Search results for event

Visual of Eventually, Drones Will Be Everywhere

Eventually, Drones Will Be Everywhere

City of Drones puts you in a first person view of a drone drifting through an abstract futuristic cityscape.

Visual of Facebook Provides a Suicide Prevention Tool

Facebook Provides a Suicide Prevention Tool

Facebook provides a new tool for suicide prevention

Visual of Why some plastic packaging is necessary to prevent food waste

Why some plastic packaging is necessary to prevent food waste

There has been a surge in awareness of the damage that plastic pollution does to our planet in recent years. It has spurred a number of campaigns to remove single-use plastics …

Visual of Preventing Data Leaks with Smell

Preventing Data Leaks with Smell

The Smell of Data alerts Internet users in any case of data leakage and communicates digital hazards by means of smell.

Visual of Fake Nature can Prevent Climate Change

Fake Nature can Prevent Climate Change

Scientists are working on an ingenious approach to carbon capture that will enhance the way plants isolate carbon dioxide from other emissions in order to contain it.

Visual of Genetic Modification Could Prevent TB

Genetic Modification Could Prevent TB

It was announced this week that genetic modification allowed scientists to produce cattle resistant to tuberculosis.

Visual of Everything is an Event on the Skin

Everything is an Event on the Skin

wrote 19th-century scientist and philosopher Hermann von Helmholtz. It was Helmholtz who inspired body-architect Lucy McRae to create Morph?.

Visual of Lab-Grown Horn to Help Prevent Poaching

Lab-Grown Horn to Help Prevent Poaching

Pembient, a West Coast startup, might have a solution to the rhino-poaching problem with its lab-grown rhino horn project.

Visual of Smart Spoon with Spilling Prevention

Smart Spoon with Spilling Prevention

People with parkinson or other diseases that cause tremors or uncontrable muscular movements, eating is a major challenge. Liftware launches two smart spoons which corrects the unexpected movements of its eaters.

Visual of Preventive Punishment for Robots

Preventive Punishment for Robots

The Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".

Visual of Purple GM Tomatoes Prevent Cancer

Purple GM Tomatoes Prevent Cancer

A new strain of purple GM tomatoes last longer on shelves and help out cancer-prone mice.

Visual of Towards collective standpoints on the future of babymaking

Towards collective standpoints on the future of babymaking

For the closing event of Reprodutopia , a true meeting of minds took place as we discussed the social implications surrounding the future of reproductive technologies. Multiple …

Visual of Exploring speculative developments of reproductive technology

Exploring speculative developments of reproductive technology

What if women of childbearing age no longer had to interrupt their careers for a pregnancy? In Kuang-Yi Ku ’s project Grandmom Mom, we take a look into the future. In 2050, the …

Visual of Paradise by the Laptop Light

Paradise by the Laptop Light

Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on 23 November 2007 16:30, as part of STRP Art …

Visual of Our Image of Nature is Naïve

Our Image of Nature is Naïve

A while ago I tried to make a landscape paintings as seen on the Bob Ross television show, yet thing turned out a little bit different in my wilderness. Nature is perhaps the most …

Visual of Join us for the closing event of Reprodutopia!

Join us for the closing event of Reprodutopia!

Should men be able to give birth to children? Should we externalize pregnancy with artificial wombs? And are these feminist dreams or frankenstein nightmares? Welcome to …

Visual of Empowered by Robots Event Report

Empowered by Robots Event Report

A report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.

Visual of Robot Babies to Prevent Pregnancy

Robot Babies to Prevent Pregnancy

An Australian study has shown the use of lifelike robot babies increased teen pregnancy, rather than discouraging it.

Visual of Plastic Exoskeletons for Turtles

Plastic Exoskeletons for Turtles

Antonio Esparza designed the TurtleBag: a 3D printable exoskeleton to help turtles distinguish plastic bags from jellyfish and extend their lifespan.

Visual of Humans could recolonize Earth after mass extinctions with ectogenesis

Humans could recolonize Earth after mass extinctions with ectogenesis

Lately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …

Visual of Ecology – A New Opium for the Masses

Ecology – A New Opium for the Masses

Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …

Visual of The Embassy of Health is designing a chronically healthy society

The Embassy of Health is designing a chronically healthy society

How will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?

Visual of Simulacra and Simulations

Simulacra and Simulations

The simulacrum is never that which conceals the truth--it is the truth which conceals that there is none. The simulacrum is true. -Ecclesiastes If we were able to take as the …

Visual of 100.000 ECOs earned at ECO coin's Living Lab with Booking.com

100.000 ECOs earned at ECO coin's Living Lab with Booking.com

After last year’s successful Living labs at DGTL and Welcome to the Village we started 2018 with another. This time with Booking.com at their Annual Meeting in January where over …

Visual of The GOGBOT Conference 2019 is your guide to biotech futures

The GOGBOT Conference 2019 is your guide to biotech futures

Look around you and try to find the most natural thing in the room you are in now. It is you. But for how long? Welcome to the wonderful world of bio design ; a world full of …

Visual of The Coronation

The Coronation

For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …

Visual of The Playboy Interview

The Playboy Interview

In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …

Visual of The Anthropocene Explosion

The Anthropocene Explosion

We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.

Visual of A System that Predicts Crime

A System that Predicts Crime

An experiment tries to prevent crime by identifying aggressive behavior with new surveillance technology before actual violence is used.

Visual of Why you should attend ADE Green

Why you should attend ADE Green

ADE Green returns for the seventh consecutive year to the DeLaMar Theater in Amsterdam. Once more, Amsterdam Dance Event organizes this leading event to ignite sustainable action, …

Visual of Next Nature Interview

Next Nature Interview

For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …

Visual of The Biosphere Code Manifesto

The Biosphere Code Manifesto

During the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.

Visual of Maurizio Montalti talks about the cycle of life

Maurizio Montalti talks about the cycle of life

As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …

Visual of Anthropomorphobia

Anthropomorphobia

Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …

Visual of Nano Supermarket in Amsterdam

Nano Supermarket in Amsterdam

From Friday 28 January - Wednesday 2 Februari the Nano Supermarket will be opened at the Leidseplein in Amsterdam. Additionally, on the 27th of January we will be opened at the …

Visual of Nano Supermarket visits Pamplona, Spain

Nano Supermarket visits Pamplona, Spain

From 9 - 14 March 2011 the Nano Supermarket opens its doors in Pampona, Spain. The NANO Supermarket presents speculative nanotech products that may hit the shelves within the next …

Visual of Is Life on Earth Suicidal?

Is Life on Earth Suicidal?

At Next Nature, we often argue that "our image of nature as static, balanced and harmonious  is naive and up for reconsideration ." Paleontologist Peter J. Ward happens to agree. …

Visual of NASA Might Give the Moon a Mini-Moon

NASA Might Give the Moon a Mini-Moon

Does the moon look lonely? NASA may eventually capture an asteroid to put in orbit around the moon, providing a wealth of research opportunities.

Visual of Next Nature Talk at SXSW

Next Nature Talk at SXSW

Going to the lustrous SXSW festival in Texas this year? Don't miss out on the Next Nature presentation!

Visual of Suzanne Lee wants to live in a world that uses only sustainable materials

Suzanne Lee wants to live in a world that uses only sustainable materials

Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …

Visual of Nano Supermarket – Call for Products

Nano Supermarket – Call for Products

Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …

Visual of Amazon Tribe lacks concept of Time

Amazon Tribe lacks concept of Time

A study, in Language and Cognition has shown that time does not exist as a separate concept for the Brazilian Amondawa  – an Amazon tribe first contacted by the outside world in …

Visual of Speculative Sensing at WDCD 2015

Speculative Sensing at WDCD 2015

On may 21st, Next Nature Network art director Hendrik-Jan Grievink  will host a workshop around the idea of Speculative Sensing: exploring the potential of senses found in nature …

Visual of Every Wikipedia Article Leads to Philosophy

Every Wikipedia Article Leads to Philosophy

According to the Wikipedia page 'Wikipedia: Getting to Philosophy', more than 94% of all articles will eventually lead to the English article "Philosophy".

Visual of Save The Humans @ The Hoxton Hotel

Save The Humans @ The Hoxton Hotel

Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'

Visual of Bodily Currencies: Blood, Sweat and Tears

Bodily Currencies: Blood, Sweat and Tears

Welcome to the access and experience economy. Currency: sweat, blood and action.

Visual of Next Generation: Cooking with viruses with Pei-Ying Lin

Next Generation: Cooking with viruses with Pei-Ying Lin

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of Paradise by the Laptop Light

Paradise by the Laptop Light

Paradise by the Laptop Light is a next nature event with short films, speedlectures, special guests and one laptop. It will be held on 12 September 2008 16:30-17:30, as the …

Visual of Nano Supermarket Opens its Doors

Nano Supermarket Opens its Doors

Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …

Visual of Next Nature Introduction

Next Nature Introduction

This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image.  The facts …

Visual of Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.

Visual of A Jewel That Stops You From Checking Your Phone

A Jewel That Stops You From Checking Your Phone

For every smartphone user to recognize, is that merely the lighting of your screen, a vibration or ring distracts you from almost every activity. Even when you are spending time …

Visual of Nano-motors in Living Cells

Nano-motors in Living Cells

Scientists succeeded in implanting non toxic nano-motors into living cells.

Visual of NANO Supermarket New Line of Products

NANO Supermarket New Line of Products

During the 2014 Dutch Design Week, the NANO Supermarket debuts a new line of speculative nano products.

Visual of Intimate Technology Evening at Droog

Intimate Technology Evening at Droog

Droog Foundation and Next Nature Network invites you to join the conversation about Intimate Technology: April 23, in Amsterdam.

Visual of St. Pauli's Walls Pee Back On You

St. Pauli's Walls Pee Back On You

Tired of drunk people peeing everywhere on the street, people of St. Pauli, Hamburg decided to take a smart step to prevent it.

Visual of Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.

Visual of Streetlight Disrupts Seasonal Cycle of Trees

Streetlight Disrupts Seasonal Cycle of Trees

Prolonged exposure to artificial light prevents urban trees from adjusting to seasonal variations.

Visual of The World's First Cyborg Olympics

The World's First Cyborg Olympics

The first cyborg Olympics will take place in Zurich in October.

Visual of Opening HUBOT at DDW

Opening HUBOT at DDW

The robots have arrived! Yesterday we celebrated the launch of HUBOT , job agency for people and robots at MediaMarkt , as part of the Dutch Design Week in Eindhoven. Our virtual …

Visual of In conversation with Jalila Essaïdi

In conversation with Jalila Essaïdi

What do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …

Visual of Why there is a new urgency for speculative design

Why there is a new urgency for speculative design

Pink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …

Visual of Hello, superorganism

Hello, superorganism

When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …

Visual of Next Generation: Speculating about the future with Deborah Rhyner

Next Generation: Speculating about the future with Deborah Rhyner

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Towards a global society as a superorganism

Towards a global society as a superorganism

Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …

Visual of Next nature disasters: the Facebook outage of 2021

Next nature disasters: the Facebook outage of 2021

Where were you on the 4th October 2021? During the day that will be remembered for the Facebook outage, not everyone was equally impacted.

Visual of Why we need to get better at predicting space weather

Why we need to get better at predicting space weather

The Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.

Visual of We now have satellite traffic jams in space

We now have satellite traffic jams in space

It seems that traffic jams aren't just a problem confined to Earth's highways and byways. How did this happen? And should we be concerned?

Visual of Humans Are the Sex Organs of Technology

Humans Are the Sex Organs of Technology

Written by Kevin Kelly , published in The Technium .  I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …

Visual of MANKO & Vacuum [#2]

MANKO & Vacuum [#2]

I should tell you the story of how Manko lost a leg. You need to know about this incident to understand his recent works. So please forgive me, I first have to go back to that …

Visual of Nano Supermarket – Opening Pictures

Nano Supermarket – Opening Pictures

Last Saturday, our Nano Supermarket opened its doors in a pleasurably crowded atmosphere. Below are some snapshots of the opening event. If you happen to be in the neighborhood, …

Visual of The Anthropocene Debate: Marking Humanity’s Impact

The Anthropocene Debate: Marking Humanity’s Impact

  Is human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …

Visual of Beyond Recognition @ Sameheads Gallery, Berlin

Beyond Recognition @ Sameheads Gallery, Berlin

Coming saturday, your faithful Next Nature editor/designer Hendrik-Jan Grievink will perform Beyond Recognition – a corporate poem about the image of words , at Sameheads Gallery …

Visual of BitFriday - First Crash for Digital Currency

BitFriday - First Crash for Digital Currency

On June 10, the digital currency Bitcoin lost 30% of its value in a few hours, dropping from US $28.92 to $20.01 per coin. Bitcoins are a largely untraceable form of money, …

Visual of Next Nature Power Show 2011 Amsterdam

Next Nature Power Show 2011 Amsterdam

The Next Nature Power Show is an intellectual spectacle where artists, scientists, designers, filmmakers, architects and philosophers present their radical ideas, visionary …

Visual of Should we clone Neanderthals?

Should we clone Neanderthals?

If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …

Visual of Nano Supermarket 2nd Edition: Call for Products

Nano Supermarket 2nd Edition: Call for Products

We call upon designers, technologists and artists to submit their speculative nanotech products for the next round of the NANO supermarket.

Visual of NANO Supermarket Jury Report 2012

NANO Supermarket Jury Report 2012

After the successful introduction of the NANO Supermarket in 2010 it became even more clear that the contest and the presented results produced discussions and many challenges to …

Visual of Structuring biomimicry, improving building's resiliency

Structuring biomimicry, improving building's resiliency

The same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …

Visual of The NBIC Convergence: When Machines and Matter ‘Have Sex’

The NBIC Convergence: When Machines and Matter ‘Have Sex’

The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …

Visual of The Rise and Fall or Rayfish Footwear

The Rise and Fall or Rayfish Footwear

For almost three years, we worked on a sneaker company that we knew would go bankrupt on the day it was founded. This is our coming out...

Visual of Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings

Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings

Floris Kayak discusses online hoaxes and the future of technology.

Visual of Nature through the Windshield

Nature through the Windshield

Volume magazine interviews Next Nature founder Koert van Mensvoort.

Visual of Paint by Numbers, then Eat It

Paint by Numbers, then Eat It

An innovative workshop points out future directions for in-vitro meat products.

Visual of The Hedonometer Uses Social Media to Measure Global Happiness

The Hedonometer Uses Social Media to Measure Global Happiness

Scientists are using Twitter, blogs, and news sites to categorize the global psyche.

Visual of This Color-Changing Glass Could Stop Date Rape

This Color-Changing Glass Could Stop Date Rape

Because date rape drugs are odorless, colorless and tasteless, victims don't normally realize they've been attacked until it's too late. In a clever, necessary bit of information …

Visual of What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks

What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks

Ever notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …

Visual of NANO Supermarket TV Commercial 2014

NANO Supermarket TV Commercial 2014

Sneak peek into your nano future with the brand new NANO Supermarket TV Commercial.

Visual of Pyramid of Technology: How technology becomes nature in seven steps

Pyramid of Technology: How technology becomes nature in seven steps

How technology becomes nature in seven steps

Visual of What’s the Point If We Can’t Have Fun?

What’s the Point If We Can’t Have Fun?

Since Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.

