Humane Technology #4: Resonate with human senses
Allison GuyPrinciple number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …
Search results for human
Humans Caused Mass Extinctions Before There Were Even Humans
Allison GuyHumans and other hominids have a reputation for bringing about mass extinctions. Homo erectus has been blamed for the disappearance of many African carnivores, our ancestors …
Humane Technology #6: Improve the Human Condition
Allison GuyAnd now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …
Humane Technology #2: Revive Human Intuitions
Allison GuyOur second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …
Humane Technology #3: Take Human Values as a Cornerstone
Allison GuyThe third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …
Human-animal hybrids could be used for growing organs
Mackenzie GrahamAround the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …
Humans could recolonize Earth after mass extinctions with ectogenesis
Matthew EdwardsLately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …
Humans Are the Sex Organs of Technology
Written by Kevin Kelly , published in The Technium . I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …
Human Nature Forecast
Koert van MensvoortInterview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.
Humanthesizer
Vincent KlerkxThe human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …
Humane Technology #1: Feels Natural
Allison GuyAll too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …
Humane Technology #5: Empower People
Allison GuyPrinciple number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …
Human Workers Get Increasingly Obsolete
Alessia AndreottiRobots are coming to replace humans at work, are they a real threat to the world’s unemployed?
Human Cloning Now Possible in China
Daniel FragaIs human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.
Humans to Blame for Global Warming
Koert van MensvoortGlobal warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …
Human genome sequencing soon child play?
Koert van MensvoortStarting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …
Human garbage can
Koert van MensvoortAnthropomorphobic object of the week. Created by Sarah Hatch .
Human Nature, designing the equilibrium with Koert van Mensvoort
NextNature.netUnder the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …
Humans Need Not Apply
Koert van MensvoortWarning, this video on the impact of automation on human labor might cause you to re-plot you professional career.
Human animal hybrid
Koert van MensvoortThis peculiar, half-human creature could be your cousin. No really; it is a sculpture by Patricia Piccinini entitled The Young Family , which, in turn, is part of a larger …
Human Nature as Pathology
Koert van MensvoortModern society seems to have transformed human nature into a pathology. Our emotions are controlled by drugs. We are forced to operate within a narrow bandwith of what are …
Human Augmentation™
TimoAs a gamer, I come across many visions of possible futures. But this trailer from the upcoming video game Deus Ex: Human Revolution , the third part in the Deus Ex series shocked …
Human-Like Robot Makes Freaky Joke About the Future of Mankind
Daniel FragaTo thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.
Human Tetris
Dr NaturalA tribute to the virtual world boomeranging back to the physical world by Mega64 . Or do you rather prefer the corny japanese gameshow version? Via Engadget ,
Human body farm
ElinWhy not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …
Human Landscape
Koert van MensvoortOur peculiar image of the week was created by artist Levi van Veluw , who reinvents the classical fine art of landscape painting, by moving from the traditional 'oil on canvas' to …
Human Barbie
Koert van MensvoortJust when you thought the Second Life hype was long gone, meet Ukrainian body artist Valerie Lukyanova who aims to turn Second Life into First Life. They call her the Human …
Human LCD
Koert van MensvoortNew media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .
Human Artist Hatches Ten Chicken Eggs
Ruben BaartFrench performance artist hatches 10 hen's eggs in Palais de Tokyo.
Human Furniture
Koert van MensvoortThis unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …
Human-Shaped Power Lines
Alessia AndreottiJust a project for now, but a far more creative way to deal with unsightly public works than tree-shaped antennas.
I'm not a robot: AI better at proving to be human than humans
Kelly van GemertResearchers at the University of California discovered that bots now excel at solving CAPTCHAs faster and more accurately than humans.
Team Human is a manifesto for humankind
Ruben Baart' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …
Video Game-Playing Robot Acts More "Human" than Humans
Allison GuyComputer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …
Talking non-human nonsense with Nonhuman Nonsense
Ruben BaartNonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …
To Be Human Is To Be Transhuman
Alessia AndreottiBuckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.
NASA's 'Human Computers' helped land the first human on the moon
Kelly van GemertNowadays mechanical intelligence is often chosen over that of our own human capabilities. But there was a time where our computers were still not always a match against our own …
Letter to Humanity
Koert van MensvoortNNN director Koert van Mensvoort writes a letter to humanity.
AI meal planner suggests humans to cook with human flesh and bleach
Kelly van GemertAI sure knows how to throw a banger of a dinner party. One that guests will never forget - or outlive. When New Zealand grocery store chain PAK’nSAVE introduced their new …
Why superhuman technologies will affect us all
Ruben BaartWhen you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …
Why human enhancement requires technological citizenship
Ira van Keulen and Rinie van EstNew technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …
Can technology be humane?
Koert van MensvoortWe must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …
On inhumane technology
Jack CaulfieldStick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …
The six principles of humane technology
Allison GuyWe must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …
A path to humane technology
Koert van MensvoortIn 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …
Next Generation: Moving towards the plastic human with Max Ahluwalia
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman
Ruben BaartWhat if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …
Longest Lived Human Embryo in a Lab
Elle Zhan WeiScientists keeping a human embryo alive in lab for 13 days for the first time.
Fly like a Bird? Get Human Birdwings
Koert van MensvoortDutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.
The Ecological Human
Rachel ArmstrongThe nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …
This machine makes human clouds
Kelly van GemertHumans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …
Meet Humanity beyond Race, it's Beautiful
Koert van MensvoortMeet Humanity beyond Race, it's Beautiful
The Posthuman Farm
Ruben BaartWu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.
The No(nhuman) Consent Form
Kelly van GemertThere seems to be a green shift happening in Dutch Design, where the traditional vision is slowly sprouting into a newer, more refreshing one. The biodesigners are emerging from …
Van Mensvoort Writes a Letter to Humanity
NextNature.netOn the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.
OUT NOW: Save the Humans! Book
NextNature.netThe SAVE THE HUMANS! book is now available on our web shop.
We Feel Empathy for Robots (Even if They Don't Look Human)
Stefan FinckenHuman test subjects felt empathy for dinosaur robots being cuddled or abused.
Save The Humans – Submit your Quote
NextNature.netWe call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.
This exhibition investigates how humans will live tomorrow
Ruben BaartOccupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …
Knitting sweaters from human hair
Kelly van GemertThe textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …
Did Monogamy Make Us Human?
Allison GuyPair-bonding sets humans apart from our relatives. But where did it come from?
Ectogenesis, Artificial Womb, Human Egg?
Hendrik-Jan GrievinkThe artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.
Merging AI with human brain cells
Kelly van GemertA team of researchers are currently investigating the fusion of human brain cells with artificial intelligence. Creepy or innovative?
Study finds humans still evolving and quickly
Dr NaturalBy Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …
2016 - Human Embryo Lives 13 Days in Lab
Elle Zhan WeiIn 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.
Neither Warfare nor Dumplings Are Innate to Human Nature
Allison GuyIn Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …
Meat-Eating Made Us Humans
Margherita OlivoEating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.
Save The Humans @ The Hoxton Hotel
Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'
Letter to Humanity in 25 Languages, Plus One!
NextNature.netRead the Letter to Humanity in Morse Code.
The Non-Human Noosphere
Allison GuyThe definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …
3 exhibitions that explore the relationship between humans and the environment
Freya HutchingsAs we go about our daily activities, we may lose sight of our connections with nonhuman life. Here are three exhibitions to encourage you to step outside of your everyday and …
Save the Humans - Call for Quotes
NextNature.netFor our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.
Five ways AI could make your car as smart as a human passenger
Max EizaDriving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …
A Brief History of Humankind
Koert van MensvoortHistorian Yuval Noah Harari takes us on a journey through the whole human history.
Is the Human Body Redundant?
Rachel ArmstrongThe increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …
Chrysler Looks to Human Lungs for a Better Gas Tank
Jonathon MarkowskiAlveoli in human lungs serve as the inspiration for designing better, stronger ways of storing compressed natural gas.
Robotization Makes Work More Human
Koert van MensvoortImagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.
The Anthropocene Debate: Marking Humanity’s Impact
Elizabeth KolbertIs human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …
Incredibly Shrinking Humanity
Allison GuyArne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow
The Soft Touch of a Human Hand
Martin TetterooNissan’s Engineers Are Creepily Trying To Replicate Human Skin
All Humans Piled Together Are So Tiny
Francesca BarchiesiAll humans on Earth put together are not enough to fill the Grand Canyon. We are so small yet so present.
Animals Give Leadership Lesson to Humans
Margherita OlivoWhat are the characteristics of the perfect leader? The answer could be found looking at nature.
GM Pigs for Animal-to-Human Organ Transplant
Alessia AndreottiScientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.
1537 - Homunculus: the Semi-Human
Elle Zhan WeiIn 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.
Scientists want to create human-cow hybrid
Koert van MensvoortScientists in the UK applied for permission to create part-cow, part-human embryos for research aimed at treating diseases such as Parkinson's and Alzheimer's. The embryos created …
Apes Like Cooked Food, and What that Means for Human Evolution
Allison GuyHumans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …
Jazz-Playing Robot Challenges Human-Computer Interactions
Margherita OlivoA musical robot able to improvise a jazz solo in response to an actual person performing jazz.
The Human Smart Home Assistant
Charlotte KuijpersArtist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.
The Pyramid of Technology: How will a technology enter the human habitat?
Hendrik-Jan GrievinkThis question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …
Making prosthetic nipples out of human hair
Kelly van GemertDesigner Arianna Pezzano creates prosthetic nipples using keratine coming from the hair that cancer patients lose during chemotherapy.
Transgenic Jell-O, more human than ever!
Allison GuyThe American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …
Internet Traffic is now 51% Non-Human
Koert van MensvoortSo you thought the Internet was made by and for people? Think again. A study by Incapsula , a provider of cloud-based security for web sites (mind you where this data comes from), …
Watch Out Whales, Humans Want Your Krill
Allison GuyKrill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …
Web Access Is A Basic Human Right
Alessia Andreotti"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.
Tooth fairy alert: Japanese company tests drug that can regrow human teeth
Kelly van GemertToregem Biopharma designed an antibody drug that can possibly regenerate teeth using the body's own tissues.
Hybrid Carp with human face
Koert van MensvoortI never expected anthropomorphobia to be evoked by a fish! This hybrid species fish was born between a carp and a leather carp in the pond of a personal house in Chongju. Each of …
Mapping the human desire to be touched
Dr NaturalFleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …
The Human LED screen
Marco van BeersAll living creates produce light by default, so do humans . Now researchers from US, China, Korea and Singapore collaborated have collaborated in order to create ultra-thin …
Beluga Whale makes Human-like Sounds
SelbyResearchers in the US have been shocked to discover a beluga whale whose vocalisations were remarkably close to human speech.
Did Forks Really Give Modern Humans an Overbite?
Allison GuyThe food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …
The Human Hamster Wheel Desk
Alessia AndreottiThe Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!
AI Defeats Human at Go
Ruben BaartGo world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.
Biopresence - Human DNA Trees
Koert van MensvoortImagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …
Radio controlled human
Arnoud van den HeuvelThink of this sonic vibe-technology inside any MP3 player ;)
Next humans
Arnoud van den HeuvelWhat will the human race look like in 1, 2, 3, 4 million years? Will it be one human race? Will there be a human race? Impressions of future scenario's must come from scientists, …
Pencils made from cremated humans
Dr NaturalArtist Nadine Jarvis fabricates pencils from carbon left over of cremated humans -- it's part of a larger "research project into post mortem." She notes that "240 pencils can be …
The Human Printer
Rolf CoppensFor a while now printer ink is probably the most expensive liquid per litre on earth. Still we need our images so badly that we accept this fact. The Human Printer manages to make …
Book as Human-Computer Interface
Stefan FinckenIn combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.
Maya YogHurt: Fermented Drink Made with Human Lactic Acid
Jiwon KimArtist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.
A Modest Future for Humanity
Koert van MensvoortThree minutes in the mind of Juan Enriquez, director of Synthetic Genomics.
20k human chip
Arnoud van den HeuvelAAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
Trading Humans for Trading Algorithms
Stefan FinckenThe economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …
#10: Enhance Human Experience, Don’t Replace it
NextNature.netPart 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …
Hacking Human Cells to Use Solar Power
Yunus Emre DuyarA new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.
Musical Journey Through the Human Body
Alessia AndreottiDe Motu is an interactive music app that let you experience your body through music and influence the sound with your own body.
The first human CRISPR trial in the US aims to cure inherited blindness
Vanessa Bates RamirezGene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …
NOT (Natural) AND NOT (mechanical) = human
Hendrik-Jan GrievinkEric Hoffer (1902-1983) You dehumanize a man as much by returning him to nature - by making him one with rocks, vegetation, and animals - as by turning him into a machine. Both …
Mirror Neurons – Simulation at the basis of Human Civilization
Koert van MensvoortWithin our society, imitation and simulation are typically seen as inferior symbols of a distorted mediated culture – think of fake Rolexes, plastic Christmas trees, silicone …
The Human Construction of Gay Animal Culture
Allison GuyMuch attention has recently been devoted to 'gay' animals. It's not the fact that many species have enthusiastic homosexual lives that should be surprising – there are convincing …
Who Needs Real Humans? Not H&M
Allison GuyClothing giant H&M no longer uses real humans in its online catalog. The company has admitted that it pastes real models' heads on computer-generated bodies. At least there's …
Rule #8: Use Human Ethics
NextNature.netPart 8 of the 11 part series Anthropomorphism and Design . Anthropomorphic products blur the boundaries between products and people. Ethical norms for people don’t usually apply …
Computer Algorithms Are Already Replacing Human Journalists
Allison GuyWill writing software eventually replace journalists?
