20k human chip
AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT
Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes in tens of thousands of genes can be evaluated at once. Every color represents a different kind of change to a cell. It’s all about measuring energy and classifying structures, f.e. to eventually be able to mutate our building blocks into their NEXT NATURE.

euh?
can you explain that?
The title? –> the activity of cellular information made visual by this scanning technology can be read out from a chip no greater than 20k of data-space. The technology CANNOT be used to alter or mutate cells, but would we be able to… then this could be the map to use.