Visual of Bistro In Vitro to Be Launched

Bistro In Vitro to Be Launched

Inspired by the award winning In Vitro Meat Cookbook , Next Nature Network and Submarine Channel present  Bistro In Vitro : an online design fiction documentary about the future …

Visual of Knotty Objects Summit @ MIT

Knotty Objects Summit @ MIT

The Knotty Object summit promises to be a paradise of anti-disciplinary delight. The event held at the renowned MIT Media Lab gathers designers, scientists, engineers and writers …

Visual of NANO Supermarket Opens in Norway

NANO Supermarket Opens in Norway

Our lustrous NANO Supermarket just opened a 100m2 pop-up store in Norway.

Visual of If a Robot Buys XTC on the Dark Web, Who is Responsible?

If a Robot Buys XTC on the Dark Web, Who is Responsible?

The Random Darknet Shopper, with bitcoin to burn, has purchased counterfeit jeans, master keys, dodgy cigs and even a bag of ecstasy tablets. Who is legally liable?

Visual of I Want Wings!!!!!!!!!!!!!!

I Want Wings!!!!!!!!!!!!!!

Read Nicholas Carr's essay on the transhumanist dream of having wings.

Visual of The Idea for Lab-Grown Meat Was Born in a Prisoner-of-War Camp

The Idea for Lab-Grown Meat Was Born in a Prisoner-of-War Camp

The phone call was as unexpected as the American accent at the other end of the line. And when she hung up a few moments later, Ira van Eelen had to stop to catch her breath. More …

Visual of Adding a new dimension to marine restoration: 3D printing coral reefs

Adding a new dimension to marine restoration: 3D printing coral reefs

The local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …

Visual of Here's all you need to know about the future of the ECO Coin (and how it came about)

Here's all you need to know about the future of the ECO Coin (and how it came about)

Today is Earth Day! This means that we think about the relationship between man, nature and technology, as technology is becoming a nature of its own. Acknowledged in 192 …

Visual of Is eSports really sport?

Is eSports really sport?

eSports is the huge industry that’s growing up around competitive online gaming. Let’s take a look at how this cyberpunk sporting world came to be.

Visual of On the origin of the e-bike

On the origin of the e-bike

The oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …

Visual of How biotechnology could shape the future of product design

How biotechnology could shape the future of product design

Humans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …

Visual of Experience biodesign at DDW19

Experience biodesign at DDW19

Bio design crosses the border between the ‘made’ and the ‘born’. Enabling living organisms as essential design elements, it brings us products that adapt, grow, sense and repair …

Visual of Why half of the world's beaches could disappear by 2100

Why half of the world's beaches could disappear by 2100

Up to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …

Visual of Can AI become addicted?

Can AI become addicted?

In 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …

Visual of Printing houses with cow poop

Printing houses with cow poop

Now here's a perspective: a pooping cow is like a living 3D printer

Visual of Billionaire space race: the ultimate symbol of capitalism's obsession with growth

Billionaire space race: the ultimate symbol of capitalism's obsession with growth

Mars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …

Visual of Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni

Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni

What if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?

Visual of The Biofabricate Summit '24 is coming to Paris!

The Biofabricate Summit '24 is coming to Paris!

Biosequin, seaweed textiles, and microbe sunscreen: these ideas and more are marking the next wave of bio-innovators during the Biofabricate Summit 2024.

Visual of The Museum of Edible Earth

The Museum of Edible Earth

We spoke with the Museum of Edible Earth, a travelling museum dedicated to the prosperous amount of soil samples.

Visual of Bioprinting in Hawai

Bioprinting in Hawai

This Fall, the 1st world Bioprinting Congress is organized in Honolulu, Hawai. Four whole days of biopatterning, bioassembly and biofabrication! The ironic choice of location …

Visual of iBiogenetics

iBiogenetics

In 1998 at the introduction of the iMac , Apple declared that the "i" stood for "internet". Apple later adopted the "i" prefix across its consumer hardware and software lines. …

Visual of You only live Twice

You only live Twice

Yes, I understand the media interest in Second Hype (Of course we don't take it serious as a virtual reality concept. Steering a mouse, sitting behind a flat screen, moving 3D …

Visual of Biggest Visual Power Show 2008

Biggest Visual Power Show 2008

The Biggest Visual Power Show is an intellectual show that blends between a conference and a pop concert. Twenty filmers, scientists, designers, artist and thinkers present …

Visual of In Space, Nobody Can See You Litter

In Space, Nobody Can See You Litter

Between the launch of Sputnik on 4 October 1957 and 1 January 2008, approximately 4600 launches have placed some 6000 satellites into orbit, of which about 400 are travelling …

Visual of BVPS Next Nature in LA - Pictures!

BVPS Next Nature in LA - Pictures!

May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …

Visual of Agenda Wallpaper

Agenda Wallpaper

Using thermochromatic ink, which changes color when the temperature exceeds a specific degree, designer Josien Pieters created a prototype of a dynamic wallpaper that …

Visual of China limits use of 'virtual' currencies

China limits use of 'virtual' currencies

By DAVID BARBOZA SHANGHAI — China made public on Tuesday regulations aimed at cracking down on the use of virtual currencies amid worries that a huge underground economy was …

Visual of How to Grow your Own Toaster

How to Grow your Own Toaster

Now here is an experiment any one can do at home: Look around in your house and try to find a consumer product of which you know where it was made and by whom. Got any? Indeed, …

Visual of Liberate the Breast Cancer Genes

Liberate the Breast Cancer Genes

On May 12, 2009 the ACLU and the (not-for-profit) Public Patent Foundation, filed a lawsuit, charging that patents on two human genes associated with breast and ovarian cancer are …

Visual of Orthorexia Nervosa: the

Orthorexia Nervosa: the "healthy" eating disorder

Following anorexia nervosa (under eating) and bulimia nervosa (overeating and compensating), orthorexia nervosa (obsessively healthy eating) is the latest eating disorder in the …

Visual of There’s Plenty of Room at the Bottom

There’s Plenty of Room at the Bottom

So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …

Visual of Goodbye, Nature vs Nurture

Goodbye, Nature vs Nurture

Talking about nature and nurture as separate, clear-cut forces is far adrift from the complexities of developmental science, says Evelyn Fox Keller in NewScientist . ONE of the …

Visual of MANKO & Plagiarism [#1]

MANKO & Plagiarism [#1]

In this first review of the works of Manko, we'll discuss the complex sorts of plagiarism in Augmented Reality art that are typical for our contemporary art scene. This introduces …

Visual of Nano Product: The Food Printer

Nano Product: The Food Printer

Are we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …

Visual of Nano-Silver Foam Condom For Women

Nano-Silver Foam Condom For Women

As we are calling for debate-provoking nanotech products that might hit the shelves of the Supermarket in the next ten years , some products much crazier than the ones we could …

Visual of Nano Supermarket on Dutch TV News

Nano Supermarket on Dutch TV News

The Dutch evening News payed a visit to our Nano Supermarket to familiarize the television viewers with the intricate world of nanotechnology and its potential impact our economy …

Visual of Nano Tattoo to Monitor Diabetes

Nano Tattoo to Monitor Diabetes

Now here is something for the NANO Supermarket : Massachusetts-based Draper Laboratories have developed a special injectable ink with nano–particles. This ink eventually could …

Visual of Self–Repairing Architecture

Self–Repairing Architecture

All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …

Visual of Self Catching Fish

Self Catching Fish

Researchers at the Marine Biological Laboratory at Wood's Hole, Massachusetts, are testing a plan to train fish to catch themselves by using a sound broadcast to attract them into …

Visual of Nano Product: Spider Silk Condoms

Nano Product: Spider Silk Condoms

Are we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …

Visual of An Ecstatic Dialogue with Richard Doyle

An Ecstatic Dialogue with Richard Doyle

When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …

Visual of Live a happy life!

Live a happy life!

Remember the movie Eternal Sunshine of the Spotless Mind, where Jim Carrey removes his memories of a relationship with Kate Winslet? According to researchers at the University of …

Visual of Manko & The Earth [#12]

Manko & The Earth [#12]

Zero: 'Where to begin? We've had many discussions in our Lab about the future of the children. The plan was simple: to raise the kids to the physical age to be 'frozen' in. Then, …

Visual of Nano Product: Pharmaceutical Sushi

Nano Product: Pharmaceutical Sushi

Are we creating the penicillin or the asbestos of the 21st century? Prior to the arrival of the Nano Supermarket , we share some speculative nanotech products with you. Here’s the …

Visual of Next Nature Hands Out Performance-Enhancing Pills

Next Nature Hands Out Performance-Enhancing Pills

Recently Google slapped our site with a warning that "something's not right here!" It seems that the Drug Enforcement Agency has caught the Next Nature staff handing out baggies …

Visual of Shopping in 2015?

Shopping in 2015?

A panacea Yoghurt? Cures athlete’s foot, acne and dandruff! Triple irradiated Spinach? Three-week shelf life! Funa sushu? Asian carp fresh from Lake Superior! Minority Report …

Visual of The Earth on Loan

The Earth on Loan

Christian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the  Next Nature …

Visual of The Neighborhood's DNA

The Neighborhood's DNA

I've noticed DNA spray notices springing up around Amsterdam.  I assumed it was a fairly standard anti-theft device:  A crime is committed, a little nozzle is activated by the …

Visual of The Search for the

The Search for the "Real" Thanksgiving

Thanksgiving is fake-for-real. While it's true that there was a minor harvest feast in 1621, held by English immigrants and Wampanoag Indians, the event was never celebrated …

Visual of The Sound of the Blue Canary

The Sound of the Blue Canary

Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …

Visual of Truck in a Truck

Truck in a Truck

Perhaps it is just us, but somehow the transport of the Nano Supermarket inside a trailer has a next nature quality to it. Peculiar image of the week. The Nano bus, which drives …

Visual of A Winery in your Microwave

A Winery in your Microwave

A delicious Montepulciano in only 6 seconds? This is now possible with the universal Nano wine. All you need is a microwave oven. In 5,64 seconds at 1000 watt you have a sublime …

Visual of 'Alp' Turns Containers into Refrigerators

'Alp' Turns Containers into Refrigerators

Transporting and displaying cold food is an incredibly wasteful and inefficient process. Current display refrigerators, like those that display meats or cheeses in supermarkets, …

Visual of Complete Computer Simulation of a Bacterium Holds Hope for Medicine

Complete Computer Simulation of a Bacterium Holds Hope for Medicine

Researchers at Stanford and the J. Craig Venter Institute  recently created the first complete computer model of an organism. The simulation models the genome and life processes …

Visual of Time Between Emergence and Design

Time Between Emergence and Design

Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.

Visual of NANO Supermarket in Rotterdam

NANO Supermarket in Rotterdam

This week our lustrous NANO Supermarket visits Rotterdam as part of Dutch Electronic Art Festival . Come learn, discuss, and taste some medicinal chocolate. Have better ideas for …

Visual of NANO Supermarket Unveils New Products

NANO Supermarket Unveils New Products

From sleek fashion to life-saving medicines. During the forthcoming Dutch Design Week , our lustrous NANO Supermarket debuts a new line of speculative nano products that might hit …

Visual of Nanotech Bracelet Detects Allergies

Nanotech Bracelet Detects Allergies

Designed by Luc de Smet, Awear is a speculative bracelet that can detect and record the sources of allergies for children in uncontrolled environments, such as schools and …

Visual of Screw Technology

Screw Technology

In this particular piece of video art, loyal readers of nextnature.net might recognise the building as Zeche Zollverein in Germany, where we organized the Biggest Visual Power …

Visual of Spray On Liquid Glass

Spray On Liquid Glass

Now here is a product that should soon find its way into the NANO Supermarket soon. At least, if supermarkets are willing to put it on their shelves, as they currently make huge …

Visual of The Ecological Human

The Ecological Human

The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …

Visual of We’re lecturing in Milan (if you ask us)

We’re lecturing in Milan (if you ask us)

From april 17-20, a large deal of the Next Nature crew will be in Milan , Italy. We will bring our lustrous  Nano Supermarket to this year’s edition of the Salone Internationale …

Visual of Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology

Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology

An interview about the history and promises of synthetic biology, and the problem with the word "nature".

Visual of Computer Teaches Itself to Play Games

Computer Teaches Itself to Play Games

An algorithm observes human players to learn how to beat Super Mario Bros.

Visual of Interview: Arne Hendriks, Researcher and

Interview: Arne Hendriks, Researcher and "Father" of The Incredible Shrinking Man

Hendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.

Visual of Join us for the Other Dinner

Join us for the Other Dinner

If you happen to be in Amsterdam this weekend, attend the other dinner at Waag Society.

Visual of Why Meat Grown in Labs is the Next Logical Step for Food Production

Why Meat Grown in Labs is the Next Logical Step for Food Production

Lab grown meat is part of the trajectory that agricultural technology is already following.

Visual of Q&A with CEO of In Vitro Meat Company

Q&A with CEO of In Vitro Meat Company "Modern Meadow"

Excerpts from the Rebbit AMA with Andras Forgacs, founder of a company that manufactures in vitro meat.

Visual of The First Recorded Attack on a Cyborg

The First Recorded Attack on a Cyborg

Looking back on the first recorded attack on a human cyborg.

Visual of What You Feel Is What You Get - Smartphone for the Blind

What You Feel Is What You Get - Smartphone for the Blind

A revolutionary new smartphone for the blind uses a completely tactile interface.

Visual of Artificial Cells Built From Silicon

Artificial Cells Built From Silicon

Scientists designed artificial cells built from silicon, able to copy basic functions of life.

Visual of Bioplastic Made of Pressed Insect Shells

Bioplastic Made of Pressed Insect Shells

Aagje Hoekstra has developed a bioplastic made of of dead beetles called Coleoptera.

Visual of Drone Crash

Drone Crash

During a triathlon ace a drone operated by a local photographer hit one of the athletes.

Visual of In Vitro Meat: Animal Liberation?

In Vitro Meat: Animal Liberation?

Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.

Visual of Nano Product: CloudCrayons

Nano Product: CloudCrayons

CloudCrayons: cloud coloring rockets.

Visual of Nano Product: The Healing Game

Nano Product: The Healing Game

The Healing Game: a playful medicine.

Visual of NANO Supermarket Best Product 2014

NANO Supermarket Best Product 2014

A jury of design and science experts awarded the best NANO Supermarket product a € 2.500 prize.

Visual of Next Nature and the Curse of Oil

Next Nature and the Curse of Oil

The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.

Visual of What Bits Want

What Bits Want

Digital bits have lives. They work for us, but we totally ignore them. What do bits really want? Here are the life stories of four different bits.

Visual of 3D Printed Fish Remove Toxins and Deliver Drugs

3D Printed Fish Remove Toxins and Deliver Drugs

Researchers from UC San Diego announced that they have developed 3D print tiny microrobots in the shape of fish able to detect and remove toxin from liquid.

Visual of Could Biomimicry Help us Solve the Refugee Crisis?

Could Biomimicry Help us Solve the Refugee Crisis?

From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.

Visual of Botox Makes it Harder to Feel Emotions

Botox Makes it Harder to Feel Emotions

Studies suggest that Botox impairs the ability to process the emotional content of language, limiting the quality of emotional experiences.

Visual of First Puppies Born by In Vitro Fertilization

First Puppies Born by In Vitro Fertilization

Thanks to the work of researchers at Cornell University (USA), for the first time a litter of puppies was born entirely from in vitro fertilization.

Visual of Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory

Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory

We recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.

Visual of NANO Supermarket Opens in Latvia

NANO Supermarket Opens in Latvia

The tour of our lustrous NANO Supermarket is coming to Riga, Latvia.

Visual of Self-Healing Concrete

Self-Healing Concrete

A microbiologist has developed a way to make the cracks in concrete structures heal themselves.