World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center
Hendrik-Jan GrievinkWorkers are completely controlled by algorithms in Amazon's fulfillment center
One Generation in, Dolphins Still Transmit Human Tricks
Allison GuyDolphins in Port Adelaide, Australia, have been observed performing a remarkable trick : tail-walking, a trait so rare it has only been seen in the wild one other time. More …
Cake Made from Human Skin
Allison GuyCake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.
If Barbie Had Human Proportions
Alessia AndreottiWhat does Barbie look like when she has the proportions of a normal 19-year-old?
Technology Made us Human
Koert van MensvoortBuckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.
A Map of Mars for Regular Humans
Margherita OlivoIf we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …
New AI Model Can Mimic Any Human Voice
Elle Zhan WeiLyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.
Lucas Foglia's photography explores the uneasy relationship between humans and nature
Laura MalloneeThere’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …
Explore your relationship with AI
Ruben BaartWhat makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …
Interview Mark Wigley: "We are living in an ecology of antenna"
Ruben BaartWith the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …
Bio-Printer Creates Living Body Parts
Margherita OlivoBioprinter creates bespoke lab-grown body parts for transplant.
Making an AI supermarket with Nonhuman Nonsense
Ruben BaartWhat does the supermarket of the future look like? The Embassy of Food at Dutch Design week.
Browse the Catalog For The Post-Human
Veronica FanzioAugment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.
Gène Bertrand on design for human needs
Meike SchipperNature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …
Colonizing Mars with plants, not humans
MaithriThe idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …
Reconnecting with wildlife through biodiverse meditations
Ruben BaartSleep and dream like a koala, relax under biodiversity and feel the meditative effect of artificial wildlife.
Interview: Bruce Sterling on the Convergence of Humans and Machines
NextNature.netWe had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.
Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”
Jack CaulfieldHumanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …
Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body
Ruben BaartSpeculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.
Next Generation: Demonstrating non-human narratives with Lindsey Bundel
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Did Booze Make Us Modern?
Allison GuyA psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?
Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings
Alessia AndreottiFloris Kayak discusses online hoaxes and the future of technology.
Next Generation: Combining AI with human creativity with Sofia Crespo
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Technology: Intrusive or Supportive?
Ioana TomiciIs the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?
This book explains why cooking food was essential to human evolution
Ruben BaartA must-read to the Next Nature fan: Catching Fire: How Cooking Made Us Human (2009). Written by British primatologist Richard Wrangham, the author shares his hypothesis that …
Why we need space janitors
Kelly van GemertReduce, reuse, recycle. We know the drill. But how do we cope with a junkyard in space?
The future infrastructure of the blockchain might be green and humane
Koen WeselThe connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …
Cyborgnest: redefining human senses
Liam BekaertNature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …
We Are more Bacteria than Human
Ingmar NieuweboerOur bodies are microbiomes, suffering from our habit of cleanliness.
Beijing's dust storm: part human, part nature
Ruben BaartThe skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …
An Edible Drone for Humanitarian Aid
Ruben BaartNigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.
The Ouroboros Steak is a steak made out of human cells
Nellie FriedrichYou are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …
Controlling Human Odour
Florian Conradi and Michelle ChristensenThe ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …
I Want Wings!!!!!!!!!!!!!!
Nicholas CarrRead Nicholas Carr's essay on the transhumanist dream of having wings.
Anthropomorphobia
Koert van MensvoortAre you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
Enter the symbiocene
Glenn AlbrechtWhat if we would use the idea of symbiosis as the basis for the next period of Earth’s history?
Should we clone Neanderthals?
Zach ZorichIf Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
Time Between Emergence and Design
carolinenevejanPreviously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.
The World Without Technology
Kevin KellyI remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …
Next Generation: Experiencing neo-robophilia with Hye Hyun Song
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
A Stroll Through the Bubbles of Chemicals and Men
Etienne TurpinA stunning pre-history of the anthropocene
Next Generation: Shaping intimacy through objects with Pleun van Dijk
Ruben BaartPleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.
Next Generation: Exploring the vegetal cyborg with Marie Declerfayt
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Hello, superorganism
Koert van MensvoortWhen I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …
Can AI become addicted?
Thomas MoynihanIn 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …
Ecology – A New Opium for the Masses
Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …
An Ecstatic Dialogue with Richard Doyle
Jason SilvaWhen techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
The Moon Gallery: the first museum in space
Ruben BaartThe Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …
Pyramid of Technology: How technology becomes nature in seven steps
Koert van MensvoortHow technology becomes nature in seven steps
The Anthropocene Explosion
Koert van MensvoortWe have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
Intimate Technology: the Battle for Our Body and Behaviour
Rinie van EstTechnology is nestling itself within us and between us, has knowledge about us and can act just like us.
Next Nature Interview
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
From Eco-Apartheid to Earth Democracy
Vandana ShivaDo humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
‘Optimism is our duty’: in conversation with Koert van Mensvoort
Ruben BaartWe live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
Nurturing architecture
Ruben BaartThe way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.
It could be time to start thinking about a cybernetic Bill of Rights
Mike RyderLike it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …
The Coronation
Charles EisensteinFor years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
The 21th Century Paradigm
The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …
Billionaire space race: the ultimate symbol of capitalism's obsession with growth
Tim JacksonMars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …
Next Generation: Sensing the critical zone with Menno Brouwer
Kelly van GemertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
How can Big History help us think about the future?
Noriko Wynn'Big History' is a multidisciplinary study that seeks to put the human story into the context of a 13.8 billion-year story from the Big Bang to now.
The Uncanny Valley of the Pussycat Dolls
Koert van MensvoortMake no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …
Yes, Naturally
Ine GeversThe introductory essay from the Yes, Naturally book - available in our store!
Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial
Ruben BaartWe recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.
What we can learn from The Social Dilemma
Vanessa Bates RamirezIs social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …
Towards a global society as a superorganism
Ruben BaartToday we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
Organs from genetically engineered pigs may help shorten the transplant wait list
David KaczorowskiDemand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …
Could Biomimicry Help us Solve the Refugee Crisis?
Daniel FragaFrom nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.
Getting rid of that bit of unspoiled green
Sanne vander BeekThere it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …
Next Generation: Visualising the diversity of microbial species with Valerie Daude
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Why I'm turning my son into a cyborg
Vivienne MingImagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …
The Embassy of Health is designing a chronically healthy society
Eloise MaraisHow will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?
Moral Shortcomings in the Technology Debate
Rinie van EstDigital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …
Next Nature and the Curse of Oil
Tere VadénThe next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.
Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing
Ingmar NieuweboerInterview with Mike Thompson and Susana Cámara Leret.
Microbiocene: the microbiological archeology of the future
Linda ValentaIn configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …
In conversation with cyborg musician Kai Landre
Ruben BaartWhat does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …
Next Nature's must reads
Ruben BaartTen books that continue to inspire the next nature philosophy—gathered for you to read this summer.
Seeking Symbiosis
Ruben BaartVisual artist Heleen Blanken explores the complex relationship between people, nature and technology.
The Playboy Interview
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
Real Nature is not Green
Koert van MensvoortAt the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …
Next Nature Introduction
Bruce SterlingThis project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image. The facts …
Further Incredibly Shrinking Man
Koert van MensvoortArtist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.
Totem Animals for the Anthropocene
Ted HeistmanInvasive species become the animal symbols for a man-made world.
The Biosphere Code Manifesto
NextNature.netDuring the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.
The Enlightenment Is Dead, Long Live the Entanglement
Danny HillisWe humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
From Homo Sapiens to Homo Optimus
Ioana TomiciWe are entering an age of technological singularity, in which artificial intelligence and biological enhancement are combined in order to construct the next stages of human evolution.
Interview: Pauline Van Dongen, Designer Merging Fashion and Technology
Margherita OlivoDutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.
When will the first baby be born in space?
Chris ImpeyWhen the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …
Inverting the energy paradigm with Charles Eisenstein
Ruben BaartEnergy policy blah blah blah, life cycle analysis blah blah blah, energy return on energy invested, peak oil, carbon footprint, renewables, hydro, nuclear, blah blah blah blah …
The prehistoric importance of trading technology
Nicholas R. LongrichThen, as now, one person could literally change the course of history, with nothing more than an idea.
Why Borghildur Indriðadóttir wishes to perform on the Moon
Kelly van GemertWhat is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …
The sense of privacy
Marit BeerseHumans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.
Are we living in a superorganism?
Ruben BaartThe coverstory of Next Nature Magazine investigates how the rise of virtual influencers on social media reveals a superorganism.
Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture
Alessia AndreottiRachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.
The Modular Body
NextNature.netThe Modular Body is an online science fiction story by Floris Kaayk about the creation of OSCAR, a living organism built from human cells.
Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?
Ruben BaartWe talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.
How a museum encourages its visitors to examine their relationship with their environment
Linda ValentaLast month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …
On the prehistoric origins of modern sexuality
Ruben BaartLet’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …
The GeneSprout Initiative: cultivating new plant breeding techniques
Ruben BaartSome 10,000 years ago humans began to domesticate plants and animals. The birth of agriculture, one of the earliest technologies available.
Next Generation: Writing a design manifesto with Pleun Wilting
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
We Domesticated Ourselves
Allison GuyOur bodies are maps of our ancestor's social lives. We evolved, physically and behaviorally, in incredibly complex social groups. Such intense sociability may have favored the …
Designed to Survive Our Roads
Ruben BaartA road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.
“Everything Is Already Invented”
Ingmar NieuweboerRobert Gordon says all the major inventions have been made, but that's only true for our limited knowledge of future possibilities.
How AI is reshaping electronic music
Linda ValentaThe idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …
In conversation with Jalila Essaïdi
Freya HutchingsWhat do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …
Next Generation: Cooking with viruses with Pei-Ying Lin
Britta de VriesThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
The technosphere is outweighing the biosphere
Ruben BaartOur deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …
Next Nature is ancient
Ruben BaartUli Westphal's Seed Series is an ongoing attempt to document the seeds of all edible plants, one seed at a time.
The AI Revolution Is On
Ruben DaasSteven Levy writes in Wired on the unexpected turn of the Artificial Intelligence revolution: rather than whole artificial minds, it consists of a rich bestiary of digital fauna, …
Anthropo-scene #3: Morphing Earth, Piece by Piece
ChristianHumans act as bio-excavators that literally move mountains.
You Can Never Go Back To Nature
Annalee NewitzOne of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …
Heart Repair with Spinach Leaves
Julie ReindlScientists developed a procedure to repair your heart with a spinach leaf.
Recharge! Sun for Your Brain Cells
Julie ReindlA gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.
In Conversation with Marleen Hartjes: Introducing a digital door to the museum
Kelly van GemertDon’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …
Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith
Liam BekaertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Unlearning botanical narratives with Nina Škerjanc
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Can This Virtual World Save the Real One?
Alessia AndreottiA Dutch artist designs a Utopian eco-socialist online society.
Beyond the Possible with Floris Kaayk
Koert van MensvoortFloris Kaayk, artist and fictive documentaries maker, confronts us with the impossible.
Which Technologies will 2016 Bring?
Wei Lun WangThe new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …
Welcome to Chanel Data Center
Mathilde NakkenTwo robots opened the show of Chanel during the Paris Fashion Week of 2017. Well robots, two models dressed up like humanoid robots entered the catwalk. Is Chanel going Next Nature?
Next Nature Gift Guide 2017
NextNature.netThe gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.
The Robots Are Coming!
Koert van MensvoortRobots are getting stronger and smarter every day. They are taking over our whole lives. How long will I have my job before a robot steals it?
How to Train Your Robot
Alejandro AlvarezHumans and robots can work together to maximize the potential of both and boost productivity to new levels.
How AI and genomics will impact the future of making babies
Vanessa Bates RamirezAs if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
5 must-see exhibitions before the end of the year
Ruben BaartA large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …
Smart homes could help dementia patients live independently
Dorothy MonekossoYou might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …
The beginner's guide to biohacking
Peter JoostenWhat is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …
Seeing in 3D
Leanne VoshellIf you are a regular reader of content from Next Nature, then you know that 3D printing can be used in all sorts of technological developments, such as organ printing , food waste …
Can microbes communicate with alien species?
Ruben BaartAre we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …
Growth is not the problem, but the solution
Ruben BaartIf we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.
Next Generation: Designing ecological webs with Miriam Lellek
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Entryparadise
Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …
The NBIC Convergence: When Machines and Matter ‘Have Sex’
Rachel ArmstrongThe Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …
The Carnery - A Cultured Future with In Vitro Meat
NextNature.netIn vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.
Interview: Liam Young on Speculative Architecture and Engineering the Future
NextNature.netInterview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.
Meet the Band Aid of the Future
Margherita OlivoThis potentially revolutionary device includes LED lights and temperature sensors to provide medication directly to the wounded section of the skin.
Our Bodies, Our Fuel
Adriene LillyThis piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.
Robot’s Best Friend
Alessia AndreottiFrom chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!
Turning Poop Back Into Food
Alessia AndreottiNasa funded a program to turn astronauts’ poop into food.
Robots Taking Government Jobs
Ruben BaartMeet Amelia, the first robot to work along with human coworkers in a council job.
The New Male Birth Control
Ruben BaartA new contraceptive has appeared on the horizon, bringing the prospect of an alternative form of male birth control one step closer.