Visual of Solar Eclipse May Impact Power Supply Due to Increased Use of Solar Panels

Solar Eclipse May Impact Power Supply Due to Increased Use of Solar Panels

Solar eclipse may impact power supply due to increased use of solar panels

Visual of The Drone Circus

The Drone Circus

The first ever circus consisting entirely of drones is coming to Amsterdam. This fall the Amsterdam Arena will host a choreographed airshow using nothing but drones combined with …

Visual of Wasps Inspire Robotic Needle for Surgery

Wasps Inspire Robotic Needle for Surgery

The Wood-Boring Wasp inspired scientists to create a new robotic needle which will be used in brain surgery.

Visual of Brexit: the Cultural Climate Warms Up

Brexit: the Cultural Climate Warms Up

On the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.

Visual of But will lab-grown meat be kosher?

But will lab-grown meat be kosher?

Read Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.

Visual of Fitness Trackers Help Improve Cycle Paths

Fitness Trackers Help Improve Cycle Paths

Tracking your workout can help improve the safety and optimize routes for cyclists and pedestrians in your town.

Visual of Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body

Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body

Speculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.

Visual of Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.

Visual of Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview with Mike Thompson and Susana Cámara Leret.

Visual of The New Cinema Is Smartphone-Friendly

The New Cinema Is Smartphone-Friendly

Cinemas for Millennials will include special sections where texting is allowed.

Visual of Re-introducing Extinct Species

Re-introducing Extinct Species

Extinct European bisons are being reintroduced in parks. But what makes a national park?

Visual of Self-Driving Trucks Hit the Highways

Self-Driving Trucks Hit the Highways

A driverless convoy of trucks drove through Europe and safely arrived in Rotterdam yesterday.

Visual of Rio 2016: the Olympic (Green) Abyss

Rio 2016: the Olympic (Green) Abyss

Last week the Olympic women’s diving pool at the Maria Lenk Aquatics Centre mysteriously turned swampy green overnight.

Visual of 1916 - Artificial Womb Appeared in Cinema

1916 - Artificial Womb Appeared in Cinema

In 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.

Visual of AI Defeats Human at Go

AI Defeats Human at Go

Go world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.

Visual of Artificial Womb Workshop at BioClub Tokyo

Artificial Womb Workshop at BioClub Tokyo

On August 8, NNN gave a workshop at BioClub Tokyo to share some insights on the future of technologies concerning human reproduction, sexuality and relationships.

Visual of Digital Detox: Disconnect to Reconnect?

Digital Detox: Disconnect to Reconnect?

Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!

Visual of Growing Mushrooms on Grass

Growing Mushrooms on Grass

The Juncao Technology Project makes it possible to grow edible and medicinal fungi on chopped grass or herbal plants.

Visual of Next Nature Habitat VR Wins Sweden VR Award

Next Nature Habitat VR Wins Sweden VR Award

Our Next Nature Habitat VR experience has won the Sweden International Virtual Reality Award in the category Best 360 Video!

Visual of Designer Anouk Wipprecht combines fashion with robotics

Designer Anouk Wipprecht combines fashion with robotics

We met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.

Visual of When the Sun Casts Its Vote

When the Sun Casts Its Vote

Space weather can influence elections on Earth.

Visual of A Virtual Reality Retreat

A Virtual Reality Retreat

Are we sleepwalking into our technological future?

Visual of How AI and genomics will impact the future of making babies

How AI and genomics will impact the future of making babies

As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …

Visual of What an artificial womb may look like in the future

What an artificial womb may look like in the future

In the future, artificial wombs could replace incubators as they mimic the natural environment of the female uterus. But what will these devices look like?

Visual of How this self-sustainable microhome may change the future of housing

How this self-sustainable microhome may change the future of housing

Looking for a self-sustainable mobile microhome? Ecocapsule got you covered. This cute-as-pie capsule pod allows you to live completely off the grid in a low-energy, mobile …

Visual of On inhumane technology

On inhumane technology

Stick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …

Visual of On the origin of the word processor

On the origin of the word processor

Writing is recognised as one of mankind’s foremost inventions and the mechanization of writing is one of these developments that typify what is commonly regarded as the work of …

Visual of The return of Rayfish Footwear?

The return of Rayfish Footwear?

Rayfish Footwear was a fictional company that offered personalized sneakers crafted from genetically modified stingray leather. This online science fiction story allowed customers …

Visual of Welcome spring with this selection of NANO Supermarket products

Welcome spring with this selection of NANO Supermarket products

Well, we finally made it. After a long, cold, dark winter, spring has officially started today. And guess what it's bringing with it? Nope, not spring flowers: Love flowers! …

Visual of The Story of Money: Plastic

The Story of Money: Plastic

The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. This episode: plastic.

Visual of 3D-printing food waste into tasty products

3D-printing food waste into tasty products

Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …

Visual of The Forgotten Plan to Coat Utah's Delicate Arch with Plastic

The Forgotten Plan to Coat Utah's Delicate Arch with Plastic

Arches National Park, located in Utah, is home to some of America's most beautiful rock formations. The most famous of them, Delicate Arch, has always been, well, pretty delicate. So much so that back in the 1940s, park rangers hatched a plan to preserve the natural monument - by coating it in plastic.

Visual of This artificial reef was just deployed in Sydney Harbor

This artificial reef was just deployed in Sydney Harbor

Earth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …

Visual of The artificial womb: dream or nightmare?

The artificial womb: dream or nightmare?

The emerging technology of the artificial womb confronts us with a series of moral and societal questions. How to cope with that? Join us on 29 March at Eindhoven University of …

Visual of Beyond biomimicry: a new urgency

Beyond biomimicry: a new urgency

Designers face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …

Visual of 5 things to do at DDW19

5 things to do at DDW19

Lining up plans for Dutch Design Week ? Once more, 2600 designers gather in over 120 locations during 450 events. So whether you're a local, new in town, or just passing through, …

Visual of Human-animal hybrids could be used for growing organs

Human-animal hybrids could be used for growing organs

Around the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …

Visual of Discussing bio-based material experiences with Elvin Karana

Discussing bio-based material experiences with Elvin Karana

The world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …

Visual of Next Generation: Visualising the diversity of microbial species with Valerie Daude

Next Generation: Visualising the diversity of microbial species with Valerie Daude

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of The Coming World: ecology as the new politics

The Coming World: ecology as the new politics

In science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …

Visual of 3 future farms that can feed the planet and heal it too

3 future farms that can feed the planet and heal it too

Intensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …

Visual of Smart cities could give the visually impaired a new outlook on urban life

Smart cities could give the visually impaired a new outlook on urban life

Travelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …

Visual of What is a species?

What is a species?

A koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …

Visual of A path to humane technology

A path to humane technology

In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …

Visual of AI Song Contest: the show must go on!

AI Song Contest: the show must go on!

The spread of the coronavirus has led to the cancellation or postponement of many events around the globe. Luckily there are still events we can look forward to, such as the AI …

Visual of How Amazon trees write their own autobiographies

How Amazon trees write their own autobiographies

Tropical forests are one of the world’s largest carbon stores and they help regulate the global climate. But they’re being erased at a terrifying rate. Deforestation claimed an …

Visual of How climate fiction novels allow us to imagine possible futures

How climate fiction novels allow us to imagine possible futures

Every day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …

Visual of Next Generation: Combining AI with human creativity with Sofia Crespo

Next Generation: Combining AI with human creativity with Sofia Crespo

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Talking non-human nonsense with Nonhuman Nonsense

Talking non-human nonsense with Nonhuman Nonsense

Nonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …

Visual of Swiping is the new touching

Swiping is the new touching

From all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …

Visual of How technology keeps us connected

How technology keeps us connected

At this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …

Visual of A digital twin of the Earth could make the planet climate-neutral

A digital twin of the Earth could make the planet climate-neutral

While Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …

Visual of How telecommunication cables could help detect earthquakes

How telecommunication cables could help detect earthquakes

At the bottom of the Earth’s oceans lies an intricate network of over a million kilometres of fibre optic cables. These cables were laid on the seabed by telecommunication …

Visual of Join us at the DDW Talks: Next Biodiversity

Join us at the DDW Talks: Next Biodiversity

The influence of humans on the earth can hardly be underestimated. Think of climate change, deforestation, and the decline of biodiversity. We are heading for a sixth mass …

Visual of Join us at the Embassy of Food Conference

Join us at the Embassy of Food Conference

Promising food design projects do not always find their way to producers, the market and ultimately to consumers. Why is that and what can we do to advance these ideas? Why is it …

Visual of Next Generation: Shaping intimacy through objects with Pleun van Dijk

Next Generation: Shaping intimacy through objects with Pleun van Dijk

Pleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.

Visual of Animals are shapeshifting to cope with climate change

Animals are shapeshifting to cope with climate change

Global warming is a big challenge for warm-blooded animals, which must maintain a constant internal body temperature. As anyone who’s experienced heatstroke can tell you, our …

Visual of Join the Next Nature Talkshow on biodesign!

Join the Next Nature Talkshow on biodesign!

A living lamp that you need to feed, a tapestry made of animal waste streams and tableware made from algae. Welcome to the wonderful world of biodesign.

Visual of Understanding the ocean's metabolism

Understanding the ocean's metabolism

Scientists have discovered the effect of sunscreen on corals. We need to understand our impact on the world to understand its problems.

Visual of The Limits and Beyond: A report about the future

The Limits and Beyond: A report about the future

In 1972, the Club of Rome published The Limits to Growth, a report about the future of the world. They described the limits of the world’s resources and what it is capable of …

Visual of Sónar Lisboa: a festival for body and brain

Sónar Lisboa: a festival for body and brain

Sometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …

Visual of AI meal planner suggests humans to cook with human flesh and bleach

AI meal planner suggests humans to cook with human flesh and bleach

AI sure knows how to throw a banger of a dinner party. One that guests will never forget - or outlive. When New Zealand grocery store chain PAK’nSAVE introduced their new …

Visual of Bacteria might have eaten the Titanic's wreckage by 2030

Bacteria might have eaten the Titanic's wreckage by 2030

In 1912, the RMS Titanic met a fateful demise as it crashed into the depths of the North Atlantic Ocean, leaving a mark on the world's collective memory, and igniting a lasting …

Visual of Meet Indonesia's virtual news anchors

Meet Indonesia's virtual news anchors

Virtual news anchors seem to spread like wildfire across Asia. We've witnessed Xinhua present the news from China and applauded Lisa on becoming India’s first regional AI news …

Visual of This device helps you to control your lucid dreams

This device helps you to control your lucid dreams

What if we could control our dreams? In the near future, this might become a reality. Prophetic developed a new technology that enables lucid dream control. 

Visual of Seeking Symbiosis

Seeking Symbiosis

Visual artist Heleen Blanken explores the complex relationship between people, nature and technology.

Visual of Next Nature is ancient

Next Nature is ancient

Uli Westphal's Seed Series is an ongoing attempt to document the seeds of all edible plants, one seed at a time.

Visual of 20k human chip

20k human chip

AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …

Visual of Biggest Visual Powershow: Photo report

Biggest Visual Powershow: Photo report

The pictures of the Next Nature Biggest Visual Powershow , in Zollverein are now online! Powershowmaster Koert van Mensvoort and Claudia (most advanced robot in the world). …

Visual of Entryparadise

Entryparadise

Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …

Visual of Close to skin technology

Close to skin technology

Wearable Interfaces, Smart Materials and Living Fabrics. V2_, Institute for the Unstable Media, Rotterdam, and Amsterdam-based Virtueel Platform, the expertise centre for …

Visual of Info Toaster

Info Toaster

Toasted bread as an information display device (originally developed in 2001 but somehow still intruiging): a toaster that parses meteorological information from the web and then …

Visual of NEXT NATURE Biggest Visual Power Show

NEXT NATURE Biggest Visual Power Show

The Biggest Visual Power Show is an intellectual show that blends between a conference and a pop concert. Over twenty arists, filmers, philosophers, politicians and designers …

Visual of Park-card

Park-card

Business card slash micro-terrain by Tur & Partner, landscape architects. It's a portable garden: impregnated with seeds, in the photosynthetic presence of sunlight and water, the …

Visual of The Sleeping Garden

The Sleeping Garden

How to design an expierience of retrieving in nature in the middle of Holland's second-biggest city? Design a park, built entirely from used railway sleepers. That was the basic …

Visual of A Tomb for All People

A Tomb for All People

Those crazy Germans are planning to build modern versions of pyramids that will function as gigantic burial sites. "The Great Pyramid can potentially be any human being's grave or …

Visual of Anti-Protection Vest

Anti-Protection Vest

Let us pretend you are a soldier and you are being sent to war. One of the first questions that should pop into mind: how will you prevent yourself from getting shot? Armor that …

Visual of Augmented Cognition

Augmented Cognition

The Augmented Cognition System will help the brain adapt to data on computer-screens. If there's too much/little data, it will decrease/increase the information for you. If the …

Visual of Augmented Fish Reality

Augmented Fish Reality

Augmented Fish Reality is an interactive installation of five rolling robotic fish-bowl sculptures. These sculptures allow Siamese Fighting fish (Betta Splendons) to use …

Visual of Biggest Visual Power Show 2006, Video

Biggest Visual Power Show 2006, Video

At the Biggest Visual Power Show 2006 , held in Zollverein, Germany, over twenty artists, designers, filmmakers and philosophers gave their view on Next Nature. Click to watch the …

Visual of Breaking Point?

Breaking Point?

John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …

Visual of Call for Proposals: One Day left!

Call for Proposals: One Day left!

One week left to send in your Designing for Next Nature proposals in round #1 . A selection of the proposals of round#1 is invited for a 5 minute presentation on 23 November 2007 …

Visual of Chewing = Browsing

Chewing = Browsing

Japanese researchers have developed head gear that lets people control devices such as an iPod using their teeth. Now that is not really new, except when you take in mind that …

Visual of Crop Circles

Crop Circles

In the UK farmers recall simple circles appearing on their land for generations. The British media first reported on the circles in the early 1980s. By 1990 crop circles had …

Visual of Designer pets

Designer pets

If your house just isn't big enough to have a leopard, you can allways buy these 20.000 dollar cats. Nailcaps are included to prevent scratches on the matching cat furniture. I …

Visual of Humans to Blame for Global Warming

Humans to Blame for Global Warming

Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …

Visual of Liquid armor

Liquid armor

The US Army Research Lab in collaboration with the University of Delaware developped a special liquid called s hear thickening fluid . It is actually a mixture of hard …

Visual of Moon Tanning?

Moon Tanning?

Feel unhappy? Little depressed? Headaches? Why not try a little trip to de Arizona desert? Richard Chaplin built the Interstellar Light Collector. As is often the case, tragedy …

Visual of Never mind guitar solo's | ReacTable

Never mind guitar solo's | ReacTable

Ever seen a performance of electronic musicians? No matter the genre, these events don't have the reputation of being very lively, rock 'n roll-like experiences. In the best case, …

Visual of Next Nature Picnic - August 5th

Next Nature Picnic - August 5th

Next weekend is a good moment for a next nature picnic. The Dutch ministry of Tures (Ministerie van Turen) invited us to their strawcastle (pictured above) for a nice picnic …

Visual of Next Friday: Paradise by the Laptop Light

Next Friday: Paradise by the Laptop Light

Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on Friday 23 November 2007 16:30 - 18:00, as …

Visual of Not A Cornfield

Not A Cornfield

"Not A Cornfield" is a project (2005) by Artist Lauren Bon. It's a living sculpture in the form of a field of corn east of Downtown Los Angeles. The site - historically a train …

Visual of Out of Control

Out of Control

The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …

Visual of People in Need Campaign

People in Need Campaign

Every next nature typically parasites on some older nature, which as a result dries out and eventually vanishes. Only rarely this mechanism is made visible. The Dutch charity …

Visual of Review Paradise by the Laptop light

Review Paradise by the Laptop light

A review by Djbroadcast on the Paradise by the Laptop Light event last week. Sorry it is all so Dutch. Wat betekent het begrip natuur voor ons vandaag de dag? We zien 'de groene …

Visual of Toys'R'Us

Toys'R'Us

March 2007 gave birth to Knut, the übercute baby icebear in the Berlin Zoo. A unique event, since it was 30 years ago a baby icebear was born in the zoo. Within weeks, Knut has …

Visual of A Garden Raised by Television

A Garden Raised by Television

  This installation is called Feed and raises ferns that can survive under conditions of extreme lighting. The television screens provide light to the plants, which grow …

Visual of Blobman

Blobman

This landscape is titled 'I can not help the way I feel' and was created by John Isaacs . The way in which the flesh grows, erupts and engulfs the body can be seen as a metaphor …

Visual of Hail Control Gun

Hail Control Gun

A single hail storm can destroy the year's harvest. For over 25 years, this gun has been used by vine and fruit growers in France, Spain, Austria and Belgium for one purpose: …

Visual of Lecture in San Diego

Lecture in San Diego

Lecture on Next Nature this Wednesday at the UCSD Center for Research in Computing and the Arts in San Diego. Expect wild trees, wild beaches, and wild systems.

Visual of Let the Dutch bury the Carbon

Let the Dutch bury the Carbon

Too much carbon emissions warming up the planet? No problem: just bring the stuff back to where you got it from in the first place. Experts have been advising to bury carbon …

Visual of Next Rabbit

Next Rabbit

This is not a 3-D-animation of a fictional creature, but an actual existing animal: the Angora Rabbit.

Visual of Power Show 2008 at Million Dollar Theater LA

Power Show 2008 at Million Dollar Theater LA

Location announcement: The upcoming Biggest Visual Power Show 2008 on Next Nature will take place at the recently renovated Million Dollar Theater on 307 Broadway, Downtown LA. …

Visual of RepRap - a self-reproducing machine

RepRap - a self-reproducing machine

The RepRap is a selfreproducing 3D printer. The 3D printer 'prints' his own components by melting tiny plastic particles together. Imagine what would happen if this 3D printer …

Visual of Next Nature Newsletter

Next Nature Newsletter

Now is a good moment to join the low-volume Next Nature email newsletter featuring the most peculiar of our recent explorations as well as announcements of Next Nature related …

Visual of Smart Forests - EWAN

Smart Forests - EWAN

At Massachusetts Institute of Technology , Christopher Love and colleagues are working to find out whether energy from trees can be used to prevent forest fires. A sensor system …

Visual of Sneakpreview

Sneakpreview

This week we are sneak previewing our forthcoming compilation DVD featuring the best of the Biggest Visual Power Shows at the Picnic 08 - E-art event on 24,25,26 September at …

Visual of The Evolution of the Richer

The Evolution of the Richer

Are we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …

Visual of The mobile evolution

The mobile evolution

In our NextNature event BVPS (May 2008), Kevin Kelly spoke of technology as the 7th kingdom of life : a form of evolution whithout the nasty side–effect of dying (Every object …

Visual of Today: Paradise by the Laptop Light

Today: Paradise by the Laptop Light

Eat the fruit. Kiss the Snake. Today 16:30-17:30: Paradise by the Laptop Light is the opening event of the Wereld van Witte de With Festival .

Visual of Soft Drinks for Suckers

Soft Drinks for Suckers

Tru Blood is a synthetic nutrient for vampires that completely eliminates the need to seek sustenance from any living creature. Packaged as a consumer good at your local …

Visual of 20 Pound Mouse Pointer

20 Pound Mouse Pointer

The recent discussion on boomeranged metaphors reminded me of this 20 pound mouse hand created a some years ago for a Paradise by the laptop light event on Next Nature. The …

Visual of A Future Love Story

A Future Love Story

By MARCEL VAN DER DRIFT. Ten years from now, a cell phone gently sinks to the bottom of the river. It's one of the latest models. The clever design, trendy colours and nifty …

Visual of Bioinstinct

Bioinstinct

Designer Laura Boffi envisions a future in which human instincts will leap behind on technological progress. For example, once the 'disease called mortality' is cured with …

Visual of Brain Scan Replaces Job Interview in 5 Years?

Brain Scan Replaces Job Interview in 5 Years?

Forget about palmistry! MRI scans for candidates in top jobs such as bank directors could soon become part of the job-application package, says Erasmus University researcher Prof …

Visual of Designing Bugs That Eat Plastic

Designing Bugs That Eat Plastic

It is a well known secret that plastic hardly breaks down and almost all of the plastic ever made still floats around somewhere . With the great pacific garbage patch now twice …

Visual of Digital Overruns Nature: Pixel Attack

Digital Overruns Nature: Pixel Attack

Apparently, camouflaging oneself with digital patterns rather than nature-imitated patterns functions as a better camouflage within "old-nature" situations. So the digital …

Visual of Fresh from the Pharm

Fresh from the Pharm

Will we in the future still buy several needs according food in shops, or will we grow M&M’s ourselves? There is a lot happening on in the field of food technology , think for …

Visual of Future babes

Future babes

A future in which prosthetic patches prevent bodies from aging? Or a sexists view on femininity in robotics?   Either way, the question is whether they are up- or downgrades of …

Visual of How biotech will drive our evolution

How biotech will drive our evolution

Are you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …

Visual of KOBIAN Shows Emotion

KOBIAN Shows Emotion

Meet KOBIAN, the humanoid robot that is not only able to walk about and interact with humans, but uses its entire body in addition to its facial expressions to display a full …

Visual of Live with Micro-Algae

Live with Micro-Algae

The Eco Pod is a experimental design proposal towards the production of clean and renewable energy, which should operate in old, abandoned buildings. Pending an eventual recovery, …

Visual of Living Root Bridges

Living Root Bridges

In the depths of northeastern India, one of the wettest places on earth, bridges aren't built – they're grown. What could 21th century architects learn from these dynamic …

Visual of Doggerland – Mapping a Lost World

Doggerland – Mapping a Lost World

So you think climate change is new? So you think the flooding of landmass by the oceans is a new? So you must have not heard of the times when people walked from London to …

Visual of Millions of gadgets unused in Britain

Millions of gadgets unused in Britain

Gadgets! You love them when you buy them, but what happens next? Over half of Brits have abandoned gadgets because they don't know how to use them properly.  Seventy-one per cent …

Visual of Moscow won't let it snow

Moscow won't let it snow

Already in the early days of modern civilization, people claimed that they could control the weather. A known example from recent history are the rituals that American Indians …

Visual of Nanocars

Nanocars

This smart-looking image is a model of what James M. Tour at Rice University (Texas) and his research team like to call a 'nanocar'. The clustered molecules can roll around on a …

Visual of Pimp My Planet

Pimp My Planet

"We live in a time where everything or everyone can be upgraded or ‘pimped'. After the worldwide acceptance of plastic surgery, it was time to subject our worldly possessions …

Visual of Second Sight - Augmented Contacts

Second Sight - Augmented Contacts

Getting information as fast as possible and on the spot is the trend. So what could be more direct than having information fired directly into the eye? Today - together with his …

Visual of The World Without Technology

The World Without Technology

I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …

Visual of Virtual Money Is a Pleonasm

Virtual Money Is a Pleonasm

Have you heard the buzz on virtual money in online games? Some years ago the first virtual millionaire was announced, yet there have also been reports on people being practically …

Visual of Wild Birds Illegally Immigrating to City Zoo

Wild Birds Illegally Immigrating to City Zoo

Besides the extensive collection of animals from around the planet, the Amsterdam City Zoo Artis also houses some local wild species on its premises who immigrated into the zoo on …

Visual of Wrapping Greenland

Wrapping Greenland

The Discovery series 'Ways to save the planet' the episode 'Wrapping Greenland ' shows how Dr. Jason Box uses reflective blankets to cover glaciers in Greenland. Due to global …

Visual of Adaptive Bloom

Adaptive Bloom

This interactive installation came out of the Postgraduate Certificate Course in Advanced Architectural Research of the Bartlett School of Architecture in London. Graduate Justin …

Visual of Castle Duivenvoorde

Castle Duivenvoorde

That Next Nature is nothing new can be proven in a walk around Castle Duivenvoorde. The castle dates back from the 11th century, while the gardens date from 1631. In a time where …

Visual of Climate Craze in Russia

Climate Craze in Russia

Climate change is often thought to have its winners and losers, with Canada, Nordic countries and Russia being portrayed as among the lucky few chilly nations where moderate …

Visual of Cultivating the Money-verse

Cultivating the Money-verse

Alright, we were mistaken. Money isn't virtual after all.   A recent TV commercial of a Greek bank shed light on the issue. Your money lives, is anthropomorphic and inhabits an …

Visual of Downriver in the Lowlands

Downriver in the Lowlands

The Netherlands is known for its outright flat landscape – its even part of the name. How come the Dutch Womans Youth Rafting Team just won the World Cup in the category …

Visual of ECO Currency – A Proposal to Balance Economical and Environmental Value

ECO Currency – A Proposal to Balance Economical and Environmental Value

Imagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …

Visual of Engineered Bacteria heal Cracks in Walls

Engineered Bacteria heal Cracks in Walls

Researchers have designed bacteria that can produce a special glue to knit together cracks in concrete structures. Technews Daily reports the genetically modified microbes have …

Visual of Follow The Money

Follow The Money

If you happen to be in the neighborhood, you may want to attend the lecture I will be throwing at the Follow the Money – The database as a narrative form conference this Thursday …

Visual of From Main Street to the Mansion: Disney, Playboy and the Next Nature of Sex and Death

From Main Street to the Mansion: Disney, Playboy and the Next Nature of Sex and Death

Nature demanded that we make a choice between immortality and sex, but the Next Nature of the 21st century may not. For help, we can look back to the 20th Century, which had many …

Visual of Having Invented the Gods, Perhaps we can Turn into Them

Having Invented the Gods, Perhaps we can Turn into Them

My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …

Visual of Join the Designers & Artists 4 Genomics Award

Join the Designers & Artists 4 Genomics Award

So, you are well aware that biotech will drive our evolution , you took the crash course on synthetic genomics , you've got your map of the DNA world in your backpack and are now …

Visual of Kosher Coke

Kosher Coke

Last week I opened a bag of potato crisps that read: "We know the origins of all our ingredients" . As some crisps had already disappeared down my throat, this made me suddenly …

Visual of Let the Bacteria do the Cleaning

Let the Bacteria do the Cleaning

Dusting furniture and floors should be history in forty years time, as special bacteria in a yet to develop cleaning product will be eating the dirt. The speculative cleaning …

Visual of NANO Supermarket – Introducing the Jury

NANO Supermarket – Introducing the Jury

Ten days left to submit your speculative product idea for the Nano Supermarket . The jury that will select the finest submissions – to be exhibited in the Nano Supermarket this …

Visual of Nano Supermarket – Jury Report

Nano Supermarket – Jury Report

Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …

Visual of Rare mutation: Razorius Gilletus Vectrus

Rare mutation: Razorius Gilletus Vectrus

If you haven't read the recently posted essay " Razorius Gilletus – On the Origin of a Next Species ?", you probably won't understand much of the following. Anyhow, I'd want to …

Visual of Runaway Robots Hunted by the Mammals They Were Designed to Replace

Runaway Robots Hunted by the Mammals They Were Designed to Replace

Last week, the U.S. Navy announced that four of their “ REMUS 100 ” unmanned underwater vehicles sailed off-radar and stopped responding to commands. The ‘bots were part of a …

Visual of The Buttons

The Buttons

Nowadays buttons are completely mundane and natural objects in our environment. You find them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the …

Visual of The Stray Shopping Cart Project

The Stray Shopping Cart Project

"Until now, the major obstacle that has prevented people from thinking critically about stray shopping carts has been that we have not had any formalized language to differentiate …

Visual of The Virtual Lives of Extinct Animals

The Virtual Lives of Extinct Animals

What happens when next nature dreams of old nature? Such is the case with extinct animals that have ever come in contact with humans, particularly the dinosaurs, our own …

Visual of X-Ray Visions

X-Ray Visions

Anyone who ever saw an x-ray picture of himself will probably recognise the uncanny feeling of staring at your own skull or bones and being confronted by one of nature’s grim …

Visual of Back to the Tribe

Back to the Tribe

Traditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …

Visual of Biomodd at work

Biomodd at work

Modding is the act of adapting hardware/software to have it do what you want it to do, which does not always correlate with what it is originally built to do. Biomodd (ding) is …

Visual of Birdfeeders spit Blackcaps in two species

Birdfeeders spit Blackcaps in two species

Until now, most people have likely regarded bird-feeders as merely a pleasant addition to their gardens. But scientists have now discovered that bird-feeders in the UK are …

Visual of Body Manipulation and Music

Body Manipulation and Music

Lucy McRae uses spandex to deterritorialize the body. #powershow #bodyart http://bit.ly/th7KyR

Visual of Browsing the Technological Sublime

Browsing the Technological Sublime

In this video, Geert Mul uses online photos to tap into the divine presence in image search #powershow http://bit.ly/uk79b0

Visual of Cheiracanthium drives a Mazda

Cheiracanthium drives a Mazda

In March, Mazda recalled 65,000 cars, not because of any structural faults in the vehicle, but because the engineers had inadvertently created the perfect habitat for a tiny …

Visual of City Living Splits Up Blackbirds

City Living Splits Up Blackbirds

Some blackbirds have found city living so much fun (the theater scene! the restaurants!) that they have given up migrating south for the winter. Cities are usually warmer than the …

Visual of City Planning with Bright Bacteria

City Planning with Bright Bacteria

Renegade architect and futurist  Rachel Armstrong has proposed that our cities, currently constructed of dead trees, baked mud, and refined ore, need to be coated in a layer of …

Visual of Drugs are Nuts

Drugs are Nuts

Thinking about Next Nature can sometimes result in a feeling of vertigo. Normal standards are eroded and slowly replaced by next natural ones. A bewildering example can be found …

Visual of Get Vegetarian Teeth and Eat Less Meat

Get Vegetarian Teeth and Eat Less Meat

Want to live a greener life? Eat less meat. Recently the UN appealed for a radical shift in diet , to improve individual health and ease conditions affecting the global …

Visual of First Lab-Grown Organ Transplanted

First Lab-Grown Organ Transplanted

Another step in the fusion of the made & the born: Surgeons in Sweden have successfully transplanted a fully synthetic, tissue-engineered organ – a trachea– into a man with …

Visual of Get Thee Up into a Fake Mountain

Get Thee Up into a Fake Mountain

If you felt like building a 2,000 meter mountain in the Netherlands, which features would you like to add? Journalist and accidental landscape visionary Thijs Zonneveld wants to …

Visual of Human Furniture

Human Furniture

This unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …

Visual of Incredibly Shrinking Humanity

Incredibly Shrinking Humanity

Arne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow

Visual of Manko & Death [#11]

Manko & Death [#11]

Manko had been here before. Being just thoughts, surrounded by nothing. He felt glad his thoughts were there, one after the other, so there had to be a form of time and therefore …

Visual of Manko & Life [#8]

Manko & Life [#8]

Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …

Visual of Manko & Nothing [#5]

Manko & Nothing [#5]

Manko was completely cut off from everything around him, virtually dead, buried alive inside of his own body. He remembered Zero's advice not to panic, but to no effect. He had no …

Visual of Mastering Bambi

Mastering Bambi

In the film Mastering Bambi, artists Persijn Broersen and Margit Lukacs have stripped the landscape of its cuddly, anthropomorphic characters. Over the course of the film, the …

Visual of Nano Super – One day left in Amsterdam

Nano Super – One day left in Amsterdam

Today is your final chance to visit the Nano Supermarket in Amsterdam. So if you happen to be in the neighborhood..