Your Next Nature guide to Dutch Design Week 2018
Meike SchipperOver time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …
People are less likely to turn a robot off if it asks them not to
Tristan GreeneA team of German researchers published a study earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …
The artificial womb: dream or nightmare?
Ruben BaartThe emerging technology of the artificial womb confronts us with a series of moral and societal questions. How to cope with that? Join us on 29 March at Eindhoven University of …
An introduction to biomimicry
Janine BenyusThe first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …
These Next Senses allow you to augment your senses with technology
Ruben BaartImagine you could communicate telepathically with a whale, listen to the WiFi networks in your environment, or experience smells through seeing color. Developments in technology …
Why physical distancing feels so unnatural to us
Isabelle Catherine WinderFor many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …
Understanding the ocean's metabolism
Marit BeerseScientists have discovered the effect of sunscreen on corals. We need to understand our impact on the world to understand its problems.
Next Senses
Ruben BaartNext Senses explores the unchartered territory of how we could experience the world with technology
Bacteria "R" Us
Rachel ArmstrongThere is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …
Illiterate Kids Learn to Hack Tablet Computers with No Outside Help
Allison GuyThe One Laptop Per Child program is experimenting with what at first seems to be the lazy way to philanthropy: dropping off tablet computers in remote Ethiopian villages and then …
Next What?
John ZerzanIn this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …
Innovative Nostalgia
Koert van MensvoortWe humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.
Neo-Evolution with Harvey Fineberg
Koert van MensvoortHumanity has three options when it comes to our evolution. Dr. Harvey Fineberg makes a case for "neo-evolution".
Electronic Skin can Detect Magnetic Fields
Yunus Emre DuyarThere is a new artificial skin technology that could give humans magnetoception in the future.
Transfigurations: Let's Design People
Daniel FragaPlastic artist Agi Haines explores hypothetical scenarios for surgically implanted body enhancements in babies.
Creating a Second Skin to Look Younger
Elise MarcusScientists managed to create what every woman has been dreaming of: a second skin to reduce wrinkles and tighten the skin.
Facial Recognition Replaces Passports
Ruben BaartBiometric technology replaces passports in Australian airports.
Designer Anouk Wipprecht combines fashion with robotics
Alessia AndreottiWe met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.
Our Relationship with Tech Is Growing Stronger
Megan Ray NicholsIt's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.
Sophia: World's First Robot with a Citizenship
Jack CaulfieldSophia the Humanoid, a human-like robot in appearance and mannerisms, was granted citizenship by Saudi Arabia and became the first robot with citizenship.
Virtual Baby Acts and Looks Impossibly Real
Charlotte KuijpersA rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.
HUBOT: Meet the Shiva Therapist
NextNature.netMeet the Shiva Therapist fro HUBOT. She massages with her own hands, but for the heavy work, she has four additional robotic arms at her disposal.
Reimagining popular apps with the Pyramid of Technology
Alejandro AlvarezToday, there's an app for everything. They help us satisfy our cravings, allow us to communicate at all times and make it easier to share special moments. But the dark, cold …
How animal filters unmask the estranged relation to our wild self
Meike SchipperWould you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …
The artificial womb: are we ready?
Ruben Baart“Within a few years it will be possible for a premature baby to continue to mature in an artificial womb,” says gynecologist Guid Oei. It is therefore that the Artificial Womb: …
Next Generation: Delving into biophilic design with Daniel Elkayam
Freya HutchingsThis story is part of Next Generation, a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Should men be able to give birth to children?
Koert van MensvoortWithin a few years, it may be possible for premature babies to grow inside an artificial womb. And when that day arrives, should men be able to give birth to children? Should we …
With this technology we can shake hands during the pandemic
Claire Ouwejan“Please refrain from hand shaking" is a common sign we now see as a result of public health organizations advising people to avoid shaking hands as a greeting. As people still …
Cyborg artist Moon Ribas feels earthquakes
Freya HutchingsImagine waking in the night, and feeling the vibrations of an earthquake on the other side of the world pulsing through your body. This is a reality for Catalan-born artist Moon …
Next Generation: illustrating the remains of the anthropocene with Louise Silfversparre
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Explore the future of nature at IDFA Festival
Kelly van GemertHumans often claim to be at the top of the food chain, but is that really the case? We are experiencing – now more than ever – our own fragility: an increase in natural disasters, …
The next generation xenobots are here
Simon CoghlanIn 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …
Next Generation: Wandering through the post wilderness with Melissa Schwarz
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Interview with a cyborg
Arnoud van den HeuvelErich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …
Out of Control
The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …
Next Nature Movie #4: Blade Runner
Koert van MensvoortLook around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …
There is not enough Africa in Computers
Koert van MensvoortBrian Eno - artist, composer, inventor, thinker - spoke to Kevin Kelly about the meaning of Africa for music and technology. "Africa is everything that something like classical …
Dolphin Wannabe
Arnoud van den HeuvelSame article , different example: Water Powered JetPack by Jetlev . (Thanks: Marlies Peeters)
Man Flies Like a Bird
Koert van MensvoortSome months ago we wrote about the dream of mechanical-engineer Jarno Smeets to fly like bird . Over the last few months Jarno worked steadily to materialize his dream. Today …
Nanotech Shots Take Mice from Drunk to Sober in Minutes
Stephen PerryEver curse the fact that you have to wait hours to sober up after a night at the bar? Now, you can sober up almost instantly – that is, if you're a mouse. Researchers at MIT …
The (Almost) Invisible Dancing Wheelchair
Jonathon MarkowskiDesigned by a dancer, a new wheelchair moves intuitively with the user's movements.
The Artificial Touch-Sensitive Hand
Alessia AndreottiRestoring the sense of touch with an artificial hand, using a brain interface.
Get Infrared Sight with a Vitamine Diet
Julia WeberBio-hackers developed a protocol to augment human sight to see into the near infrared range.
Making the Skin your New Touchscreen
Alessia AndreottiA tool that could turn the arm into a touch screen display.
We Are Weaker Than Our Ancestors
Alessia AndreottiHuman fitness has decreased so significantly that even the strongest of us would consider ancient men to have a supernatural force.
After In Vitro Burger, Chicken is the Next
Yunus Emre DuyarSoon, we might be getting a taste of the first lab-grown chicken meat.
Anthropo-scene #9: Sense, Sensors, Sensitivity
ChristianTechnology helps us understand the unfolding of the Anthropocene.
Ingestible Device to Monitor Vital Signs
Margherita OlivoBiomaterials researchers at MIT came up with a very tiny device able to monitor vital signs from deep inside the body.
See Through the Skin with Your Smartphone
Wei Lun WangIn the near future he ability to see through things won’t be a dream anymore with this infrared smartphone camera.
The Sketchbook Made Of Artificial Skin
Alessia AndreottiThe SkinBook is made of synthetic skin that allows beginner tattooists to practice their skills.
Watch out for Bullied Robots
Alexandra BremersDystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …
Future of Feelings: Emotion Reading Radio
Mathilde NakkenResearchers have the developed the EQ-Radio: a tool to read people emotions from a distance.
Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium
Ruben BaartDutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.
The Lightest Solar Cell Ever Made
Margherita OlivoResearchers created solar cells as light as a soap bubble.
Making King's Day More Sustainable
Margherita OlivoOn King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.
App Activates Cells That Manage Diabetes
Julie ReindlScientists develop engineered cells to be implanted in patients with diabetes to regulate blood sugar levels, controlled with a smartphone app.
Looking into the Artificial Eye
Elle Zhan WeiSensor specialists recently developed a sensor that mimics the mammalian eye.
3D Printed Capsule Replaces Needle Injection
Julie ReindlA needle free oral delivery system might in the future dissolve the old way of vacancies injected by syringes.
Personhood Status for Robots
Julie ReindlAn "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.
Sleep and Dream Controller
Lydia HaldersDevelopers at Dutch-based company Arenar have designed a device that not only claims to improve the quality of sleep, but also induces lucid dreams.
Stay Young with Millennial Blood
Ruben BaartA clinical startup sells millennial blood to reverse aging.
E-Skin Makes You Control Objects Without Touching Them
Charlotte KuijpersScientists developed an e-skin that lets the wearer manipulate virtual objects without touching them, by using magnetic fields.
If you could have another sense, which sense would you choose?
Meike SchipperColor-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …
Welcome to the CRISPR baby world—here’s what you should know
Vanessa Bates RamirezLast week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …
The Artificial Womb project receives funding to develop a prototype
Freya HutchingsHooray! The team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
Smart cities could give the visually impaired a new outlook on urban life
Drishty SobnathTravelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …
How climate fiction novels allow us to imagine possible futures
Adeline Johns-PutraEvery day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …
How future fashion could help us cope with isolation
Ruben BaartToday we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …
How technology keeps us connected
Britta de VriesAt this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …
An artificial skin to breathe underwater
Leanne VoshellThe human world often sees itself as separate from the rest of the natural world. Because we have deemed ourselves, ironically, as higher functioning beings over all others on …
In conversation with cyborg choreographer Moon Ribas
Ruben BaartIf we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …
The information age is starting to transform fishing worldwide
Ioana TomiciPeople in the world’s developed nations live in a post-industrial era, working mainly in service or knowledge industries. Manufacturers increasingly rely on sensors, robots, …
Geodesign
Nellie FriedrichWe have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.
Exploring Next Nature (2004)
Koert van MensvoortThe first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …
A Society of Simulations
Koert van MensvoortAn interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …
How biotech will drive our evolution
Koert van MensvoortAre you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …
End of Life Care Machine
Marco van BeersDesigner, artist and engineer Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …
Anthropo-scene #1: From Rocks to Thoughts
ChristianHow geology and humanity turn ancient algae into high-tech gadgets.
GM Mosquitoes: No Olfaction, No Sting
Alessia AndreottiEngineering mosquitoes to ignore the scent of human flesh.
Interview: Arne Hendriks, Researcher and "Father" of The Incredible Shrinking Man
Alessia AndreottiHendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.
The "Actroid" Lives in the Uncanny Valley
Allison GuyThe Actroid robot holds clues for climbing out of the uncanny valley.
A Plan to Eliminate Predators
Alessia AndreottiBritish philosopher David Pearce believes we should to stop animals from hunting and killing other animals.
Anthropo-scene #7: Anthropocene Bird
ChristianDue to human action, 1300 bird species are seriously in decline. Other birds have learned to live with humans and profit from their presence.
The Risk of Technological Unemployment
Daniel FragaStephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.
Fellow Day: Next Senses
Ingmar NieuweboerOn June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.
The future of the ECO Coin
Koen WeselHow can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …
Your next doctor might just be a robot
Jack CaulfieldConventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …
Maurizio Montalti talks about the cycle of life
Meike SchipperAs modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …
Recap of the Next Nature book launch
Next Nature DevThe new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …
How a 6.000-year-old fruit fly gave us cheese
John MorrisseyHistorians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …
Embracing the Future with Patricia Piccinini
Freya HutchingsPatricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …
Next Generation: listening to ultrasound waves with Sheng-Wen Lo
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Why your pets can't spread the coronavirus
Sarah CaddyA Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …
Exploring assisted evolution with Prof. Dr. John van der Oost
Marit BeerseAssisted evolution raises complex questions. The practice involves human intervention to increase the rate of natural evolutionary processes. A technique that inevitably …
Dancing at the intersection of natural and virtual worlds
Eleni MaragkouExploring the intersection of technology and art, a team of creatives presents a virtual performance that pushes the limits of human expression.
How to design your future family
Ruben BaartImagine a place called Reprodutopia. How would such a place look like?
Wild wild space
Veronica FanzioWhen Earth goes south, cowboys go all the way up. The Space Rush of 2020s has something to do with settler colonialism.
Breaking Point?
John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …
Information Decoration: Our Environment as an Information Carrier
Koert van MensvoortPicture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …
Gel Remote
Koert van MensvoortHuman-product relationships increasingly play out in a realm which was previously considered exclusive for human-human and human-animal relationships. Panasonic now redesigned one …
Homo Desktopus
Koert van MensvoortA future physical anthropologist who knows nothing about the human race and would dig up a contemporary desktop computer, might conclude homo desktopus must have been the user of …
Ars Electronica Festival goes Next Nature
This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …
Bulletproof Skin
Lisa van der VoortRecent work of artist Jalila Essaïdi exemplifies of how science and art can meet and create meaningful inventions for society. Jalila Essaïdi used the spider silk produced by …
The Monsters We Deserve
Allison GuyRecently, a video clip has been circulating the web that purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …
Arne Hendriks – Incredible Shrinking Man
Koert van MensvoortArtist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.
Walter Benjamin on Film and the Senses
During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …
A More Interesting, More Depressing Theory of Easter Island's Downfall
Allison GuyA new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.
Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas
Alessia AndreottiMedia artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.
Should Intelligent Sex Robots be Banned?
Daniel FragaThe Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.
Meet Yangyang, Actroid From China
Alessia AndreottiThe humanoid robot Yangyang can function autonomously, talking and gesturing while interacting with people.
Poem Passes the Turing Test
Yunus Emre DuyarZackary Scholl developed a program to produce a poem that passed the Turing Test.
Should We Fear Thinking Machines?
Maria RamosIt seems thinking machines could put the human race in danger. How realistic these fears are?
Stewart Helps People to Trust Self-Driving Car
Erik van der VeenStewart is a tactile interface that mediates the communication between human and self-driving car.
Artificial Senses for Navigation
Ruben BaartA team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.
Empowered by Robots Event Report
Mathilde NakkenA report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.