Visual of Nano Supermarket seeks Assistants

Nano Supermarket seeks Assistants

Always wanted to work in a Supermarket? Here is you chance. The Nano Supermarket seeks assistants. The Nano Supermarket assistant is part of a team, knows the products and knows …

Visual of Nano Supermarket @ TEDx

Nano Supermarket @ TEDx

Last week our NANO Supermarket was presented at TEDxBrainport in Eindhoven. A good opportunity to show some of our speculative nano products and explain a bit of the why & how …

Visual of Next Nature Book Trailer

Next Nature Book Trailer

Pop the champagne! Our must-read coffee table book was officially launched at the delightful and uplifting Next Nature Power Show in Amsterdam. Pictures and video's of the event …

Visual of Next Nature Server Dementia

Next Nature Server Dementia

Over the last few days the Next Nature website has been suffering symptoms of dementia due to a hardware failure at our very fancy and luxurious web hosting provider Media Temple …

Visual of Next Nature Services

Next Nature Services

Intentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …

Visual of Plastic Planet

Plastic Planet

We tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …

Visual of System Animals

System Animals

What animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …

Visual of Technology: The 7th Kingdom of Life

Technology: The 7th Kingdom of Life

Kevin Kelly, Senior Maverick at Wired Magazine talks about the nature of technology and propose to define technology as the 7th Kingdom of Life.

Visual of The Afterlife of PIG 05049

The Afterlife of PIG 05049

Christien Meindertsma spent three years tracking down every product made from a single pig. Pork made a showing, but the more strange goods were "ammunition, medicine, photo …

Visual of The Non-Human Noosphere

The Non-Human Noosphere

The definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …

Visual of The Pigeon that Shat the Golden Soap

The Pigeon that Shat the Golden Soap

Ever wished you could take a shower with pigeon poop? Artist Tuur van Balen proposes changing pigeons from flying rats to cleaning agents. A speculative, specially engineered …

Visual of Trading Humans for Trading Algorithms

Trading Humans for Trading Algorithms

The economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …

Visual of Typing Out Evolution

Typing Out Evolution

From the exhibit "What Machines Dream Of" in Berlin comes Life Writer , a work by Christa Sommerer and Laurent Mignonneau. As the participant types, letters are projected on a …

Visual of Welcome to Earth, Number 7,000,000,000!

Welcome to Earth, Number 7,000,000,000!

Welcome to earth, #7,000,000,000! Hope you like the #anthropocene. Learn more: http://bit.ly/se1SQc

Visual of Who Watches the Watchers?

Who Watches the Watchers?

In The Watchers , the creative geniuses at Studio Smack picture a world where surveillance systems don't just watch us - they actively judge.  Are you a green-coded Conformist or …

Visual of #10: Enhance Human Experience, Don’t Replace it

#10: Enhance Human Experience, Don’t Replace it

Part 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …

Visual of Algae in the Supermarket

Algae in the Supermarket

As mentioned  earlier , the world seems obsessed with algae. Not limited to producing light or energy , algae has also found its way to our plate as a new vegetable, and maybe …

Visual of Antifreeze from Fish Blood Keeps Low-Fat Ice Cream Rich and Creamy

Antifreeze from Fish Blood Keeps Low-Fat Ice Cream Rich and Creamy

Fat is what makes ice cream taste rich and creamy. It's called ice cream, after all, not ice skim milk. So how have some manufacturers managed to make reduced fat ice cream that …

Visual of Bacteria Inspire Magnetic Hard Drive

Bacteria Inspire Magnetic Hard Drive

Certain types of bacteria can navigate using magnetic nanoparticles as tiny compasses. Researchers at the University of Leeds have extracted the protein that controls this process …

Visual of Better Walking with Robotic Legs

Better Walking with Robotic Legs

The Berkeley Robotics & Human Engineering Laboratory is researching a way to improve the performance of human bodies. They are doing innovative research in the field of …

Visual of Bonobos (And Maybe Baboons) Domesticated Themselves

Bonobos (And Maybe Baboons) Domesticated Themselves

While evidence indicates that humans  domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …

Visual of Complexity and Evolving Synthetic Soil

Complexity and Evolving Synthetic Soil

Twenty-first century society draws from a world that is less determined by objects and increasingly shaped by connectivity. The clear either/or distinctions that formerly informed …

Visual of Does Chocolate Milk Come From Brown Cows?

Does Chocolate Milk Come From Brown Cows?

Although chocolate milk producing cows may sound silly, scientists are seriously analyzing the feasibility of the idea. Why not add genes of cocoa and sugar to a cow, in order to create a cow that produces sweet chocolate milk?

Visual of First

First "Farm"aceuticals Grown in Carrots

The United States Food and Drug Administration recently approved Elelyso, the first drug to be grown in genetically modified plant cells. Produced in carrot cells, this drug helps …

Visual of Photoshop Your Way to Beauty

Photoshop Your Way to Beauty

Filmmaker Jesse Rosten shows his critical views on body standards by presenting the exclusive beauty breakthrough Fotoshop by Adobé. This revolutionary product features pro-pixel …

Visual of Four Objections to Lab-Grown Meat

Four Objections to Lab-Grown Meat

In vitro meat has been billed as a way to  end animal suffering , put a stop to global warming , and solve the world's insatiable demand for animal protein. There's no doubt that …

Visual of Hendrik-Jan Grievink - From Blog to Book

Hendrik-Jan Grievink - From Blog to Book

At the next nature powershow designer Hendrik-Jan Grievink explained how over 1600 blog post on nextnature.net were re-designed & re-edited into a must-read coffee table book.

Visual of Frozen Coral Sperm Holds Promise in a Boiling World

Frozen Coral Sperm Holds Promise in a Boiling World

Life is bleak and bleached for many of the world's corals. Fatal bleaching events triggered by warming seas have become common from the Caribbean to Australia. More worrying still …

Visual of Genetically Engineered

Genetically Engineered "Arctic" Apple Will Never Turn Brown

Canada-based Okanagan Specialty Fruits is pitching a genetically engineered apple that does not turn brown when bruised or exposed to air. This new technology, available in both …

Visual of House of Cow Blood

House of Cow Blood

Using animal blood for building your own house sounds like something from a horror film, but architect Jack Monro has created a set of  experimental bricks that take bovine blood …

Visual of Humans Caused Mass Extinctions Before There Were Even Humans

Humans Caused Mass Extinctions Before There Were Even Humans

Humans and other hominids have a reputation for bringing about mass extinctions. Homo erectus  has been blamed for the disappearance of many African carnivores, our ancestors …

Visual of Ice Cream Cones Made from Ice Cream, and Other Wikicells

Ice Cream Cones Made from Ice Cream, and Other Wikicells

Plastic is a part of the earth's ecosystem , but it's a part that no one wants. At Harvard, scientists are looking to replace single-use plastic bottles, plates, and cups with …

Visual of In the Future, We Will Mine for Plastic

In the Future, We Will Mine for Plastic

Peak oil, the point when petroleum extraction is at its maximum, may have already occurred sometime  in the last few years . Not only affecting whether we drive a Humvee or not, …

Visual of Is the Human Body Redundant?

Is the Human Body Redundant?

The increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …

Visual of Latro Algae Lamp

Latro Algae Lamp

As advances in nanotechnology bring us increasingly energy efficient products, plant life such as algae could become attractive sources for tapping energy. The Latro lamp by …

Visual of Let the Robotic Farmers feed the World

Let the Robotic Farmers feed the World

The future of farming is not to be found in further mass-industrialization nor in the return to traditional farming with man and horse power, but rather in swarms of smart, cheap robotic farmers that patiently seed, tend and harvest fields one plant at a time without the need for damaging pesticides.

Visual of Little Green Cows

Little Green Cows

The world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …

Visual of Millions Mourn After Massacre Leaves City Littered with (Virtual) Dead

Millions Mourn After Massacre Leaves City Littered with (Virtual) Dead

"Earlier today, certain realms were affected by an in-game exploit, resulting in the deaths of player characters and non-player characters in some of the major cities," wrote a …

Visual of NANO Supermarket at Lowlands Festival

NANO Supermarket at Lowlands Festival

This weekend some of our sustainable, energy related, NANO Supermarket products are exhibited at the lustrous Lowlands popfestival . Come visit us at the Llowlab to charge your …

Visual of NANO Supermarket in RTL Koffietijd

NANO Supermarket in RTL Koffietijd

Design fiction for the masses. Our NANO Supermarket was presented in the Dutch television show RTL Koffietijd (coffeetime). If you belong to the exquisite 5% visitors of this …

Visual of NANO Supermarket - Introducing the Jury

NANO Supermarket - Introducing the Jury

Little over two weeks left to submit your speculative product idea for the Nano Supermarket . The jury that will select the finest submissions – to be exhibited in the Nano …

Visual of Nanotech Diatoms

Nanotech Diatoms

No, those aren't plastic trinkets or beads from a craft store. They're diatoms, a group of single-celled algae, and unlike almost all of our current technologies, they can rapidly …

Visual of Nanotech Generates the Blackest Black

Nanotech Generates the Blackest Black

As the NANO Supermarket opens discussions on the ethics, purpose and usability of nanotechnology, Frederik De Wilde is researching its artistic possibilities. De Wilde is a guest …

Visual of Natura Prossimo a Milano

Natura Prossimo a Milano

This week our NANO Supermarket will be visiting Milan as part of the Salone Internazionale del Mobile.

Visual of Neither Warfare nor Dumplings Are Innate to Human Nature

Neither Warfare nor Dumplings Are Innate to Human Nature

In Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …

Visual of Next Nature Lecture @ DesignMarch Island

Next Nature Lecture @ DesignMarch Island

If you happen to be in the neighborhood you may want to attend the Next Nature lecture at the Island Design March on March 22 in the "most northerly capital in the world". If you …

Visual of Next Nature Night in Rotterdam

Next Nature Night in Rotterdam

Some months ago the Rotterdam Think Café organized a Next Nature night featuring a prominent nextnature connoisseur.

Visual of Plastic Junk Helps Ocean Animals (Sometimes)

Plastic Junk Helps Ocean Animals (Sometimes)

While the Pacific garbage patch is often characterized as a dense, Texas-sized island of plastic, in reality it's an area of 2,736 square km scattered with  tiny, floating bits of …

Visual of Portable Data Silence

Portable Data Silence

Experience full data silence with the Faraday Bag. Made from electromagnetic shielding silver coated fabric, it prevents devices inside it from being contacted. Made by artist …

Visual of Turning Wind Farms into Seaweed Farms

Turning Wind Farms into Seaweed Farms

Closed to commercial shipping and fishing, offshore wind farms aren't put to much use besides generating clean energy. Ecofys , a Dutch sustainable consulting company, hopes to …

Visual of Twitter Implant becomes a Reality

Twitter Implant becomes a Reality

You all probably know the ' Twitter implant ' from the Nano Supermarket . Scientist at the University of Princeton now created the first working prototype. The implant is actually …

Visual of Walter Benjamin on Film and the Senses

Walter Benjamin on Film and the Senses

During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …

Visual of What is Next Nature?

What is Next Nature?

At the Next Nature Power Show 2011 our master of ceremony, Koert van Mensvoort gave a mini lecture on our changing notion of Nature.

Visual of A More Interesting, More Depressing Theory of Easter Island's Downfall

A More Interesting, More Depressing Theory of Easter Island's Downfall

A new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.

Visual of A Stroll Through the Bubbles of Chemicals and Men

A Stroll Through the Bubbles of Chemicals and Men

A stunning pre-history of the anthropocene

Visual of Bye Bye Barbed Wire: Cow-Mounted GPS Will Enable

Bye Bye Barbed Wire: Cow-Mounted GPS Will Enable "Virtual Fencing"

A device that remotely controls cattle's movements promises to transform the American landscape.

Visual of Computer Algorithms Are Already Replacing Human Journalists

Computer Algorithms Are Already Replacing Human Journalists

Will writing software eventually replace journalists?

Visual of Dad Hires Virtual Hitman to Kill Son's Online Avatars

Dad Hires Virtual Hitman to Kill Son's Online Avatars

A 23-year-old in China was recently puzzled why his online avatars were being killed off at disproportionate rates. After asking around, the young man eventually discovered that …

Visual of Delivery Drones Are Coming

Delivery Drones Are Coming

Amazon announces they want to use drones to deliver your order within a half hour at any location you choose.

Visual of Demo Day at Next Nature Lab

Demo Day at Next Nature Lab

Unpolished creativity at the Next Nature lab from the Industrial Design Department at the Eindhoven University of Technology.

Visual of Free Electricity from the Technosphere

Free Electricity from the Technosphere

Scientists learn how to harvest electricity from radio waves.

Visual of From Eco-Apartheid to Earth Democracy

From Eco-Apartheid to Earth Democracy

Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.

Visual of Gated Communities: In Or Out?

Gated Communities: In Or Out?

Ultimately existence (or not) for gated communities comes down to the existential choice: should we be afraid of the future?

Visual of Grow Your Own - Call for Projects

Grow Your Own - Call for Projects

Science Gallery is calling synthetic biologists, bio-artists, bio-designers, amateur biotechnologists and bio-hackers to submit proposals for projects for their upcoming flagship exhibition GROW YOUR OWN.

Visual of How Social Media Has Changed Our Response to Disaster

How Social Media Has Changed Our Response to Disaster

From the earthquake in Haiti to Hurricane Sandy to the Boston Marathon bombings, Facebook, Twitter and other social media were used to spread information and help citizens and …

Visual of How to Turn Skin Cells into a Baby

How to Turn Skin Cells into a Baby

A stem cell experiment with mice may one day mean that same-sex couples could have bio children.

Visual of Interact with Friends (in Real Life) with Facebook Monopoly

Interact with Friends (in Real Life) with Facebook Monopoly

A Facebook version of Monopoly forces players to interact with each other in meatspace.

Visual of Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert

Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert

An interview with Daisy Ginsberg, artist and synthetic biologist.

Visual of Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.

Visual of Living Among Pests – Designing the Biosynthetic City

Living Among Pests – Designing the Biosynthetic City

Joyce Hwang discusses the challenges for designers, and gains for citizens, of living in a truly biosynthetic city.

Visual of Manmade Global Warming Is at Least 15,000 Years Old

Manmade Global Warming Is at Least 15,000 Years Old

How the extinction of mammoths changed the atmosphere.

Visual of Moments in Meat History Part I - Origins of Meat-eating and Hunting

Moments in Meat History Part I - Origins of Meat-eating and Hunting

About 4 or 5 million years ago, major changes in the Earth's climate brought about grassland regions where giant mammals could graze.

Visual of Moments in Meat History Part VII - Factory Farming

Moments in Meat History Part VII - Factory Farming

In the 1950s, the transition towards what is now known as factory farming picked up speed with farmers.

Visual of Moral Shortcomings in the Technology Debate

Moral Shortcomings in the Technology Debate

Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …

Visual of NANO Supermarket 2014 Call for Products

NANO Supermarket 2014 Call for Products

Submit your speculative product to the NANO Supermarket and win 2500 euro.

Visual of NASA Solves the Toxic 'New Car Smell'

NASA Solves the Toxic 'New Car Smell'

A new material can stop toxic off-gassing from plastics, but the 'new car smell' is so valuable the car industry might not change.

Visual of Next Nature TEDx Talk in Budapest

Next Nature TEDx Talk in Budapest

Indulge in the Next Nature stump speech at TEDx from Dr. Van Mensvoort

Visual of Oranges Are Going Extinct – Unless a Gene from Spinach Can Help

Oranges Are Going Extinct – Unless a Gene from Spinach Can Help

Only genetic engineering can stop citrus from going commercially extinct. But is the public ready to accept GM orange juice?

Visual of Painting with Toxic Runoff

Painting with Toxic Runoff

A professor and an artist have invented a method to manufacture paint from acid mine runoff.

Visual of The Technium

The Technium

Buckle up for another cinematic espresso shot from our favorite performance philosopher Jason Silva.

Visual of Toss the Brita: Bacteria Can Filter Antibiotics from Water

Toss the Brita: Bacteria Can Filter Antibiotics from Water

Filter and recover antibiotics from drinking water using only bacteria, water and sunlight.

Visual of We Are Not Alone Eating Fast Food

We Are Not Alone Eating Fast Food

Beekeepers in France have been puzzled by their bees producing blue and green honey. Turned out the bees were eating waste from an M&Ms factory.

Visual of World's First In Vitro Hamburger Arrives

World's First In Vitro Hamburger Arrives

Break out the ketchup: Mark Post has grown the world's first entirely artificial burger from cultured beef cells.

Visual of You Can Never Go Back To Nature

You Can Never Go Back To Nature

One of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …

Visual of A Net will Collect Debris from Outer Space

A Net will Collect Debris from Outer Space

JAXA developes a net that could collect debris from outer space.

Visual of Biofabricate – NN Lecture in New York

Biofabricate – NN Lecture in New York

4th of December Dr Van Mensvoort lectures in New York at the BIOFABRICA summit. Other speakers include Paola Antonelli and Andras Forgac.

Visual of Domestication as a Last Refuge

Domestication as a Last Refuge

In glass capsules endangered rainforest flora will be able to survive regardless of what happens to their natural habitat.

Visual of How modern sanitation gave us polio

How modern sanitation gave us polio

For most of history, poliomyelitis was a relatively unremarkable disease – it caused paralysis and occasionally death, but only in a tiny fraction of those infected. It was …

Visual of Future Lecture in Bangkok

Future Lecture in Bangkok

If you happen to be in Bangkok this week, do consider attending the Creative Unfold conference, featuring prominent 'What if..." thinkers.

Visual of No Future for Traditional Meat

No Future for Traditional Meat

At Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook

Visual of Old Nature Strikes Back

Old Nature Strikes Back

Geology isn't always slow.

Visual of OUT NOW: The In Vitro Meat Cookbook

OUT NOW: The In Vitro Meat Cookbook

On the 5th of August, one year after the lab grown hamburger, the In Vitro Meat Cookbook was launched.

Visual of Plastic Pollution Solution

Plastic Pollution Solution

Is there a possibility to clean up the oceans from plastic pollution?

Visual of Robot Cheetah Now Runs Free

Robot Cheetah Now Runs Free

Researchers created a robo-feline able to run and bound while completely untethered.

Visual of Robotic Furniture puts IKEA to Shame

Robotic Furniture puts IKEA to Shame

Science Fiction taught us to think of robots as human-like beings, yet the robots that actually make it into your home are more likely to look like furniture.

Visual of Shock Therapy for a Better Self

Shock Therapy for a Better Self

The Pavlok wristband gives its wearers an electric shock if they fail at hitting work deadlines or completing fitness goals.

Visual of Sidewalk Lane For Smartphone Users

Sidewalk Lane For Smartphone Users

Dividing the sidewalk in two lanes: one for cell phone users and one for non-cell phone users.

Visual of The Bottle of The Future is an Edible Blob

The Bottle of The Future is an Edible Blob

What if we could drink from a giant drop of water? The bottle of the future has the shape of a soft, hygienic, biodegradable and edible blob.

Visual of Three Points in Support of In Vitro Meat

Three Points in Support of In Vitro Meat

The top three aspects why people should support cultured meat.

Visual of Transportations Of The Future

Transportations Of The Future

A selection of nine enthralling and striking concepts of future way of transportation.

Visual of Where Is My Care-Bot?

Where Is My Care-Bot?

Robots are coming to replace shopping assistants , teachers , farmers and eventually even nurses!

Visual of Ambient City

Ambient City

How cities will function when there are more robots than people working in factories, everything is intelligently interlinked, autos drive autonomously and drones deliver the mail?

Visual of Anthropo-scene #8: Anthropocene Rabbit

Anthropo-scene #8: Anthropocene Rabbit

With cities covering growing area of land, we humans and our spaces build the new wilderness for animals and plants.

Visual of Artificial Intelligence Able to Create Music

Artificial Intelligence Able to Create Music

Emily Howell is an interactive interface able to compose and perform her own pieces of music.

Visual of Communicating with City Infrastructures

Communicating with City Infrastructures

A recent project, named GENESI, might make it possible for city infrastructures to communicate with us.

Visual of DOUG: the First Robot Able to Draw

DOUG: the First Robot Able to Draw

Robots can already read, talk and reason. Yet, they do not seem to have found limits to their artistic skills either. Meet DOUG_1, first the drawing robot.

Visual of Drugs Testing with Artificial Organs

Drugs Testing with Artificial Organs

Researchers are working on artificial organs-on-chips will be used for drug development.

Visual of GM Salmon Approved for Consumption

GM Salmon Approved for Consumption

Time ago we wrote about the fact that  US Food and Drug Administration  was considering whether to approve the first genetically engineered salmon. We have a verdict: from now on …

Visual of Genome Editing - Bringing the Übermensch to a Shelf Near You

Genome Editing - Bringing the Übermensch to a Shelf Near You

Last April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …

Visual of GM Pigs for Animal-to-Human Organ Transplant

GM Pigs for Animal-to-Human Organ Transplant

Scientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.

Visual of Google's Smart Interactive Clothing

Google's Smart Interactive Clothing

Project Jacquard makes it possible to weave touch and gesture interactivity into any textile.

Visual of Human-Like Robot Makes Freaky Joke About the Future of Mankind

Human-Like Robot Makes Freaky Joke About the Future of Mankind

To thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.

Visual of IBM Predicts Artificial Intelligence Future

IBM Predicts Artificial Intelligence Future

While the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".

Visual of Should Intelligent Sex Robots be Banned?

Should Intelligent Sex Robots be Banned?

The Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.

Visual of Local Deliveries: Robots or Drones?

Local Deliveries: Robots or Drones?

Starship, a robot that will remodel our local deliveries system.

Visual of MyWebwill Dead Before its Subscribers

MyWebwill Dead Before its Subscribers

The company MyWebwill helped you to manage your digital afterlife. Unfortunately for its subscribers the company itself has now deceased.

Visual of NANO Supermarket 100 m2 Pop-Up Store

NANO Supermarket 100 m2 Pop-Up Store

Our lustrous NANO Supermarket opened a 100m2 pop-up store in Stavanger, Norway.

Visual of Nasa's Projections on Global Warming

Nasa's Projections on Global Warming

Researchers at Nasa's Center for Climate Simulation (NCCS) in Maryland can deploy a supercomputer called the "Discover".

Visual of Next Nature at Futur en Seine Festival

Next Nature at Futur en Seine Festival

Next Nature at "Mindfulness and Digital Detox: How to Tune Out to Tune In" Conference in Paris.

Visual of Next Nature Night on Design & Evolution

Next Nature Night on Design & Evolution

Next Nature Night on Design & Evolution, Tuesday 30th June.

Visual of Next Nature Talk at Nature 3.x Symposium

Next Nature Talk at Nature 3.x Symposium

Koert van Mensvoort will take part in the Nature 3.x: Where is Nature Now? symposium at the University of Minnesota.

Visual of NNN Movement & the First ECO Coin

NNN Movement & the First ECO Coin

We officially launched the Next Nature Movement in The Netherlands. To seal the beginning of the Next Nature Movement, director Koert van Mensvoort donated the first symbolic ECO coin.

Visual of Ocumetrics Bionic Lenses can Triple Your Eyesight Capability

Ocumetrics Bionic Lenses can Triple Your Eyesight Capability

Dr. Garth Webb, an optometrist from British Columbia, has invented the Ocumetics Bionic Lens : lenses that after being implanted through an eight minute surgery, improve eyesight …

Visual of Space Archeologist Unlocks Secrets of Ancient Civilizations

Space Archeologist Unlocks Secrets of Ancient Civilizations

Sarah Parcak is a pioneering "satellite archaeologist" from University of Alabama, a sort of Indiana Jones with 21st century tech. She has been awarded the 2016 TED Prize for her …

Visual of Gameplay of the Crowds

Gameplay of the Crowds

Australian programmer started a social experiment called “Twitch Plays Pokémon”. Over a Million People Play Pokémon in Social Experiment

Visual of Architecture on Mars

Architecture on Mars

The future anticipates 3D printed homes on Mars.

Visual of The First Beauty Contest Judged by AI

The First Beauty Contest Judged by AI

The first beauty contest judged by complex algorithms has sparked controversy after biased results.

Visual of Fighting Photo Overflow with a Camera

Fighting Photo Overflow with a Camera

What if a camera would say "no" when you press the shutter because there are already too many similar photos on the internet?

Visual of Coming Soon: Video Face Hacking for All

Coming Soon: Video Face Hacking for All

team of computer scientists at the universities of Germany and California has created what they call photoshoping videos in real time.

Visual of A Cryptocurrency Helping to Cure Cancer

A Cryptocurrency Helping to Cure Cancer

Part two of a ten part series exploring the design of an invisible technology: money.

Visual of Your Data Is Worth More Than You Think

Your Data Is Worth More Than You Think

How valuable are your data?

Visual of Design on the Border of Technology and Biology Demands Us to 'Mother' Nature

Design on the Border of Technology and Biology Demands Us to 'Mother' Nature

Designer and architect Neri Oxman explores how digital fabrication technologies can interact with the biological world. Watch the TED talk.

Visual of Designed to Survive Our Roads

Designed to Survive Our Roads

A road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.

Visual of Drones in Agriculture

Drones in Agriculture

Here's a look at how drones can and will impact the agriculture and farming industry.

Visual of Enlisting Eagles to Take Down Drones

Enlisting Eagles to Take Down Drones

An eagle clutching a flying drone is probably not a show that you see everyday, unless you live in the Netherlands.

Visual of Eating Plastic or Krill: a Smelly Story for Birds

Eating Plastic or Krill: a Smelly Story for Birds

Seabirds eat floating plastic debris because it smells like food, study finds.

Visual of The Enlightenment Is Dead, Long Live the Entanglement

The Enlightenment Is Dead, Long Live the Entanglement

We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.

Visual of Experience a Real Safari, Google-Style

Experience a Real Safari, Google-Style

Google launched the Mzansi Experience, a virtual tour to South Africa through Street View.

Visual of When FB Told Everyone They Were Dead

When FB Told Everyone They Were Dead

Due to an algorithmic error, Facebook mistakenly "memorialized" vital user accounts with a banner announcing the user’s passing – turning their friend walls into memorial walls.

Visual of Feeling Lonely with 1000 Facebook Friends

Feeling Lonely with 1000 Facebook Friends

Loneliness is a major social issue and can only be 'cured' with real world interaction.

Visual of The Bioengineered Elixir of Life

The Bioengineered Elixir of Life

Scientists say they can reverse aging by reprogramming the genome.

Visual of From Vegetable to Stroopwafel

From Vegetable to Stroopwafel

Chloé Rutzerveld presents a modern version of the iconic stroopwafel, fully made of vegetables.

Visual of Genetic Scissors Instead of Chef's Knife

Genetic Scissors Instead of Chef's Knife

CRISPRy cabbage has been served for the first time in the world.

Visual of Traffic Lights for Smartphone Zombies

Traffic Lights for Smartphone Zombies

Ground Level Traffic Lights For Smartphone Zombies

Visual of Growing Drones From Chemicals

Growing Drones From Chemicals

Researchers are experimenting with a new technology that would be able to grow drones from chemical compounds.

Visual of In Defense of the Eggplant

In Defense of the Eggplant

The eggplant emoji became a political weapon and gain cult status being the forbidden fruit of the web.

Visual of Designer Govert Flint applies motion to everyday life

Designer Govert Flint applies motion to everyday life

Interview with Govert Flint, designer, architect and self-taught artist.

Visual of How Knitwear Can Save Penguins

How Knitwear Can Save Penguins

The penguin jumper is designed by the Penguin Foundation, an organization that rescues penguins on the Australian coast who are hit by oils spills.

Visual of Lilou the Airport Pig Will Soothe Your Travel

Lilou the Airport Pig Will Soothe Your Travel

If you happen to be at San Francisco International Airport on the hectic Holiday time, LiLou, the airport's pig can help you alleviate the stress.

Visual of We Love Cities, so Do Wild Animals

We Love Cities, so Do Wild Animals

How wild animals and cities are adapting to each other.

Visual of Computers Need Domestication

Computers Need Domestication

Soon we won’t program computers anymore, we’ll train them like dogs.

Visual of Madrid's Future Is Greener than Ever

Madrid's Future Is Greener than Ever

Madrid's new plans to fight rising temperatures and high pollution rates investing on green urban areas.

Visual of Make Toblerone Great Again!

Make Toblerone Great Again!

American chocolate manufacturer Mondelez reduces the weight of its widely popular Toblerone bars as a result of the Brexit vote.

Visual of Making King's Day More Sustainable

Making King's Day More Sustainable

On King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.

Visual of A Map of Mars for Regular Humans

A Map of Mars for Regular Humans

If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …

Visual of Turning Contact Lenses into Screens

Turning Contact Lenses into Screens

A polymer film coating can turn contact lenses into computer screens.

Visual of What if Mosquitoes Were Only a Zoo Species?

What if Mosquitoes Were Only a Zoo Species?

Genetic engineers are developing techniques to kill several types of mosquitoes.

Visual of NANO Supermarket in Brussels

NANO Supermarket in Brussels

Come and check out the NANO Supermarket at SAS Software's Forum BeLux 2016 on October 13 in The Egg Brussels!

Visual of The New Era of Tourism is Underwater

The New Era of Tourism is Underwater

Sleeping underwater has always been your dream? Thanks to an ambitious project it will be soon reality.

Visual of What Is Next Nature? #11

What Is Next Nature? #11

Being reminded by Facebook that it's your best friends' birthday.

Visual of Who Owns the Map?

Who Owns the Map?

In their pursuit of mapping the physical world online, mapping services simultaneously shape our understanding of it too.

Visual of There Are More People Flying in Airplanes right Now, than there were Alive on Earth in the Stone Age

There Are More People Flying in Airplanes right Now, than there were Alive on Earth in the Stone Age

Today there are on average there are some 8000 planes in the sky carrying at least half a million people. On average during the Stone Age there must have been less.

Visual of Photoshop Hacks Become In Real Life Art

Photoshop Hacks Become In Real Life Art

UV Production House reflects on popular online platforms for maker culture.