The First Artificial Intelligent Lawyer
Mathilde NakkenThere is an artificial intelligent robot called ROSS that is taking over the work of thousands of lawyers. Working non-stop, reading faster then any human attorney can do.
Traffic Lights for Smartphone Zombies
Ruben BaartGround Level Traffic Lights For Smartphone Zombies
Artificial Light Threatens Pollination
Daniel FragaA recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.
Technosphere Weighs 30 Trillion Tons
Koert van MensvoortIf humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.
How AI could revolutionize the teaching profession
Jack CaulfieldIn various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …
Exploring body architecture with Lucy McRae
Meike SchipperAs evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …
Next Generation: Thinking about the future of food with Annie Larkins
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Why there is a new urgency for speculative design
Freya HutchingsPink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …
(Im)possible bodies: responsiblity and care in our cyborg future
Koert van MensvoortWhat does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …
Living robots made from frog stem cells may revolutionize medicine
Freya HutchingsAt just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …
Next Generation: Speculating about the future with Deborah Rhyner
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Next Nature announces their 2021-2024 plans
Next Nature DevWith great pleasure we announce our plans for 2021-2024: ‘Hello, Superorganism’ . Our human presence has a huge impact on the planet; plastic in the oceans, climate change, mass …
What will COVID-19 teach us about life?
Koert van MensvoortWe live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …
5 Dutch exhibitions you cannot miss this summer
Ruben BaartInterior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …
Next Generation: Designing ecosystems of technology with Maike Gebker
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Designing chairs with mealworms and Will Eliot
Kelly van GemertWilliam Eliot designs chairs while collaborating with mealworms.
With this sound recognition technology scientists can eavesdrop on nature
Lucas ZarzosoWhat if humans would be able to listen to what nature has to say? Conservationists are trying to grasp non-human sounds , which might help us to better understand environmental …
A new mythology of technology
Ruben BaartIn conversation with architect Julia Watson, a leading expert on Indigenous technologies and author of 'Lo-TEK, Design by Radical Indigenism'.
Next Gen: De-exctincting the mammoth with Wendi Yan
Kelly van GemertWhat if an ancient mammoth found herself resurrected by humans into our modern age?
The Evolution of the Richer
Diogo CorreiaAre we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …
Having Invented the Gods, Perhaps we can Turn into Them
Jason SilvaMy name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …
Disaster Edens: The Anti-Tourist Attraction
Allison GuyImagine your cruise to the Galapagos came with a ghoulish warning: "Your hair will fall out, your skin will blister, you'll probably get cancer and your children's children might …
Live a happy life!
Marco van BeersRemember the movie Eternal Sunshine of the Spotless Mind, where Jim Carrey removes his memories of a relationship with Kate Winslet? According to researchers at the University of …
Swallowable Parfum
Koert van MensvoortSwallowable Parfum is a digestible scented capsule that works through your own perspiration. Once absorbed, fragrance molecules are excreted through the skin’s surface. A unique …
Can Life Be a Technology?
Rachel ArmstrongIn 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …
GM Bacteria Turn Carbon Dioxide into Biofuel
Allison GuyIn a twist on the classic " microbes that turn shit into petrol ", researchers at MIT have developed a bacterium that turns carbon dioxide into a direct substitute for gasoline. …
Huggable Vending Machine
Koert van MensvoortFinally a vending machine that doesn't want you money, it wants hugs. Embrace it to get a free can of coke. Might give you rushes of anthropomorphobia too though. Via The Pop-Up …
Ice Cream Cones Made from Ice Cream, and Other Wikicells
Allison GuyPlastic is a part of the earth's ecosystem , but it's a part that no one wants. At Harvard, scientists are looking to replace single-use plastic bottles, plates, and cups with …
Nano Product: Energy Belt
NextNature.netWith Energy Belt, stop treating your excess fat like a liability, and instead embrace its untapped potential. Artificial protocells in the belt mimic natural brown fat, taking …
Nano Product: Lungless
NextNature.net350 million years after crawling from the sea, the Lungless suit will bring us back. Inspired by fish gills, the Lungless Aquatic Respiration Suit uses millions of cascading …
Post Natural Organisms of the EU
Koert van MensvoortIf you happen to be in the neighborhood you might want to drop by at the exhibition Post Natural Organisms of the European Union in Amsterdam. The small but delicate expo, curated …
Rural Energy: From Kerosine to LED
Koert van MensvoortWhile for most of us, happy blog readers, access to electricity is taken for granted, things are quite different in developing regions of the world. In India for example, over 65% …
Will Eugenics Become an Acceptable Strategy to Avoid Climate Change?
Koert van MensvoortClimate change is one of the biggest challenges of today and various scenarios, ranging from artificial trees , pollution trading , co2 capturing to geo-engineering, have been …
Cow Poower! Bacteria Turn Poo into Fuel
Silvia CelibertiFarmers in the US are producing fuel and high-quality fertilizer from their cows' manure.
Get Your One Way Ticket to Mars
Alessia AndreottiWhat to do when earth is not enough? Thousands of people, tired of their life on Earth, are ready to emigrate to Mars. Since subscriptions opened on April 22, 80,000 people have …
Moments in Meat History Part I - Origins of Meat-eating and Hunting
Jonathon MarkowskiAbout 4 or 5 million years ago, major changes in the Earth's climate brought about grassland regions where giant mammals could graze.
Sony's Smart Wig: Top or Flop?
Alessia AndreottiSensors, a communication interface and an actuator for tactile feedback all hidden ina wig.
BrainDriver: the Mind Controlled Car
Alessia AndreottiImagine you could drive your car using only your thoughts. It is now possible!
Hemihelix: A New Geometric Shape
Alessia AndreottiRubber band distortions lead to discovery of a new shape called hemihelix.
Retro-Futuristic Smartwatch
Alessia AndreottiIn 1981 the idea of what we call smartwatch was nothing more than a funny joke.
Smart Contact Lens Can Monitor Glucose
Alessia AndreottiSmart contact lens project to monitor glucose.
Solaris: Mind-Controlled Magnets
NextNature.netSolaris gives participants the power to control a pool of magnetic fluids with their brainwaves.
The Moon will Become a WiFi Zone
Alessia AndreottiResearchers proved it is possible to provide the Moon with the wireless connectivity we have on Earth.
The Power Amplification Robot
Alessia AndreottiPower Loader: the power amplification exoskeleton robot.
Wearing Technology Under the Skin
Alessia AndreottiUnderSkin is a device that would be implanted beneath the skin on your hand and charge off your body’s energy.
A Tiny Trackpad That Fits on Your Nail
Yunus Emre DuyarResearchers from the Massachusetts Institute of Technology have developed a tiny wireless trackpad that could easily fit on your finger nail.
Apple Watch Evolution
Alessia AndreottiIn 1992, decades before the era of wearable technology, Apple produced its first watch: no apps and vintage design.
Archaeology of Media
Alessia AndreottiThe Archéologies des Medias exposition turns archaic technology that was once cutting-edge into art.
Technology and Emotions
Margherita OlivoA wearable lighting device that changes color and shade according to movement, facial expressions, weather and mood.
Changing your Mood on Demand with Brain-Altering Wearable Technology
Alessia AndreottiThync, is a new brain-altering wearable technology that promises to “shift your state of mind and conquer life” by allowing its users to change their mood whenever they need it.
Controlling Smart Devices with the Skin
Len KromkampiSkin is a flexible, stretchable and visually customizable on-body touch sensor for mobile computing.
Diseases Of The Future
Alessia AndreottiNowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …
Drugs Testing with Artificial Organs
Yunus Emre DuyarResearchers are working on artificial organs-on-chips will be used for drug development.
Ear-Free Headphones
Alessia AndreottiUsing bone conduction, this device allows to hear the sound directly in the head, keeping the ears free.
Google's Smart Interactive Clothing
Alessia AndreottiProject Jacquard makes it possible to weave touch and gesture interactivity into any textile.
Implanting Chips into Employees
Alessia AndreottiAn he hi-tech Swedish office block implanted a microchip under the employees’ hand skin.
Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society
NextNature.netWe recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between biosciences and society and the importance of communication to overcome the fear of new technologies.
Modafinil Boosts Your Brain
Erik van der VeenA pill that makes you smarter without causing harmful side-effects? Modafinil might be this “smart-drug”.
Algorithm Tells You How to Dress
Alessia AndreottiWhat should I wear today? The answer to one of life’s big questions could came from an algorithm created to solve all your fashion problems.
Organs Could Self-Heal with Nanoneedles
Yunus Emre DuyarAn international team of scientists used nano-sized needles in order to promote production of new blood cells.
Sexy Car – From Russia with Love
Koert van MensvoortHumans cannot have intercourse with cars or replicate with them, so why would we find cars sexy anyhow?
The Hotel Run by Robots
Alessia AndreottiA futuristic Japanese hotel will be run by robots, designed to be extremely human-like.
Are These the Headphones of the Future?
Monika KozubNo matter which brand is going to rule the wireless headphones scene, it's time to get used to have a computer in our ear that we never need to take out. Until it may grow into it someday!
Bye Bye BlackBerry
Ruben BaartBlackBerry has just confirmed that it will no longer create its own phones, marking the end of an era for the once dominant leader of the smartphone market.
A.I. Can Guess Exact Locations of Images
Margherita OlivoGoogle's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.
Doctors Used VR to Save a Baby's Life
Margherita OlivoGoogle Cardboard was used by a cardiologist to train for a very risky heart surgery on a four months baby.
EcoHelmet: Foldable, Recyclable and Cheap
Monika KozubThe new recyclable, foldable and affordable bike helmet can change city bike sharing for good.
Facebook Provides a Suicide Prevention Tool
Ingmar NieuweboerFacebook provides a new tool for suicide prevention
The First Baby with Three Genetic Parents
Mathilde NakkenThis year, on April 6th, a baby was born with three genetic parents: two mothers and one father.
Good Air Quality? You Get Free WiFi
Margherita OlivoThese birdhouses in Amsterdam share free Internet whenever the air quality improves.
Lunar Insurrection Vol.2: Harvest Moon
Daniel FragaLunar Insurrection is a group of architects that explores the creative possibilities of the moon as a potential territory for human activity and inhabitation. In Vol.2 , their …
Man Controls Prosthetic Arm with His Mind
Ingmar NieuweboerResearchers at the John Hopkins University School of Medicine succeeded in hooking up a prosthetic arm to the human brain.
Payment by Thumb
Alessia AndreottiAustralian biohacker Meow-Ludo Meow Meow implanted a chip in his thumb to make contactless payments.
Pigs Have a Heart for Us
Elise MarcusReplacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.
Racist Robots and Bloodthirsty Crowds
Daniel FragaIt took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.
Solar Energy: the Hottest New Currency
Lewis JustEnergy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.
A Step Further in the Race Against AI
Alejandro AlvarezToday, we all have superpowers. It may not seem like it because we are attached to our physical devices to use our powers, but with a Neural Lace that may soon change.
A Tablet for the Visually Impaired People
Margherita OlivoU.S. researchers are working on an affordable braille tablet for blind people.
Talking Contact Lenses
Ruben BaartResearchers at University of Washington have introduced a new wireless communication method that allows small wearable devices to ‘talk’ to everyday devices.
This Indestructible Micro-Animal Will Help Us
Monika KozubWill a small step for Ramazzottius Varieornatus be a giant leap for mankind?
A Temporary Tattoo That Heals
Monika KozubMoving tattoos from purely aesthetic crave to a healing method thanks to nanotechnology.
Scientists Connected a Brain to a Tablet
Ingmar NieuweboerSeverely paralyzed woman controls a tablet with her brain.
Air Pollution Mask for Kids
Ruben BaartDanish design studio Kilo created an air pollution mask suitable for kids aged six and up.
Artificial Womb Workshop at BioClub Tokyo
NextNature.netOn August 8, NNN gave a workshop at BioClub Tokyo to share some insights on the future of technologies concerning human reproduction, sexuality and relationships.
The New Way to Boost Creativity
Julie ReindlDanish company develops device to stimulate creativity.
Brainwaves as Password
Elle Zhan WeiResearchers have found a way to use our brainwave as a verification of our identity.
The Digital Mythology of... Super Mario
Daniel FragaMythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.
Ecosexuality: Make the Biosphere Your Lover
Ruben BaartEcosexuality reconceptualizes our perspective on the biosphere by having consensual experiences with it.
HUBOT: Meet the Focused Assembly Worker
NextNature.netAs a focused assembly worker, you are a real go-getter thanks to your smart tools. Wearing smart factory goggles and using a transparent LED screen, these give you direct …
Gene Therapy Cures Chronic Disease
Elle Zhan WeiGene therapy can cure up to 200 different diseases and the list is growing.
Google Cars Can Now Sniff Out Pollution
Jack CaulfieldGoogle cars can now measure urban air quality and collect data to create interactive maps with the most detailed views of pollution patterns ever created.
HUBOT: Meet the Exoskeleton Mover
NextNature.netA job from HUBOT: as an exoskeleton mover, you wear a motorized exoskeleton suit that gives you the muscular power of a gorilla.