Visual of How Rare Is Virtual Gold?

How Rare Is Virtual Gold?

Part one of a ten part series exploring the design of an invisible technology: money.

Visual of Are Robots the Future of Tattoos?

Are Robots the Future of Tattoos?

An industrial robot just tattooed the first person ever in San Francisco.

Visual of Sea Delicatessen Grow Along Highways

Sea Delicatessen Grow Along Highways

With winter just around the corner, salt trucks are getting ready to hit the road spreading tons of salt. Ice free asphalt is necessary to drive safely and keep transports …

Visual of Storing Knowledge for Eternity

Storing Knowledge for Eternity

Researchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.

Visual of Time Is a Universal Currency

Time Is a Universal Currency

The principle behind a time based currency is usually very simple: one hour of work equals a unit of time.

Visual of Meeting the Future at TodaysArt

Meeting the Future at TodaysArt

Last week The Hague hosted a festival dedicated to contemporary experiments in music, art and digital culture.

Visual of Untouched Nature Is Entirely Gone

Untouched Nature Is Entirely Gone

Researchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.

Visual of Old Cellphones to Fight Deforestation

Old Cellphones to Fight Deforestation

A Californian engineer is using old cellphones and solar panels to save the rainforest ecosystem against deforestation.

Visual of VR as a Tool for Social Change

VR as a Tool for Social Change

United Nations aims at turning a playful technology into a serious medium.

Visual of Bringing The Web into Real Life

Bringing The Web into Real Life

Web 0.0 is sa project by street-artist Biancoshock where web apps are contextualized in real life.

Visual of Web Training Collar

Web Training Collar

Jasper van Loenen developed a wearable that sends a corrective electrostatic shock to its wearer when visiting an unprotected website.

Visual of Welcome to the Age of Plastic

Welcome to the Age of Plastic

According to a new study, humankind is now entering the "Age of Plastic". The research investigates the evidence that we are living in the Anthropocene, a time in which humanity is the main geological force.

Visual of Wi-Fi Hotspots Take Over Old Payphones

Wi-Fi Hotspots Take Over Old Payphones

New York City decided to definitely say goodbye to neglected payphones and replace them with Wi-Fi hotspots.

Visual of World's

World's "Coolest" Hotel

Sweden's new Icehotel 365 uses solar cooling to stay open all year.

Visual of 1996 - First Artificial Womb Experimented

1996 - First Artificial Womb Experimented

In 1996, Yoshinori Kuwabara at Juntendo University in Tokyo incubated a premature goat fetus by using extrauterine fetal incubation.

Visual of An AI Is Writing the Next

An AI Is Writing the Next "Game of Thrones"

One fan has become so impatient for the conclusion to "Game of Thrones", he's programmed an AI to write it for him. Move over, George R.R. Martin!

Visual of Animal Tsunami Alerts from Space

Animal Tsunami Alerts from Space

Global data about animal movements are indispensable in our today international networked world to understand how to safe human health and wildlife simultaneously.

Visual of Anime Characters at Your Service

Anime Characters at Your Service

Take a look at this video to get an idea of what life with a virtual anime assistant would look like.

Visual of 400 BCE - Myth of Princes Grown in Jars

400 BCE - Myth of Princes Grown in Jars

In year 400BCE in ancient Indian Sanskrit epics, 100 princes were created from a jar of ghee.

Visual of The New Way to Boost Creativity

The New Way to Boost Creativity

Danish company develops device to stimulate creativity.

Visual of DNA Hacking: Catch a Computer Virus

DNA Hacking: Catch a Computer Virus

We know how it feels to catch a cold; how might it feel to catch malware?

Visual of Greetings from the Ciptagelar Village

Greetings from the Ciptagelar Village

A series of photographs from the Ciptagelar village in West Java, Indonesia.

Visual of Cruising Critters Travel the Ocean on Plastic

Cruising Critters Travel the Ocean on Plastic

Tons of living animals have floated from Japan to the United States traveling across the ocean on plastic junk and debris.

Visual of Design Your Own Vegetables

Design Your Own Vegetables

With her project Future Food Formula, food designer Chloé Rutzerveld is looking for innovative methods to design vegetables.

Visual of Designer babies: the kids of the future?

Designer babies: the kids of the future?

What if you had the choice of sparing your child from diseases and disorders such as Alzheimer’s disease, heart disease or autism?

Visual of The Digital Mythology of... Super Mario

The Digital Mythology of... Super Mario

Mythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.

Visual of Drones and Robots Co-Work in Solar Farms

Drones and Robots Co-Work in Solar Farms

BladeRanger might have found the ultimate solution for solar panels cleaning putting drones and robots together at work.

Visual of Dutch Trains Now Run on Wind Power

Dutch Trains Now Run on Wind Power

Dutch train passengers travel 100% on wind power.

Visual of ECO Coin Award Interviews: Shubhendu Sharma

ECO Coin Award Interviews: Shubhendu Sharma

We asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.

Visual of ECO Coin First Trial at DGTL 2017

ECO Coin First Trial at DGTL 2017

We had a wonderful first run of the ECO Coin during DGTL festival in Amsterdam.

Visual of Experience Death with VR

Experience Death with VR

Virtual reality experiment tries to help people frightened of death with outer-body experience.

Visual of Explore Depths from Your Chair

Explore Depths from Your Chair

To explore deep sea Standfort University developed OceanOne: a humanoid diving robot, which at the same time creates a simulation of the underwater experience on land.

Visual of Fellow Day 2017: Next Habitat

Fellow Day 2017: Next Habitat

Last week, our NNN fellows gathered to discuss the Next Habitat; how will we work in the future? And how does this affect our personal lives?

Visual of The Future of Firefighting

The Future of Firefighting

Firefighters can see through smoke with new thermal mask.

Visual of Next Nature Habitat VR at SXSW17

Next Nature Habitat VR at SXSW17

This week our virtual reality experience landed at the inaugural VR program of SXSW festival.

Visual of Happy Earth Day!

Happy Earth Day!

Today we celebrate Earth day, here is why.

Visual of HUBOT: Meet the Remote Savior

HUBOT: Meet the Remote Savior

When giving first aid, all kinds of emotions are in play. Thus it is important for the victim of an accident to receive emotional assistance and to be mentally supported during an …

Visual of The Internet of Bees

The Internet of Bees

What can we learn from listening to the buzz of bees' conversation? With the help of a new monitoring system, a Canadian researcher is hoping to find out.

Visual of Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.

Visual of An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018

An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018

Meet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.

Visual of Will Kites Provide Wind Energy in the Future?

Will Kites Provide Wind Energy in the Future?

If you’ve watched clouds roll by, you know wind moves more steadily in the upper atmosphere. Turbines just can’t reach high-altitude wind energy. Kites can!

Visual of Letter to Humanity

Letter to Humanity

NNN director Koert van Mensvoort writes a letter to humanity.

Visual of Supermarkets Are Our New Savannah, Especially During Natural Disasters

Supermarkets Are Our New Savannah, Especially During Natural Disasters

Before a natural disaster hordes of people crowd in supermarkets and fight over the last supplies. It mirrors the savannah with cliques and groups trying to get the available food, water or shelter.

Visual of iPhones Are Happy to See Us

iPhones Are Happy to See Us

What if you could unlock your phone by simply looking at the camera? According to Apple, this is precisely how the iPhone X will work. But how secure is it?

Visual of Old Cows and New Ideas

Old Cows and New Ideas

Will cows still graze fields in an in vitro future? And what might we do with these animals when they naturally die?

Visual of Want Plastic with Your Salt?

Want Plastic with Your Salt?

A recent study examining the purity of 17 commercial sea salt brands from eight different countries found microplastics in all 17 samples.

Visual of Our Relationship with Tech Is Growing Stronger

Our Relationship with Tech Is Growing Stronger

It's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.

Visual of Replacing Fireflies with Lasers

Replacing Fireflies with Lasers

After mounting criticism from environmentalists, a firefly-themed park in China announced that the glowing bugs will be replaced by lasers.

Visual of Robotic Pillow Breathes to Help You Sleep

Robotic Pillow Breathes to Help You Sleep

A smart, huggable bed partner, who also improves your sleep quality. Sounds great, right? Soon, you might be able to order one yourself: Somnox is a soft robotic pillow that gently breathes as you hold it.

Visual of Scientists Create Ghost Heart

Scientists Create Ghost Heart

The Texas Heart Institute researches in the field of organ transplantation. With the “ghost heart” — an heart organ scrubbed clean of all its former cells, the researches are on the verge of creating a sustainable and effective way of transplanting organs.

Visual of Skyscraper Hanging from the Sky

Skyscraper Hanging from the Sky

What if we rethink the system and instead of building from earth to sky, we do it the other way around?

Visual of Skyscraper Fails to Load Its Textures

Skyscraper Fails to Load Its Textures

In New York, observant residents were surprised to see a skyscraper that looked like it was struggling to load its textures.

Visual of Smell of Data Documentary on Nextnature.net

Smell of Data Documentary on Nextnature.net

The Smell of Data documentary will make its online debut on nextnature.net.

Visual of The Smell of Global Economy

The Smell of Global Economy

The Pollution Pods installation replicates the smell and air quality of five different urban environments, forming the smell of a global economy.

Visual of Sponge Cities: Soak It, Store It, Reuse It

Sponge Cities: Soak It, Store It, Reuse It

The philosophy behind sponge cities is simple: cities should contribute to solving water related problems instead of causing them.

Visual of The Story of Money: Gold

The Story of Money: Gold

The story of money, an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. This episode: gold.

Visual of The Story of Money: Livestock

The Story of Money: Livestock

The story of money: an accessible roadmap from prehistory to digital age - from cows to credit, from gold mining to bitcoin mining.

Visual of The Story of Money: Paper

The Story of Money: Paper

The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. This episode: paper.

Visual of The Posthuman Farm

The Posthuman Farm

Wu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.

Visual of Transformative Appetite: Shape-Shifting Pasta

Transformative Appetite: Shape-Shifting Pasta

MIT Media Lab developed pasta programmed on a computer.

Visual of Meat the Future Exhibition: Appetizer

Meat the Future Exhibition: Appetizer

Have you already visited our Meat the Future exhibition? Consider this three course meal an introduction to what you may expect.

Visual of Your Virtual Midwife Is Here

Your Virtual Midwife Is Here

An external device that helps you conceive, carry and raise a child. Too scary? Or extremely useful? It's up to you to decide, your virtual midwife is here!

Visual of How AI could revolutionize the teaching profession

How AI could revolutionize the teaching profession

In various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …

Visual of Here’s how the Dutch are embracing blockchain in the polder

Here’s how the Dutch are embracing blockchain in the polder

Smiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …

Visual of Next Nature Network x Border Sessions: <br> Calling for festival bloggers!

Next Nature Network x Border Sessions:
Calling for festival bloggers!

Calling all bloggers! We’d love to have you on board for the 2018 Border Sessions festival in The Hague (NL). Join our team for behind-the-scenes access to festival events. To …

Visual of Towards a design brief for the artificial womb

Towards a design brief for the artificial womb

Humanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …

Visual of Your Next Nature guide to Dutch Design Week 2018

Your Next Nature guide to Dutch Design Week 2018

Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …

Visual of Turning surplus bread into craft beer

Turning surplus bread into craft beer

Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …

Visual of Getting rid of that bit of unspoiled green

Getting rid of that bit of unspoiled green

There it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …

Visual of A happy birth day to Louise Brown

A happy birth day to Louise Brown

Dear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …

Visual of Interview: Huub Ehlhardt on the evolution of products

Interview: Huub Ehlhardt on the evolution of products

"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …

Visual of Should lab-grown meat be labelled as meat when it's available for sale?

Should lab-grown meat be labelled as meat when it's available for sale?

Australian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …

Visual of Next Nature baby care

Next Nature baby care

Babies' needs aren't complex. And yet, they are. Over the years, parents have found some tricks to ease their babies as well as themselves. Taking a baby for a drive to make them …

Visual of Skiing on Mars? It's possible!

Skiing on Mars? It's possible!

For those experiencing symptoms of motion sickness in VR , it’s now possible to step inside a real-life simulation of what it could be like to ski on mars. Last week, desert dust …

Visual of Chernobyl goes green: The ambitious plan to reclaim a nuclear disaster site

Chernobyl goes green: The ambitious plan to reclaim a nuclear disaster site

Chernobyl is famous as the site of the worst nuclear power accidents in history. The 1986 disaster has come to represent the perils of nuclear energy, much as Hiroshima represents …

Visual of Celebrate 10 years of Studio Drift at the Stedelijk Museum

Celebrate 10 years of Studio Drift at the Stedelijk Museum

Tonight, Studio Drift is launching their debut museum solo exhibition at the Stedelijk Museum in Amsterdam: Coded Nature . As  NNN Fellows , this Dutch duo is showcasing a …

Visual of The future infrastructure of the blockchain might be green and humane

The future infrastructure of the blockchain might be green and humane

The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …

Visual of This tiny tooth sensor tracks what you eat, and it could help you be healthier

This tiny tooth sensor tracks what you eat, and it could help you be healthier

The South Beach diet. The Atkins diet. Eating paleo. Cutting out gluten. Going vegan. The list of fad diets and health crazes goes on, yet health statistics in the US and around …

Visual of People are less likely to turn a robot off if it asks them not to

People are less likely to turn a robot off if it asks them not to

A team of German researchers published  a study  earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …

Visual of Managing the data deluge: Twitter as a tool for ecological research

Managing the data deluge: Twitter as a tool for ecological research

As early as 2009-10 , researchers were looking at Twitter data mining as a way to predict the incidence of flu. At the time, the H1N1 virus, or “swine flu,” had made the jump from …

Visual of Your Next Nature guide to Unseen 2018: When Records Melt

Your Next Nature guide to Unseen 2018: When Records Melt

Images largely shape our experience of reality. Just consider how imagery of nature continues to rise in popularity: only a society no longer grounded in their natural landscape …

Visual of Researchers are using VR to help teachers understand autism

Researchers are using VR to help teachers understand autism

Researchers are using VR as an empathy tool to help neurotypical teachers understand their students with autism. There have already been attempts to use VR to help autistic …

Visual of Welcome to the CRISPR baby world—here’s what you should know

Welcome to the CRISPR baby world—here’s what you should know

Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …

Visual of 'WFF' is a person who you encountered briefly, but stays in your online life forever

'WFF' is a person who you encountered briefly, but stays in your online life forever

Before social networks, there were episodic characters in our lives - people we've only met once or twice, and we haven’t heard from since. Nowadays whoever, we once add a person …

Visual of Why human enhancement requires technological citizenship

Why human enhancement requires technological citizenship

New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …

Visual of The artificial womb: are we ready?

The artificial womb: are we ready?

“Within a few years it will be possible for a premature baby to continue to mature in an artificial womb,” says gynecologist Guid Oei. It is therefore that the Artificial Womb: …

Visual of 6 designers changing the future of fashion

6 designers changing the future of fashion

We live in a world of fast or disposable fashion. This industry is increasingly impacting the environment due to the use of toxic chemicals, water and energy consumption, heavy …

Visual of Can technology be humane?

Can technology be humane?

We must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …

Visual of How Pokémon are affected by climate change

How Pokémon are affected by climate change

You know climate change is real when dead coral Pokémon start to wash up on (virtual) beaches. Behold, Cursola, world’s first dead coral Pokémon. On the origins of Cursola While …

Visual of Why digital detoxes are a solution looking for a problem

Why digital detoxes are a solution looking for a problem

With New Year’s resolutions in full swing, many people may have chosen to cut down on their tech use – or even give it up altogether. The  growing popularity of such “digital …

Visual of Future Food: here's what we'll be eating in 2050

Future Food: here's what we'll be eating in 2050

What will you be having for breakfast, lunch or dinner in 2050? Where will this food be sourced? And how will it be prepared? Edible insects? A hamburger made from cultured meat? …

Visual of Next Nature Night: Future food is on the menu

Next Nature Night: Future food is on the menu

Always thinking about food? What about food that doesn’t exist yet? On the 18th of September at De Studio, Next Nature Network will host a night of talks on the future of food and …

Visual of How technology bridges the generational communication gap

How technology bridges the generational communication gap

Emoji, Skype, Selfies - can these communication technologies close the generation gap? In part, yes! Young people are teaching senior citizens how to use technology, and it’s …

Visual of How to biofabricate leather

How to biofabricate leather

Leather is one of the oldest and most versatile materials in the world. It’s a supple, tough, relatively strong and durable material and it’s relatively impermeable, yet …

Visual of The Pyramid of Technology: How will a technology enter the human habitat?

The Pyramid of Technology: How will a technology enter the human habitat?

This question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …

Visual of The first human CRISPR trial in the US aims to cure inherited blindness

The first human CRISPR trial in the US aims to cure inherited blindness

Gene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …

Visual of Iceland is mourning a dead glacier

Iceland is mourning a dead glacier

Death certificates and commemorative plaques aren’t something you’d normally associate with a glacier. But that is exactly how Iceland recently mourned the loss of 700-year-old …

Visual of Lessons in bio design from Emma van der Leest

Lessons in bio design from Emma van der Leest

As a young bio designer at the start of your career, you'll have to overtake all kinds of obstacles. From the collection of living materials to working in a laboratory and …

Visual of Gène Bertrand on design for human needs

Gène Bertrand on design for human needs

Nature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …

Visual of The path towards solar democracy with Marjan van Aubel

The path towards solar democracy with Marjan van Aubel

Solar cells are often considered an eyesore, used for their sustainability yet not for their beauty. Installed on roofs or in solar parks, they take up precious space. Well that’s …

Visual of In conversation with Studio Drift

In conversation with Studio Drift

A flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …

Visual of Artificial bones for the natural meat experience

Artificial bones for the natural meat experience

The world is developing, climate change is happening and it's time for us to do something. Now. One strategy would be to simply stop eating meat — or at least reduce the amount of …

Visual of Smart homes could help dementia patients live independently

Smart homes could help dementia patients live independently

You might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …

Visual of The beginner's guide to biohacking

The beginner's guide to biohacking

What is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …

Visual of Work with us!

Work with us!

We are a network of makers, thinkers, educators and supporters. With members in 44 countries, we are the international network for anyone interested in the debate on our future – …

Visual of A guide to parenting with AI Barbie

A guide to parenting with AI Barbie

The rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …

Visual of How China is enjoying blue skies thanks to COVID-19

How China is enjoying blue skies thanks to COVID-19

Surrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …

Visual of It could be time to start thinking about a cybernetic Bill of Rights

It could be time to start thinking about a cybernetic Bill of Rights

Like it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …

Visual of Meatable: from stem cells to pork chops

Meatable: from stem cells to pork chops

The food chain has always worked roughly like this: sunlight feeds plants. Plants feed insects. Insects and plants feed animals. Plants and animals feed people. Then …

Visual of Our Next Nature Future Lab plan received funding

Our Next Nature Future Lab plan received funding

Hooray! This just in: Next Nature Network is granted a significant contribution from the Dutch government intended to develop a Future Lab for design & technology in Eindhoven …

Visual of Her is an outlook on the possible future of dating a chatbot

Her is an outlook on the possible future of dating a chatbot

With most of us stuck at home because of lockdown, for the singles around us intimacy may have turned into a distant dream. Could we find our salvation in technology? And what …

Visual of How a 6.000-year-old fruit fly gave us cheese

How a 6.000-year-old fruit fly gave us cheese

Historians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …

Visual of How public camera recordings domesticate us

How public camera recordings domesticate us

Facial recognition is increasingly being used in many countries around the world. In some cases the take up has been dramatic . As a result, people are being observed by cameras …

Visual of POND is a symphony of lights and water

POND is a symphony of lights and water

Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …

Visual of ‘Optimism is our duty’: in conversation with Koert van Mensvoort

‘Optimism is our duty’: in conversation with Koert van Mensvoort

We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …

Visual of Next Generation: listening to ultrasound waves with Sheng-Wen Lo

Next Generation: listening to ultrasound waves with Sheng-Wen Lo

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Next Generation: illustrating the remains of the anthropocene with Louise Silfversparre

Next Generation: illustrating the remains of the anthropocene with Louise Silfversparre

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Generation: Simulating textile ecosystems with Scarlett Yang

Next Generation: Simulating textile ecosystems with Scarlett Yang

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of 9 creatives in biotech you need to know right now

9 creatives in biotech you need to know right now

The field of biofabrication is still new to most people. As founder and CEO of Biofabricate, Suzanne Lee shared with us this exciting online event series Creatives in Biotech . If …

Visual of A countryside dweller's guide to the future

A countryside dweller's guide to the future

The current lockdown in much of Europe has city-dwellers flocking to the countryside to wait out the outbreak sweeping the continent. Seeking relief from coronavirus, urbanites …

Visual of Have you thought about your social media death?

Have you thought about your social media death?

Recently, Twitter announced it would be clearing all inactive accounts in an effort to free up dormant usernames and prevent the risk of old accounts being hacked. The new policy …

Visual of Nadine Bongaerts: 'We’re attempting to make foie gras based on stem cells'

Nadine Bongaerts: 'We’re attempting to make foie gras based on stem cells'

Biosensors, cultivated meat and spider’s silk. For synthetic biologist and Next Nature ambassador Nadine Bongaerts, these are all advances towards a new world, where polluting …

Visual of Synthetic skin is bringing the sense of touch to VR

Synthetic skin is bringing the sense of touch to VR

Current social distancing measures are all about keeping a physical distance from each other in order to flatten the curve. But this does not mean we have to keep a distance from …

Visual of The Invention of Morel is a techno-lovestory from the future

The Invention of Morel is a techno-lovestory from the future

Octavio Paz says calls  The Invention of Morel , “ without exaggeration… a perfect novel. ” According to Borges, “ to classify  [it]  as perfect is neither an …

Visual of Next Generation: Moving towards the plastic human with Max Ahluwalia

Next Generation: Moving towards the plastic human with Max Ahluwalia

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of What we can learn from The Social Dilemma

What we can learn from The Social Dilemma

Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …

Visual of This exhibition explores love in the internet age

This exhibition explores love in the internet age

Data Dating is an exhibition that explores what it means to find romance in the internet age. Love it or hate it, technology has transformed the way we date. So, how are digital …

Visual of Why physical distancing feels so unnatural to us

Why physical distancing feels so unnatural to us

For many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …

Visual of Why screen games are still real play

Why screen games are still real play

Play is a core part of a healthy childhood , through which children develop social, communication, cognitive and physical skills. Children’s play adapts to its circumstances. …

Visual of Why your pets can't spread the coronavirus

Why your pets can't spread the coronavirus

A Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …

Visual of 5 Dutch exhibitions you cannot miss this summer

5 Dutch exhibitions you cannot miss this summer

Interior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …

Visual of In conversation with cyborg musician Kai Landre

In conversation with cyborg musician Kai Landre

What does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …

Visual of Blind woman sees with new implant and plays video game sent straight to her brain

Blind woman sees with new implant and plays video game sent straight to her brain

It’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …

Visual of Check your technoprivilege!

Check your technoprivilege!

Technology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.

Visual of Next Nature plans for Evoluon honored with Region Deal

Next Nature plans for Evoluon honored with Region Deal

Good day astronauts of spaceship Earth! Today it was announced that Next Nature's plans for the Evoluon have been awarded a financial contribution of €7.6 million from the Region …

Visual of Evolving In Vitro with Yuval Yancovitch

Evolving In Vitro with Yuval Yancovitch

With 7.9 billion people and counting, the Food and Agricultural Organisation of the United Nations predicts that by 2050, food supply needs to grow by 70% in order to accommodate …

Visual of This exhibition explores the open ends of the apocalypse

This exhibition explores the open ends of the apocalypse

The exhibition "Apocalypse - End Without End" shows that the end is a human invention

Visual of La Belle Verte imagines a world of harmonious existence

La Belle Verte imagines a world of harmonious existence

Utopianism and dystopianism are themes often found in today’s movies, especially considering the increased awareness of the damage done to the Earth by human activities. Often …

Visual of Knitting sweaters from human hair

Knitting sweaters from human hair

The textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …

Visual of Max Liboiron: pollution is colonialism

Max Liboiron: pollution is colonialism

We now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …

Visual of Metaverse: 5 things you need to know

Metaverse: 5 things you need to know

What is the metaverse and to what extent should we believe that the vision being presented to us is really going to be central to our daily lives?

Visual of Mojo Visions augmented reality contact lenses kick off a race to AR on your eye

Mojo Visions augmented reality contact lenses kick off a race to AR on your eye

The digital world has been creeping closer to your face. Was a time when a laptop was about as personal as you got with a computer. Then came smartphones, and a few years later, …

Visual of Social media likes change the way we feel about our memories

Social media likes change the way we feel about our memories

Memories are often considered very personal and private. Yet, in the past few years, people have got used to notifications from social media or phone galleries telling them they …

Visual of This documentary tells the story of Biosphere 2

This documentary tells the story of Biosphere 2

Can we create a new biosphere on another planet? Documentary "Spaceship Earth" shows how - in the Arizona desert.

Visual of How a starfish inspires robotic design

How a starfish inspires robotic design

In a feat of biomimicry that seamlessly marries biology with physics, tests carried out at the University of Southern California’s Viterbi School of Engineering made fascinating …

Visual of That modernist dream of the house as butler is not going to happen

That modernist dream of the house as butler is not going to happen

Looking at evolution, we see that there’s always a next nature. Nature changes along with us. How will that influence our way of life in the future?

Visual of This machine makes human clouds

This machine makes human clouds

Humans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …

Visual of This year's electronic waste weighs more than the Great Wall of China

This year's electronic waste weighs more than the Great Wall of China

It’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics

Visual of We sequenced DNA from a million-year old mammoths

We sequenced DNA from a million-year old mammoths

Most people think of mammoths as the iconic woolly species from the last Ice Age, which ended around 12,000 years ago. But mammoths originated in Africa around 5 million years …

Visual of What Julia Watson is reading this summer

What Julia Watson is reading this summer

In an era of high-tech and climate extremes, we are drowning in information while starving for wisdom. Architect Julia Watson imagines a design movement building on indigenous …

Visual of The next generation xenobots are here

The next generation xenobots are here

In 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …

Visual of Five things not to miss at Floriade

Five things not to miss at Floriade

Here are 5 things you cannot miss at Floriade Expo 2022

Visual of Bio, Art & Design (BAD) Award Winners

Bio, Art & Design (BAD) Award Winners

The three winners of the Bio, Art & Design (BAD) awards have been announced.

Visual of Chloé Rutzerveld designs the food of tomorrow

Chloé Rutzerveld designs the food of tomorrow

You are in for a surprise when you look at food and concept designer Chloé Rutzerveld 's portfolio. It is hard to believe that somebody so young - she is just 25 - has already …

Visual of How technology will help us adapt to climate change

How technology will help us adapt to climate change

Climate change will transform how we live, but these tech and policy experts see reason for optimism

Visual of Growing artificial muscles

Growing artificial muscles

A team of researchers from Freiburg University has developed an artificial muscle that may result in improvements in medicine, prosthetics, and implants.

Visual of Growth is not the problem, but the solution

Growth is not the problem, but the solution

If we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.

Visual of The long history of the metaverse

The long history of the metaverse

Many aspects of the current metaverse were already familiar 143 years ago.

Visual of The Moon Gallery: the first museum in space

The Moon Gallery: the first museum in space

The Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …

Visual of Next Generation: Experiencing neo-robophilia with Hye Hyun Song

Next Generation: Experiencing neo-robophilia with Hye Hyun Song

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of The Cyborg Foundation is fighting for cyborg rights

The Cyborg Foundation is fighting for cyborg rights

Cyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.

Visual of Next Generation: Changing the oceans chemistry with Santa Ramaherison

Next Generation: Changing the oceans chemistry with Santa Ramaherison

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Why Borghildur Indriðadóttir wishes to perform on the Moon

Why Borghildur Indriðadóttir wishes to perform on the Moon

What is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …

Visual of The sense of privacy

The sense of privacy

Humans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.

Visual of The Furby threat to national security

The Furby threat to national security

We are now so used to communicating with some robotic device in our homes. But this skill cost Furbies a national ban in the US.

Visual of Organs from genetically engineered pigs may help shorten the transplant wait list

Organs from genetically engineered pigs may help shorten the transplant wait list

Demand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …

Visual of ChatGPT is getting stupider and we don't know why - so I asked ChatGPT

ChatGPT is getting stupider and we don't know why - so I asked ChatGPT

AI language model ChatGPT has hit the mainstream last year when it became widely accessible to everyone. Next to doing our (home)work, it became also a D&D Dungeon Master , …

Visual of A Dutch startup is saving the banana from extinction

A Dutch startup is saving the banana from extinction

There is a banana crisis happening right now. Our beloved yellow fruits are being threatened with extinction due to a fungal infection called Panama disease, which can wipe out …

Visual of Hurray! There are now vaccines for honeybees

Hurray! There are now vaccines for honeybees

A significant milestone has been reached as the US Department of Agriculture has granted approval to a vaccine for insects for the very first time. An important breakthrough, …

Visual of Tesla enhanced Lotus, now Lotus returns the favor

Tesla enhanced Lotus, now Lotus returns the favor

Lo and behold the new Lotus Eletre Hyper SUV car. It shouldn't be allowed to exist, yet you may meet it in traffic soon.

Visual of We can now grow insulin from lettuce

We can now grow insulin from lettuce

In a ground-breaking discovery, researchers at the University of Pennsylvania have achieved to produce insulin out of lettuce. There's no need for needles and injections anymore, …

Visual of Why we need space janitors

Why we need space janitors

Reduce, reuse, recycle. We know the drill. But how do we cope with a junkyard in space?

Visual of Soon you can have dinner in space in a low-carbon balloon (if you're rich)

Soon you can have dinner in space in a low-carbon balloon (if you're rich)

Get ready to take your dining experience to literal new heights, soon we are able to enjoy high cuisine at the edge of space. French company Zephalto is introducing extravagant …

Visual of Why looking at beaver dams might save the world

Why looking at beaver dams might save the world

Eddie Corwin studies beaver dams and ponds from satellite images in order to restore watercourses and wetlands, and establish nature reserves.

Visual of Browse the Catalog For The Post-Human

Browse the Catalog For The Post-Human

Augment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.

Visual of Furniture futures

Furniture futures

Wondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?

Visual of How to design your (home)office

How to design your (home)office

Designer Govert Flint proposes a new office concept, entirely based on movement and play.

Visual of The Petunia Carnage

The Petunia Carnage

To pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.

Visual of Enter Spa Sybarite: the luxury wellness center of our dreams and nightmares

Enter Spa Sybarite: the luxury wellness center of our dreams and nightmares

In conversation with film director Joshua Ashish Dawson about the future of wellness, climate anxiety and healthy cynicism India-born, Los Angeles-based film director Joshua …