HUBOT: Meet the Blind Traffic Regulator
NextNature.netA visual impairment does not have to be confining and futile when it comes to traffic control. As a blind traffic regulator, you wear a haptic suit that translates the traffic …
HUBOT: Meet the Data Waiter
NextNature.netAs a data waiter you are working at the Tinder restaurant. Upon arrival, visitors log in with their social media account. An intelligent algorithm matches the guests based on …
HUBOT: Meet the Farm Director
NextNature.netGames are often played to escape a boring daily reality, but they can also teach us to take control over the land as farmers do. As a farm director you work in a gamified …
HUBOT: Meet the Remote Savior
NextNature.netWhen giving first aid, all kinds of emotions are in play. Thus it is important for the victim of an accident to receive emotional assistance and to be mentally supported during an …
HUBOT: Meet the Supersmart Handyman
NextNature.netDon’t worry, a handyman doesn’t have to be a bookworm. You rather work with your hands than sitting in the library. And yet, you often need to read the manuals of the broken …
A Robot Will Spark the Next Avant-Garde
Nadine Roestenburg “An illegal theme park exposing the ideology of the aesthetics of hacking”. “A hybrid drone targeting technological domination”. “A psychedelic fridge to raise doubt about fake …
Pay with Your Face
Elle Zhan WeiFace-detecting systems in China now authorize payments, provide access to facilities, and track down criminals.
Jobs for Creators - Robots at Work #2
Mathilde NakkenHave a look at our series Robots at Work! In this episode we present you five jobs for creators, the ones that build with their hands.
HUBOT: Meet the Singing Package Deliverer
NextNature.netYou did not make it to the Idols final, but you can sing very well and you love to make people happy. As a singing package deliverer, you deliver packages with a personal song. …
Smart Fabric Might Be the Key to the Future
Charlotte KuijpersResearchers designed a smart fabric able to encode data readable by a magnetometer, like the one in your phone, without electronics or batteries.
A Voice Mask to Protect Your Privacy
Ruben BaartIntroducing world's first voice mask designed to protect your privacy.
What an artificial womb may look like in the future
Hendrik-Jan GrievinkIn the future, artificial wombs could replace incubators as they mimic the natural environment of the female uterus. But what will these devices look like?
Next Nature Network x Border Sessions:
Calling for festival bloggers!
NextNature.net
Calling all bloggers! We’d love to have you on board for the 2018 Border Sessions festival in The Hague (NL). Join our team for behind-the-scenes access to festival events. To …
Edible packaging: Seaweed could replace plastic in disposable packaging
Jack CaulfieldWhat to do about the plastic planet ? The seas are steadily filling up with plastic , and it's vital to find ways to address the problem . One way to do this is to move away from …
HUBOT: Meet the Digital Detox Dietitian
NextNature.netAs a digital detox dietitian, you know exactly how much digital technology your client needs and you give professional advice with a personal approach.
HUBOT: Meet the Walker Inspector
NextNature.netWhile many people consider a rollator as a sign of decay, you as a rollator inspector are just part of the headway! The walker inspector measures air quality, particulate matter …
HUBOT: Meet the Street Knitter
NextNature.netBricklayer, a physically heavy occupation, becomes a lot more bearable with the street-knitting robot. The street knitter is a job from HUBOT.
Technology and Sports: Nutrigenomics
Megan Ray NicholsWe’ve been told since grade school that what we eat is important, but we’ve all been told to eat the same sort of healthy things. This isn’t bad, but with the up-and-coming …
The Pyramid of Technology: How will we co-evolve with technology?
Hendrik-Jan GrievinkThis question is an excerpt from the Pyramid of Technology toolkit Cooking is a process through which humans outsource part of their bodily functions to technology (think …
How biotechnology could shape the future of product design
Ruben BaartHumans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …
The Coming World: ecology as the new politics
Ruben BaartIn science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …
The church of AI
Linda ValentaWould you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …
Watch the BBC report on world's first artificial womb
Ruben BaartNow that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
Suzanne Lee wants to live in a world that uses only sustainable materials
Ruben BaartBiotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …
Next Generation: Hearing the first breath of Earth with Dora Lionstone
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This app allows you to talk to quarantined people around the world
Ruben BaartLoneliness is one of the silent serial killers during the pandemic. Therefore Next Nature provides you the tip to pick up your phone. Artists Danielle Baskin and Max Hawkin …
This exhibition explores love in the internet age
Ruben BaartData Dating is an exhibition that explores what it means to find romance in the internet age. Love it or hate it, technology has transformed the way we date. So, how are digital …
A message from volcanic rocks
Laura van den BrinkAlthough it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …
It's been fifty years since we took the first full photo of Earth from space
Robert PooleThe image of the whole Earth as seen from space has become a symbol of the environmental movement. Time for an update?
To decarbonize flying, we need biofuels
David Simon LeeWhile aviation accounts for 2.4% of all emissions from fossil fuel use globally, two-thirds of the sector’s warming effect depends on something other than its CO₂ emissions. And …
Check your technoprivilege!
Hendrik-Jan GrievinkTechnology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.
This electronic skin enhances our virtual tactile perception
Kelly van GemertFrom mouse, to stylus, to finger: our virtual tactile perception has changed a lot over the years, just like our overall virtual experience. With new developments our virtual …
How plastic waste is hurting women in developing countries
Kutoma WakunumaIf we are to build a greener, fairer and more equal society in the wake of COVID-19, it’s time for rich countries to end their practice of dumping plastic waste in developing …
We could power households from the scraps in our food waste bins
Ananya MukherjeeImagine if you could power your kettle using the energy generated from the vegetable cuttings quietly breaking down in your kitchen’s compost bin. That reality might not be so far …
Reproducing robots
Leanne VoshellWhen we think of robots, we typically do not think of small cellular organisms made with embryonic cells from frogs. However, this is exactly what the joint teams at University of …
Animals are shapeshifting to cope with climate change
Sara RydingGlobal warming is a big challenge for warm-blooded animals, which must maintain a constant internal body temperature. As anyone who’s experienced heatstroke can tell you, our …
This year's electronic waste weighs more than the Great Wall of China
Vanessa Bates RamirezIt’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics
Meet the lungs of the sea: phytoplankton
Abigail McQuatters-GollopPhytoplankton are microscopic algae living throughout the ocean’s surface waters. They can’t swim and are at the mercy of the currents and tides. Despite their small size, …
Building with biocement
Marit BeerseUsing the waste streams from the chemical industry and urine to make biocement.
Sónar Lisboa: a festival for body and brain
Ruben BaartSometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …
Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni
Kelly van GemertWhat if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?
Friending, Ancient or Otherwise
By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …
Remote pets
Arnoud van den HeuvelHumans have domesticated animals for thousands of years. The earliest known evidence of a domesticated dog is a jawbone found in a cave in Iraq and dated to about 12,000 years ago …
DrinkPeeDrinkPeeDrinkPee
Arnoud van den HeuvelDrinkpeedrinkpeedrinkpee is a project by Britta Riley and Rebecca Bray about the role our bodies play in larger ecosystems. It's an installation about the Urine to Fertilzer DIY …
Hyperfins
Tijn KooijmansThe next step in biomimetic body extentions for propelling yourself through water. Man moves on from copying ducks to become a dolphin-like cyborg. With these fins you can be …
Suffering from Anthropomorphobia?
Koert van MensvoortAnthropomorphobia is the fear of acknowledging qualities we wish to consider only human in non-human things. Sufferers from the condition used to have trouble mostly at fairs or …
Think Hello
Arnoud van den HeuvelRemember Asimo ? Honda has now developped a new Brain-Machine Interface technology that allows humans to control the humanoid robot simply by thinking certain thoughts. The BMI …
Next Nature Movie #1: Quest for Fire
Koert van MensvoortThe Quest for Fire (1981) shows the Next Nature of 80.000 BC. Set in a world without highways, supermarkets, airports, Internet, television, farming, money or written language, …
11 Golden Rules of Anthropomorphism and Design: Introduction
NextNature.netWelcome to the 11 part series The Golden Rules of Anthropomorphism and Product Design. In this series, we will be examining how designers can better integrate human-like forms or …
Back to the Tribe
Koert van MensvoortTraditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …
Flap to Freedom
It works like this. Position yourself with a friend in front of a battery hen and flap your arms as fast as you can when the music sets in. The harder you flap the faster your …
Nintendo Portables Are Breeding Grounds For Sexy Fun
Vincent KlerkxSexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …
The Earth on Loan
Allison GuyChristian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the Next Nature …
The Sound of the Blue Canary
Berry EggenBlue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
The Technological Sublime
Jos de MulThe sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …
A Fake Sun for Your 25/7 Life
Allison GuyThe earth operates on a 24 hour cycle, and so do humans. For most of history, we didn't have much choice in the matter. However, in the absence of visual cues light sunlight, some …
Lions Relocate to the Suburbs
Allison GuyAs cities push to the edges of the wilderness, wild animals are increasingly com
Rule #7: Respect Social Standards
NextNature.netAnthropomorphic products enter the human social space. Humans have the most complex social behavior of any organism on Earth. Anyone or anything trying to join in should be careful to do it right.
A Frankenstein-esque System
Fenna Klein TuenteThe boundary between humans and machines is slowly but steadily blurring. The Immortal is a machine which exists out of several life-support machines connected with wires and electric cords.
A Lifetime of Questions through Google
Hendrik-Jan GrievinkGoogle becomes the authority on existential questions about aging.
EcoBot III: a Robot that Produces Energy Fueled by Organic Matter
Alessia AndreottiThere are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …
Fuel Your Body With Algae Headgear
Alessia AndreottiAlgae as the future alternative fuel for the human body.
What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks
Deborah GordonEver notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …
Painting the Anthropocene
Alessia AndreottiGovedare paints the human impact on natural environments, showing how nature has become a subset of culture.
Dynamic Exoskeleton Chair
Svetlana MironcikaAn exoskeleton chair that allows the body to move freely.
How Technology is Becoming More and More Sensitive
Margherita OlivoOver the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …
The Golden Quarter
Michael HanlonSome of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?
AI Teenage Girl Hit by Depression
Ruben BaartAn AI was intended to improve human-like experiences in regards to the company’s customer service chatbots, but has fallen into a suicidal depression instead.
C-Sections Caused an Evolutionary Change
Mathilde NakkenC-sections have an unexpected side effect on human evolution. Newborn heads are getting bigger, while the mothers birth cannals are becoming smaller.
But will lab-grown meat be kosher?
Benjamin Aldes WurgaftRead Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.
Evolution Will Change the Way We Sleep
Margherita OlivoA group of researchers is working to optimize the way we sleep, increasing our relaxation, and therefore reducing the time devoted to our naps.
Augmented Biology: Growing Ears on Apples
Alejandro AlvarezA promising way to grow body parts: using an apple.
How We Domesticated Food
Margherita OlivoWe tend to believe that the fruit and the vegetables we eat today are "natural" and the same as they always were. It turns out that in the past this familiar food didn't look like this at all.
Medical Practice Aided by Robots
Ioana TomiciRobots in health care could lead to a doctorless hospital.
Storing Knowledge for Eternity
Margherita OlivoResearchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.
The Supermarket with No Employees
Alessia AndreottiThis automated store in Sweden doesn’t have any human employees, only a smartphone app.
Untouched Nature Is Entirely Gone
Margherita OlivoResearchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.
Welcome to the Age of Plastic
Margherita OlivoAccording to a new study, humankind is now entering the "Age of Plastic". The research investigates the evidence that we are living in the Anthropocene, a time in which humanity is the main geological force.
2017 - Artificial Womb Incubates Fetal Lamb
Elle Zhan WeiA lamb born at the equivalent of 23 weeks in a human gestational period was kept alive in an artificial womb and developed just as if it was in a normal womb.
1932 - "Brave New World" Published
Hendrik-Jan GrievinkAldous Huxley published Brave New World in 1932, bringing the idea of the artificial uterus to the big audience.
ECO Coin Award Interviews: Shubhendu Sharma
Jack CaulfieldWe asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.
Explore Depths from Your Chair
Mathilde NakkenTo explore deep sea Standfort University developed OceanOne: a humanoid diving robot, which at the same time creates a simulation of the underwater experience on land.
Female Menstrual Cycle on a Computer Chip
Julie ReindlThe complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.
A Floating Gym in Paris
Ruben BaartThis floating gym harnesses human energy to sail down the Seine River in Paris.
Hire a Smart Robot
Daniel FragaWhat if your co-worker was a robot? Dutch startup Smart Robotics is a job agency for robots that allows you to hire a smart-robot.
HUBOT: Meet the Robot Coach
NextNature.netCraftsmanship is generally very appreciated, but it takes a lot of time to master a craft. Therefore, as a robot coach you train - you guessed it, a robot - to transfer your …
Preventive Punishment for Robots
Elle Zhan WeiThe Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".
The Economy of Ecology
Lewis JustWhat if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?
Custom-grown bones, and other wild advances in regenerative medicine
Vanessa Bates RamirezThe human body has always been an incredible machine, from the grand feats of strength and athleticism it can accomplish down to the fine details of each vein, nerve, and cell. …
Next hospitals: How virtual reality is shaping the future of medicine
Jack CaulfieldAnd it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …
The world’s plastic problem is bigger than the ocean
Christopher J. PrestonAs you read this, a strange object that looks like a 2,000-foot floating pool noodle is drifting slowly through the central north Pacific Ocean. This object is designed to solve …
This startup uses body heat to mine crypto
Camille CharluetWhile many love to speculate about the sheer number of jobs that robots and artificial intelligence are going to replace in the near future, no one seems to be coming up with any …
Discussing bio-based material experiences with Elvin Karana
Meike SchipperThe world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …
In conversation with Studio Drift
Meike SchipperA flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …
Social animals are the inspiration for robot swarms
Edmund HuntFrom flocks of birds to fish schools in the sea, or towering termite mounds , many social groups in nature exist together to survive and thrive. This cooperative behaviour can be …
What is a species?
Henry TaylorA koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …
How China is enjoying blue skies thanks to COVID-19
Britta de VriesSurrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …
POND is a symphony of lights and water
Nellie FriedrichHave you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
Matilde Boelhouwer wants to make urban environments flower again
Ruben BaartMatilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …
Is in vitro meat good news for animals?
Ruben BaartThe Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …
The new Next Nature book is here!
Next Nature DevWe live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
Swiping is the new touching
Nadine RoestenburgFrom all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …
Next Generation: Building aquatecture with Shaakira Jassat
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Notes on the plastisphere
Shahar LivneEvery piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …
Science Friction explores living among companion species
Ruben BaartIs it possible to imagine other earthly stories? Can we conceive of other ways of living among different species? This exhibition explores these issues with the help of a …
Growing artificial muscles
Marit BeerseA team of researchers from Freiburg University has developed an artificial muscle that may result in improvements in medicine, prosthetics, and implants.
The Cyborg Foundation is fighting for cyborg rights
Marit BeerseCyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.
Next Generation: Fantasising about fashion with ShirpShiro
Kelly van GemertFinding realistic solutions to the humanitarian and environmental issues in the textile and fashion industries.
Artist refuses photography prize after admitting his image was AI-generated
Vanessa Bates RamirezA German artist refused a photography prize after admitting his image was AI-generated.
Playing Pong with lab-grown brains
Kelly van GemertBiotechnology startup Cortical Labs successfully guided human brain cells in a petri dish through a simulated game of Pong.
Potatoes from Mars
Ruben BaartIt might sound like the title of a bad horror movie. But cultivating potatoes in space may soon be more than just fiction. Scientists and biologists are currently using simulated Mars and moon soil to experiment with space farming. One of them is space farmer Wieger Wamelink.
The fantastical living landscapes of AUSGANG Studio
Kelly van GemertAUSGANG Studio combines art, technology, and living materials to tell stories of our world's trajectories.
The World is not a Desktop
Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …
Faustian Bargains and Pineapple Shampoo
Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …
Luxalive - The emotionally aware lamp
Koert van MensvoortSo you thought that animated Pixar Lamp from the movies was just a fantasy? Not anymore. Luxalive is a prototype of an reading lamp that moves according to the character of its …
Blood Cells 2.0
Marcel van HeistUnlike many people fear that computers will overtake humans, Ray Kurzweil states that robots will merge with humans, robots the size of cells which can do the job way more …
Crash course on synthetic genomics
Koert van MensvoortNext Monday when your colleagues ask you what you have been doing for the weekend, you might answer you something default like you went out with friends, danced, biked to the …
Deliver us from Skeuomorph Prosthetics
Koert van MensvoortNo, this is not another example in our fake for real series , comparing an artificial with a human hand. Rather, you are looking at twice the same hand: with and without its …
Doggerland – Mapping a Lost World
Koert van MensvoortSo you think climate change is new? So you think the flooding of landmass by the oceans is a new? So you must have not heard of the times when people walked from London to …
Synthetic biology demystified
Koert van Mensvoort://nextnature.net The expanding research culture of synthetic biology demystified in this TV item on the International Genetically Engineered Machine competition . Via Posthuman …
Geminoid Female
Arnoud van den HeuvelProfessor Hiroshi Ishiguro ( Intelligent Robotics Laboratory at Osaska University) has done it again! This time in coöperation with robot-maker Kokoro Co. Ltd . Objective: to …
Razorius Gilletus – On the Origin of a Next Species
Koert van MensvoortIs the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …
Babel Fish
SelbyResearchers are working on a language and a device that will help humans and dolphins talk with each other. Denise Herzing , a researcher and founder of the Wild Dolphin Project …
Living Life Support
Allison GuyDesigner Revital Cohen imagines a future where life-support machines are replaced with life-support animals. In this scenario, a transgenic lamb is allowed to frolic in the fields …
System Animals
Koert van MensvoortWhat animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …
Take your transgenic kids to the CPNH
Allison GuyThe Center for PostNatural History doesn't house the dinosaurs or dioramas of your run-of-the-mill natural history museum. Instead, it's the first museum dedicated exclusively to …
Unboxing Artificial Intelligence
Arnoud van den HeuvelDid you know that phones were once used for calling up our (human) friends? Researching the beginning of it all, we came accross demo video's on the cloud called "internet" where …
Voodoo Phone
Koert van MensvoortJapanese professor Hiroshi Ishiguro from Osaka University has quite a track record of threading the uncanny valley. Remember his Doppelgänger Robot and Geminoid Female ? His …
Better Than Nature?
Rachel ArmstrongAt the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments. These teeny tiny photogenic doggies, which had been …
Better Walking with Robotic Legs
Simon RiezebosThe Berkeley Robotics & Human Engineering Laboratory is researching a way to improve the performance of human bodies. They are doing innovative research in the field of …
Nature is Dead, Long live Nature
Koert van MensvoortLike we did to old nature before, we must now cultivate our technological environment.
Thirsty? With a Cyborg Bladder, You'll Never Need to Drink
Allison GuySome desert animals, like the kangaroo rat, get through their lives without needing to drink even a drop of water. Now, a Japanese design company aims to make humans just as …
Bionic man
Marco van BeersAn showcase of what we are currently capable of installing in human beings.
Computer Teaches Itself to Play Games
Geert van den BoogaartAn algorithm observes human players to learn how to beat Super Mario Bros.
Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert
Alessia AndreottiAn interview with Daisy Ginsberg, artist and synthetic biologist.
Invisible Headphone Implants
Alessia AndreottiInvisible ear implants for listening to music, getting directions, and recording conversation.
Q&A with CEO of In Vitro Meat Company "Modern Meadow"
Stephen PerryExcerpts from the Rebbit AMA with Andras Forgacs, founder of a company that manufactures in vitro meat.
Animals Love Technology
Alessia AndreottiA macaque stole a tourist's iPhone and fiddled around with it like a human would.
How Technology becomes Nature
NextNature.netIn this talk at TEDxGhent, our own Dr. Van Mensvoort shows how technology becomes nature in seven steps and what engineers, inventors, designers and entrepreneurs can learn from that.
Retro Robot Band
Alessia AndreottiThe '50s robot band, Le Trio Fantastique, is exemplary of human distant longing for technology that integrates with our body and senses, to the point of taking our place!
What’s the Point If We Can’t Have Fun?
David GraeberSince Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.
WikiGalaxy
Alessia AndreottiTurning 100,000 entries from the Wikipedia into a growing nebula of human knowledge.
"The End": a Virtual Opera Singer, Millions of Fans and the Meaning of Death
Alexandra BremersSixteen-year-old Japanese singer Hatsune Miku grew in short time to a worldwide popstar. With her colourful appearance she counts millions of followers on social media, she …
Gene-Edited Micropigs Will Be Soon Sold As Pets
Wei Lun WangEarlier this year, a group of Chinese scientists published a paper about the modification of the genome of human embryos with the cutting-edge powerful technique called CRISPRs. …
Genome Editing - Bringing the Übermensch to a Shelf Near You
Daniel FragaLast April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …
Harvard Creates Half-Man Cyborg Flesh
Yunus Emre DuyarBioengineers at Harvard University have created the first cyborg tissue.
Hearing Colors
Hessel HoogerhuisThanks to the antenna implanted in his skull, Neil Harbisson can hear images and paint sounds.
Abandoning Modern Life to Live as a Goat
Wei Lun WangConceptual designer Thomas Thwaites is currently investigating and experiencing to live life as a goat.
Stratospheric Sky Garden with Proto Life
Alessia AndreottiA sky garden of cacti and artificial life forms floating a hundred thousand feet above the Earth's surface.
AI Outsmarts Face Masking Methods
Monika KozubThe latest researches showed how AI can recognize human faces even if pixelated and meant to be incognito.
The First Fully Autonomous Soft Robot
Ruben BaartThe Octobot is the first of its kind made fully of soft materials and is aimed to pave the way towards a more safely interaction with humans.
The First Self-Driving City Coach
Ruben BaartMercedes-Benz just revealed the first self-driving city coach and took it to the streets of Amsterdam for a test drive.
The Bioengineered Elixir of Life
Mathilde NakkenScientists say they can reverse aging by reprogramming the genome.
How Is Hi-Tech Changing Sports?
Margherita OlivoHitech is changing sports, but what are the consequences?
Computers Need Domestication
Alejandro AlvarezSoon we won’t program computers anymore, we’ll train them like dogs.
Mentally Disordered Robots
Nadine RoestenburgWhile robots are becoming more and more human, with all their sensors and information processing abilities, may it be likely that they too could develop mental illnesses?
What if Mosquitoes Were Only a Zoo Species?
Mathilde NakkenGenetic engineers are developing techniques to kill several types of mosquitoes.
This Robot Takes Care of Your Children
Ruben BaartThis robot nanny is designed to take on adult responsibilities, raising concerns regarding the consequences of using robots to raise our children.
Robots Are Making Pizza Now
Ruben BaartA new wave of automation lies in pizza. Not only will robots deliver your pizzas in the future, they will even make them.
Self-Driving Trucks Hit the Highways
Margherita OlivoA driverless convoy of trucks drove through Europe and safely arrived in Rotterdam yesterday.
1916 - Artificial Womb Appeared in Cinema
Elle Zhan WeiIn 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.
1999 - Ectogenesis Enters The Matrix
Elle Zhan WeiThe movie The Matrix brought ectogenesis to the public eye.
Artificial Womb: the Timeline
NextNature.netNNN is currently doing a preliminary research into the idea of the artificial womb. This timeline will help you navigate through the investigation.
Add-on Body Parts: Bionic Thumb
Charlotte KuijpersRoyal College of Art graduate Dani Clode reframed prosthetics as extensions of the body, rather than replacements for missing parts.
Dinner with Chef Watson
Ruben BaartChef Watson knows over 10.000 recipes. The highbrow robotic cook invited us over for dinner during the first Neo-Futurist Dinner at Mediamatic.
Living on Water for a Sustainable Planet
Charlotte KuijpersCompany Blue Frontiers wants to build 7.500 square meters of floating city made up of linked platforms, starting 2018. They hope to complete it by 2020.
Govert Flint on Enrichers
Ruben BaartNNN fellow Govert Flint discusses Enrichers in Frame magazine.
Interview: Lining Yao, Interaction Designer and Maker of Novel Materials
Alessia AndreottiWe recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.
Opening HUBOT at DDW
NextNature.netThe robots have arrived! Yesterday we celebrated the launch of HUBOT , job agency for people and robots at MediaMarkt , as part of the Dutch Design Week in Eindhoven. Our virtual …
HUBOT: Meet the Organ Designer
NextNature.netAs an organ designer, you develop genetic algorithms from which organs are grown to perfectly fit the recipient’s body, but also to meet the personal wishes of the patient.
Jobs for Caretakers - Robots at Work #1
Mathilde NakkenThis is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.
Scientists Create Ghost Heart
Julie ReindlThe Texas Heart Institute researches in the field of organ transplantation. With the “ghost heart” — an heart organ scrubbed clean of all its former cells, the researches are on the verge of creating a sustainable and effective way of transplanting organs.
Rescue Drone Will Save You in Open Water
Elle Zhan WeiDrone made to rescue in bad weather condition in open waters.
This artwork lets trees tell the story of climate change
Linda ValentaIn our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …
Future AI may hallucinate and get depressed — just like the rest of us
Tristan GreeneScientists believe the introduction of a hormone-like system, such as the one found in the human brain, could give AI the ability to reason and make decisions like people do. …
Gamers are the new athletes: Sports in video games from Pong to VR
Jack CaulfieldSports have always had an important place in human societies, providing entertainment, exercise, and a demonstration of the exceptional things the human body can achieve. But in a …
A happy birth day to Louise Brown
Hendrik-Jan GrievinkDear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …
I like my steak lab-grown, not-grass fed
Angus HerveyRight now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …
Interview: Designer Shahar Livne is geomimicing the future of plastics
Kelly van GemertWe sat down with Shahar Livne, an Israeli-born designer who graduated from the Design Academy in Eindhoven to talk about her vision on the future of plastics.
Open Call for ECO Coin Award 2018 Submissions
NextNature.netNominate an inspiring project, platform, person or community who is tackling food waste for the ECO Coin Award 2018
Face the future of intimacy with Kiiroo
Ruben BaartMeet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …
AI creates images of food that doesn’t exist (yet)
Tristan GreeneA team of researchers from Tel-Aviv University developed a neural network capable of reading a recipe and generating an image of what the finished, cooked product would look like. …
Air pollution may be making us less intelligent
Barbara MaherNot only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …
Why electric cars should be allowed to drive faster
Koert van MensvoortIn response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …
There are 299 trees growing in a football stadium
Ruben BaartSome centuries ago landscape painters taught us to appreciate the quality of an untouched landscape. Ever since we have been doing everything to recreate it. We camouflage cell …
A guide to parenting with AI Barbie
Siri BeerendsThe rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …
We are all parent Earth
Ruben BaartLast week I was strolling through the aisles of the supermarket when I heard a buzzing sound coming from my pocket. I looked up from my cart and saw it was a message from …
This documentary tells the story of Biosphere 2
Ruben BaartCan we create a new biosphere on another planet? Documentary "Spaceship Earth" shows how - in the Arizona desert.
Bio, Art & Design (BAD) Award Winners
Next Nature DevThe three winners of the Bio, Art & Design (BAD) awards have been announced.
Jurassic World scientists still haven’t learned
Ruben BaartJust because you can doesn’t mean you should – real-world genetic engineers can learn from the cautionary tale. “ Jurassic World: Dominion ” is hyperbolic Hollywood entertainment …
Hedgehog's robotic fungi farms
Selin KirBeyond being little umami bombs, mushrooms are: protein-packed and nutritious. But here's the pitfall: their cultivation can be pricy. Especially gourmet mushrooms such as …
Enter the memesphere
Laura van den BrinkWhy memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.
How to design your (home)office
Govert FlintDesigner Govert Flint proposes a new office concept, entirely based on movement and play.
The Museum of Edible Earth
Kelly van GemertWe spoke with the Museum of Edible Earth, a travelling museum dedicated to the prosperous amount of soil samples.
5 must see exhibitions in 2023
Selin Kir1. THE FUTURE IS PRESENT Design Museum Danmark How will contemporary design define the future? THE FUTURE IS PRESENT grasps the very essence of Danish artistry of material …
A Model's Body
Hendrik-Jan GrievinkDutch photographer Koen Hauser blends parts of the human body with parts from anatomical models. You know, the ones you had in biology class and gave you this fine colorful …
Do you "MIND"?
Arnoud van den HeuvelNeuroSky (founded in 2004) innovator in "wearable" bio-sensor/signal processing systems and SEGA TOYS are developing mind-controlled computer games and next generation consumer …
Rhythm robot Keepon
Arnoud van den HeuvelThe goals of "understanding humanity" and "humanizing robots" are tightly related to each other. Infanoid Project is trying to relate robotics to human sciences in order to …
True Knowledge beats Google
Arnoud van den HeuvelWhat you are looking at, is the logo of perhaps the (in idea) biggest competitor on the search-engine market. It is beta-testing right now, but its demo video looks promising. Why …
Call for Proposals: Designing for Next Nature
Nowadays, children know more corporate logo's and brands than bird or tree species. The average Western person has more worries about the instability of financial markets and …
Evolution in the Bedroom
Arnoud van den HeuvelGood morning anywhere in the world! Waking up is a problem (at least for 50% of the population). That's why alarm clocks exist; machines and devices are invented to solve …
Future playground
Rolf CoppensShot taken before the robot in question short-circuited and started to kill all humans in sight.
Peer-to-Peer Immigration
Koert van MensvoortAt the beginning of the computer era, many objects and experiences from everyday life were transferred to the digital environment in order to make technology understandable (think …
Tail communicator
Sara'The LED Dog Tail Communicator' is an initiative of James Auger and Jimmy Loizeau, and it is part of the larger 'Augmented Animals' project. Its focus points to technological …
Voyage of the Bacteria Bots
Dr NaturalThe 1966 science-fiction movie Fantastic Voyage famously imagined using a tiny ship to combat disease inside the body. With the advent of nanotechnology, researchers are inching …
Bacteria that Turn CO2 into Energy
Koert van MensvoortWe’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …
Ear on your arm? Why not?!
ewesFor over 40 years Australian artist Stelios Arcadious Stelarc has made art with medical instruments, prosthetics, robots, virtual reality systems and biotechnology to investigate …
Liberate the Breast Cancer Genes
Arnoud van den HeuvelOn May 12, 2009 the ACLU and the (not-for-profit) Public Patent Foundation, filed a lawsuit, charging that patents on two human genes associated with breast and ovarian cancer are …
Mapping the DNA World
Koert van MensvoortDNA related tools, once expensive and restricted to research and crime labs, are rapidly becoming affordable. Like GPS – once a high-tech wonder now turned into a everyday gadget …
Supermarket – Our Next Savanna
Koert van MensvoortWe are living in the future and we find it boring. The best place to gather evidence for this claim is the supermarket. To begin with, try and have a fresh look at the word: …
Tattooed Goldfishes
Koert van MensvoortIf a tattooed pig is a bit too much for you, why not go for a tattooed goldfish? They bring you lost of luck and are available Chinese characters such as “Wealth, Dragon, …
The Robot Versus the Sign
Arnoud van den HeuvelQuote Eric Horvitz : "After finishing my doctoral work, I returned to Stanford Medical School to finish up the MD part of my MD/PhD. During one of my last clinical rotations, I …
Ars Electronica 2010: Artists Adressing NextNature
Ties van de WerffSind wir noch zu retten? That was the slogan of this year’s Ars Electronica festival in Linz (Austria). Titled ‘REPAIR’, the media art festival urged to leave our scepticism and …
Cultivating the Money-verse
Orestis TsinalisAlright, we were mistaken. Money isn't virtual after all. A recent TV commercial of a Greek bank shed light on the issue. Your money lives, is anthropomorphic and inhabits an …
Friendly Vending Machine
Koert van MensvoortDesigner Guus Baggermans was quite annoyed by the clumsy impoliteness of current vending machines, that typically require you to enter some abstract number to select your drink or …
Mud Tub
Koert van MensvoortMud tub is an experimental tangible interface that allows people to control a computer while playing in the mud. By sloshing, squishing, pulling, punching, etc, in a tub of mud …
Self–Repairing Architecture
Rachel ArmstrongAll buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
Technology vs Football: 4-4
Ties van de WerffSome matches remain interesting, even though they're predictable. Take the continuous battle between technology and football. Every time the stakes get high, such as at the World …
US Judge Rules Gene Patents Invalid ?because they are Natural
Koert van MensvoortDid you know that about 20 percent of your body isn't really yours? It has been patented by some corporation you probably never heard of. You can't patent gold, you can't patent …
American Hyperbodies
Allison GuyLady Gaga is famous for fashion that exaggerates or obscures her body, but a few months ago, she made a foray into 'actual' body-modification. Gaga appeared on Jay Leno's talk …
Birdfeeders spit Blackcaps in two species
Koert van MensvoortUntil now, most people have likely regarded bird-feeders as merely a pleasant addition to their gardens. But scientists have now discovered that bird-feeders in the UK are …
City Rats Love Ethnic Food
Allison GuyCity rats, it seems, prefer the same foods that humans do: Greasy, fatty, sweet, and salty. Although rats are usually seen as the billy goats of city life, ready to chow down on …
I am not a Robot. I am a Unicorn.
Arnoud van den HeuvelAt Cornell Creative Machines Lab they were curious to see how two "chatbots" would make conversation. Powered by Cleverbot , created by AI researcher Rollo Carpenter, the robots …
Is that a hamster in your pocket or are you just pleased to see me?
Natalie DixonMobile phones may be the most affective technology we own but researchers at the Design Research Lab in Berlin have taken this notion to its most outlandish limit. Their cellular …
![Visual of Manko & Life [#8]](https://nextnature.net/media/pages/magazine/story/2011/manko-life-8/f762250e48-1602632753/manco-8-868x486.jpg)
Manko & Life [#8]
Aston RevolaManko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …
Robo-teacher
Arnoud van den HeuvelSay hello to teacher Engkey ! The city of Daegu — South Korea, introduced 29 robot teachers in 19 elementary schools as part of a large scale project to robotize teaching. The …
The Cat Parasite that Sells Motorcycles
Allison GuyThe protozoa Toxoplasma gondii makes an unobtrusive home in nearly every warm-blooded species, but it's prolific life is limited: Toxo can only reproduce in cat stomachs. The …
The Incredible Shrinking Man
Lisa van der VoortIt has been a trend for people to grow taller and taller during the evolution. When people get taller, they will need more energy, food and space. Since the human population is …
Bonobos (And Maybe Baboons) Domesticated Themselves
Allison GuyWhile evidence indicates that humans domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …
Monkeys Fall into the 'Uncanny Valley' Too
Koert van MensvoortThe uncanny valley, a phrase coined by Japanese robotic researcher Masahiro Mori nearly three decades ago, describes the uncanny feeling that occurs when people look at …
Robutt
Arnoud van den HeuvelTokyo University of Electro-Communications , revealed SHIRI (? = "buttocks"), a "Buttocks Humanoid That Represents Emotions With Visual and Tactual Transformation of the Muscles." …
Rule #5: Consider Zoomorphism as an Alternative
NextNature.netFor past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. When a product imitates animal behavior, the strict social rules …
Where Be Dragons? Try Your Instinctual Fear of Snakes
Allison GuyThis last Monday rang in the Chinese Year of the Dragon. Not restricted just to the benevolent, snake-like creature of Chinese mythology, or to the greedy, princess-stealing …
Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology
NextNature.netAn interview about the history and promises of synthetic biology, and the problem with the word "nature".
Microchips Learn to Repair Themselves
Daniel BlokbergenTaking a cue from the human brain, a new microchip can rewire itself after damage.
Birdhouse Sweet Birdhouse
Alessia Andreotti3D printer company MakerBot recently launched a contest inviting designers to create the birdhouse of the future. The winner is The American Craftsman Bungalow by Brent J. …
Bright Streetlights Make Us No Safer, and Why That's Good News
Allison GuyArtificial lighting at night makes us fat, depressed and sick. What are the alternatives?
Electric Skin Could Allow Robots to Feel
Koert van MensvoortA new kind of piezotronic transistor mesh could make for robotic skin that’s as sensitive as your own is, covered in thousands of tiny mechanical hairs.
Engineering Beneficial Parasites
Lloyd AlbertsBreeding parasites to improve immune function, skin tone and even resistance to poison.
Hate Babies? Why Not Give Birth to an Endangered Species?
Allison GuySolving the world's population crisis by replacing human infants with aquatic creatures.
Killing Cancer Cells, Arcade-Style
Alessia AndreottiA speculative nanotech pill that lets you virtually rove your body, zapping cancer cells as you go.
Lego Minifigs Will Take Over The Planet By 2019
Silvia CelibertiImagine the devastation when there are more Lego minifigs on Earth than humans...
Loyal Lamps that Follow You Like Pets
Alessia AndreottiTwo lights that behave like pets, acting and reacting like autonomous creatures.
Moving From Password to Biometric Data
Alessia AndreottiUnlock our devices with our fingerprint, this technology for security represents a change in our digital life.
Paradise Reset
NextNature.netInterview with our own Koert van Mensvoort in the IKON Television Documentary 'Paradise Reset' on the future of human nature.
Shape-Shifting House Acts like a Flower
Jelle LangeraapImagine your home adapting itself to seasonal, meteorological and even astronomical conditions by changing its shape. D*Dynamic is based on the discovery of mathematician Henry …
Smart Sock Makes Your Feet Speak
Alessia AndreottiA new wearable device provides runners with info on posture, rhythm and stride length.
"Soylent" Liquid Meals Will Save the World
Alice FumeyCan a meal replacer save us money, time, and maybe even save the world?
Transfer a Loving Tap Via Bluetooth
Alessia AndreottiA bracelet able to transfer a touch between two people.
When Is Biomimicry Not Really Biomimicry?
Jonathon MarkowskiA entomologist gives another explanation for that famous fruit fly with ant-patterned wings: it's not evolution, it's human error.
World's First In Vitro Hamburger Arrives
Allison GuyBreak out the ketchup: Mark Post has grown the world's first entirely artificial burger from cultured beef cells.
Animals Doing Extreme Stunts
Koert van MensvoortCGI video of animals doing crazy stunts makes us realize how peculiarly creative humans really are.
Cat-like Sensitive Whiskers for Robots
Alessia AndreottiElectronic whiskers put sensitive catlike sensors on robots.
In Vitro Meat: Animal Liberation?
NextNature.netMany people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
Plastic Pollution Solution
Lotte BiesheuvelIs there a possibility to clean up the oceans from plastic pollution?
Professions Of The Future
Francesca BarchiesiAs technology evolves, what today seems like science fiction may be the job market of tomorrow: 11 professions of the future.
Recovering Phosphorus from Wastewater
Julia WeberResearchers found a technology that allows to recover valuable substances from wastewater.
Robotic Furniture puts IKEA to Shame
Koert van MensvoortScience Fiction taught us to think of robots as human-like beings, yet the robots that actually make it into your home are more likely to look like furniture.
Sexy High Heels
Koert van MensvoortOur peculiar image of the week makes us shivers with Anthropomorphobia.
3D Printed Fish Remove Toxins and Deliver Drugs
Alessia AndreottiResearchers from UC San Diego announced that they have developed 3D print tiny microrobots in the shape of fish able to detect and remove toxin from liquid.
Analogue vs Digital: Handwriting
NextNature.netWill handwriting soon be history? Or will we always prefer a handwritten love letter from our beloved?
Anthropo-scene #10: From Thoughts to Geology
ChristianIt's more than two years since I have started this exploration of the Anthropocene for Next Nature for you. We have visited many places together, places I have traveled to as a …
Anthropo-scene #8: Anthropocene Rabbit
ChristianWith cities covering growing area of land, we humans and our spaces build the new wilderness for animals and plants.
Did a Robot Grow your Vegetable?
Alessia AndreottiThe world’s largest indoor farm is not the only firm developing vertical agriculture. Japanese company Spread plans to grow more than ten million heads of lettuce a year by …
How Many Trees are There on Earth?
Alessia AndreottiThere are about 3.04 trillion trees on Earth. That is 422 trees per human being.
Let Your Drone Mow Your Lawn
Yunus Emre DuyarIf you do not want to slave away under the sun, pushing a bulky mower around, drones can do it for you.
Local Deliveries: Robots or Drones?
Margherita OlivoStarship, a robot that will remodel our local deliveries system.
Medical Microbots Used to Perform Biopsy
Hessel HoogerhuisWith recent successful experiments, we may see doctors switching from the single forceps to hordes of so-called microgrippers.
Ocumetrics Bionic Lenses can Triple Your Eyesight Capability
Daniel FragaDr. Garth Webb, an optometrist from British Columbia, has invented the Ocumetics Bionic Lens : lenses that after being implanted through an eight minute surgery, improve eyesight …
Order Anything with Amazon's Button
Yunus Emre DuyarAmazon introduced a new gadget, named Dash Button, that will help you order groceries automatically.
Smart Gloves Turn Gestures into Music
Yunus Emre DuyarEnglish artist Imogen Heap, with an army of artists, musicians, scientists and technologists, developed the Mi.Mu gloves.
The Future of Artificial Reproduction
Yunus Emre DuyarAccording to researchers we could go a step further and use stem cells derived from your skin cells.
Turning Cockroaches into Rescue Robots
Yunus Emre DuyarCyborg cockroaches might be used for search-and-rescue operations in the future.
Empowered by Robots Design Challenge
NextNature.netWanted: New jobs for humans and robots! Which designers, technicians, robot enthusiasts will help us with innovative, feasible ideas for the new jobs of the future?
When FB Replaced Editors with Algorithm
Ruben BaartFacebook had just fired their curatorial team for the ‘Trending’ news section over an algorithm, resulting in false stories attacking a news anchor, a writer, and Mac Donald’s.
Landfills Cause Changes in Bird Migration
Margherita OlivoGarbage dumps may not be very attractive places for us but they sure are for animals. A study published in Science Advances shows how certain groups of storks modified (and …
Explore Mars with NASA's VR Experience
Margherita OlivoExploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.
Computer-Simulated Realistic Sounds
Daniel FragaResearchers at MIT have created a system that is able to simulate sounds that are so perfect that they can even fool human listeners.
Rethinking 3D Printing for the Future
Nadine RoestenburgAdditivism is a movement that calls for radical rethinking of new technologies, such as 3D printing, the plastification of the world and our human position within it.
A Robot to Help The Refugee Crisis
Margherita OlivoIn the last months we've been witnessing a refugee crisis of huge proportions. More than a million people crossed the sea to flee violence in Africa and the Middle-East. Together …
Are Robots the Future of Tattoos?
Ruben BaartAn industrial robot just tattooed the first person ever in San Francisco.
Will We Share .thought Files?
Mathilde NakkenWith the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.
Meeting the Future at TodaysArt
Monika KozubLast week The Hague hosted a festival dedicated to contemporary experiments in music, art and digital culture.
What's Flying There? Coloring Book
NextNature.netWhat’s Flying There? is a coloring book that opens up new perspectives for drones applications in the human habitat.
The World's First Cyborg Olympics
Margherita OlivoThe first cyborg Olympics will take place in Zurich in October.
Digital Detox: Disconnect to Reconnect?
Nadine RoestenburgDo you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!
Flying Car Modular Transport System
Elle Zhan WeiAirbus and Italdesign unveil modular urban land and air transport system.
Hoverboarding Over the Atlantic
Elle Zhan WeiIn 2017, a hoverboard can fly 164 feet above earth and able to hover over the Atlantic Ocean.
Intimate Technology S01E07: Our Selves
NextNature.netWe think of selfhood as residing in our everyday stream of consciousness. But could we possibly have a second digital self in our online behaviors? Watch episode 3 of our Intimate Technology series.
Make the World Your Office
Megan Ray NicholsImagine being able to enter your office through a digital representation of reality. It sounds crazy, but it’s possible with augmented and virtual reality.
Smartflower Solar Device
Elle Zhan WeiPOP is an all-in-one solar energy system that hold visible benefits for humans.
Pre-Order the Pyramid of Technology Toolkit
NextNature.netThe Pyramid of Technology toolkit is a workshop-in-a-box that helps you better understand technology and catalyze innovative processes.
Jobs for Facilitators - Robots at Work #3
Mathilde NakkenThis is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.
Jobs for the Extraordinary-Robots at Work #5
Mathilde NakkenThis is post number five of our serie 'Robots at Work'. In this last episode we present you five jobs for the extraordinary, the ones who won't let themselves be categorized.
Rights for Robots: EU Calls for Regulation
Jack CaulfieldA new report recommends that we decide the legal status of robots sooner rather than later. It even suggests that they could be given personhood and rights.
Smell of Data Documentary on Nextnature.net
Ruben BaartThe Smell of Data documentary will make its online debut on nextnature.net.
Untouched Nature? Not in the Amazon
Alejandro AlvarezThe Amazonian rainforest was already transformed over two thousand years ago by people who built hundreds of large, mysterious earthworks.
The City as Technology in Tokyo
NextNature.netAre cities in their current form really the future of the human habitat? What is a next nature version of the city and how would it look like? In line with this perspective, NNN designer Hendrik-Jan Grievink led two workshops in Tokyo.
This bio-brick is made out of urine mixed with sand and bacteria
Helen SwinglerThe world’s first bio-brick grown from human urine has been unveiled by University of Cape Town (UCT) master’s student in civil engineering Suzanne Lambert, signalling an …
Call for projects: bring your groundbreaking creativity to tackle pressing energy issues
NextNature.netWe need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …
Counteracting Climate Change with Geoengineering
Jack CaulfieldA respected astrobiologist argues that a radical new process called geoengineering might be the only way to save us from climate change.
Towards a design brief for the artificial womb
NextNature.netHumanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …
Why in the future, we will all wear one piece of garment
Ruben BaartIt's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …
In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light
Kelly van GemertThere was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …
ReTuna: the Shopping Mall Selling Nothing but Recycled Products
Jack CaulfieldA Swedish shopping center is bucking the trend of mindless consumption. At the ReTuna Återbruksgalleria every product is made of recycled materials.
Smart Ring Turns Thumb Gestures into Words and Numbers
Belen MunozFrom the Georgia Institute of Technology arrives FingerSound, a smart ring that recognizes thumb gestures and converts them into words and numbers.
Next Nature is hiring an army of bots
Next Nature DevAs we showed with HUBOT , we can use new technologies and robotics to make our work more enjoyable, interesting and humane. Aside from our speculative jobs, a lot of robotic …
This artificial reef was just deployed in Sydney Harbor
Vanessa Bates RamirezEarth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …
This brain-controlled exoskeleton allows a paralyzed man to walk again
Freya HutchingsA breakthrough technology that responds to signals from the brain has transformed the life of a paralyzed 28-year-old man called Thibault. Four years after the initial incident …
How Pokémon are affected by climate change
Ruben BaartYou know climate change is real when dead coral Pokémon start to wash up on (virtual) beaches. Behold, Cursola, world’s first dead coral Pokémon. On the origins of Cursola While …
Iceland is mourning a dead glacier
Rupert ReadDeath certificates and commemorative plaques aren’t something you’d normally associate with a glacier. But that is exactly how Iceland recently mourned the loss of 700-year-old …
Oded Ezer discusses the future of typography and the importance of dreaming
Freya HutchingsOded Ezer is a typographer from Israel who never fails to push boundaries, or rather, discard them altogether. Ezer is a rebellious force that swings between commercial and …
Next Generation: Unleashing nature’s untapped potential with Amelie Unger
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
How Amazon trees write their own autobiographies
Chris HuntTropical forests are one of the world’s largest carbon stores and they help regulate the global climate. But they’re being erased at a terrifying rate. Deforestation claimed an …
Why half of the world's beaches could disappear by 2100
Simon BoxallUp to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …
7 ways to connect with your loved ones
Ruben BaartDuring these challenging times, we have tried to find happy moments together where we could find them. From weekly Zoom lunches to having online wine tastings, still, it doesn't …
14 Golden Rules of working with a robot
Next Nature DevThe 14 Golden Rules of HUBOT are rules of conduct which must be followed and which everyone needs to hold each other to account. Themes like respect, teamwork, creativity, and …
Blocking the sun with dust
Vanessa Bates RamirezIn the past few years, scientists have hatched some pretty crazy-sounding schemes in the name of protecting Earth and its inhabitants. From building an underwater wall 120 …
Cyborg mythologies #3: in god we trust, all others bring data
MaithriThis is #3 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
This exhibition explores the open ends of the apocalypse
Ruben BaartThe exhibition "Apocalypse - End Without End" shows that the end is a human invention
Join us at the DDW Talks: Next Biodiversity
Next Nature DevThe influence of humans on the earth can hardly be underestimated. Think of climate change, deforestation, and the decline of biodiversity. We are heading for a sixth mass …
Why we need to get better at predicting space weather
Koert van MensvoortThe Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.
Welcome to new Evoluon
Next Nature DevToday our human impact on Earth is humongous. Climate change, plastic oceans, mass urbanization and deforestation. Scientist recently calculated the technosphere now outweighs the …
Next Generation: Exploring blood, salt and iron as biomaterials with Hedwich Rooks
Kelly van GemertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch: magazine@nextnature.net. …
Next Generation: Launching the Eva Biodesign Lab with Carlos Silveira
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Mapping the world's DNA
Marit BeerseThe Earth BioGenome Project is aiming to create a database of genomes of all organic life on earth within 10 years.
This billionaire wants to live forever
Eleni MaragkouFrom the mythical fountain of youth to the many anti-aging procedures available today: humans have dreamed of internal youth for a long time already. At lot of us perceive aging, …
Scoring music hits with Grimes using her Elf. Tech
Selin KirThe music industry is witnessing drastic changes. With the emergence of artificial intelligence technology, no industry has been left untouched and there are broad discussions …
How to plant seeds with your shoes
Selin KirImagine helping nature restore itself simply by going for a run. In a fusion of fashion and conservation, London-based designer Kiki Grammatopoulos has introduced her concept …
Why NASA sends giant disco balls into space
Kelly van GemertIn the 1970s, NASA and the ASI launched a giant disco ball into space. Its purpose? Teaching the humans of today and the civilizations of tomorrow about Earth.
How to design a digital democracy
Rinie van Est10 design requirements to fully immerse ourselves into the 21st Century—in which technology makes our world richer, not poorer.
The Material Futures of Central Saint Martins
Zeynep KunduracilarMeet United Matters, a London collective exploring how we might live in the future by blurring the boundaries between craft, science and technology.
Meet the BAD Awards winners of 2023
Kelly van GemertThe annual Bio Art & Design (BAD) Award encourages new artists and designers to explore the world of bio art and design. Let's have a look at the three winning projects of this year.
Deadline to save the World: 30th August
Koert van MensvoortPicnic Green Challenge calls upon people like you to invent a product or service that can help to save the world. Restore the planet's harmony and lets you win 500.000 Euro on the …
Diesels Global Warming Ready Campaign
Koert van MensvoortThe Earth is heating up. The sun will blow up within 5 billion years. The human race will probably go extinct before entering the posthuman stage, or the probabillity that we are …
French Aids Campaign
Koert van MensvoortThis French Aids campaign is a wonderful example of biomimicmarketing (using images of old nature for propaganda or marketing purposes). They may be disturbing but the message …
Vin Memoriam
DesignmusketeersThe Vin Memoriam concept introduces a new ritual in the mourning process after losing a loved one. When a person has passed away, a small amount of blood can be processed into a …
Amsterdam Weekly on the Natural Revolution
The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …
Fight climate change: Hack the Planet
Dr NaturalLots of clouds this week. The peculiar picture above shows the eruption of mount Pinatubo in 1991, which apparently resulted in a certain amount of global cooling (next to some …
Killer Robots
Koert van MensvoortRule #1: A robot may not injure a human being or, through inaction, allow a human being to come to harm. Remember Isaac Asimov's classic three laws of robotics ? Surely thats …
BVPS Next Nature in LA - Pictures!
May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …
From Genes, to Memes, to Temes
Koert van MensvoortSusan Blackmore studies memes: ideas that replicate themselves from brain to brain like a virus. She makes a bold new argument: Humanity has spawned a new kind of meme, the teme, …
Green Glowing Monkeys
Arnoud van den HeuvelJapanese researchers of the Central Institute for Experimental Animals , took a green fluorescent protein gene of a jellyfish, wove it into the DNA of a few marmosets embryos, …
Nanotechnology Crashcourse
Koert van MensvoortThis mashup video project integrates various video clips that ask: What is nanotechnology? Via Posthumanblues , via Futureblogger . See also: Small Talks , Bacteria Bots , …
Pollution trading – savior or scam?
Koert van MensvoortWhile most people are still prudently changing light bulbs and recycling coffee cups to fight global warming – or at least their gnawing conscience – policy-makers have long moved …
Branded Pigs
Koert van MensvoortWhat are these people doing? Of course! They are tattooing a pig with the pattern of the luxury bag brand Louis Vuitton. For those who want something more special than the mundane …
3D Bioprinter promises tissue on demand
Koert van MensvoortBehold "the world's first production model 3D bio-printer." A machine capable of arranging human cells and artificial scaffolds into complex three-dimensional structures, which …
Goodbye, Nature vs Nurture
Talking about nature and nurture as separate, clear-cut forces is far adrift from the complexities of developmental science, says Evelyn Fox Keller in NewScientist . ONE of the …
Nano Supermarket – Jury Report
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
Next Nature Movie #3: Koyaanisqatsi
Koert van MensvoortKoyaanisqatsi (1982) is a film with no actors, no storyline, and no dialogue. The only things we see are landscapes, images of cities, and people going about their regular lives. …
Reading the Body: Finger Length Ratio Predicts Athletic Ability
Martijn van MensvoortThe human body is increasingly recognized as a biometric source of information for a wide spectrum of issues, including security, psychopathology, personality and health. Earlier …
The Virtual Lives of Extinct Animals
Allison GuyWhat happens when next nature dreams of old nature? Such is the case with extinct animals that have ever come in contact with humans, particularly the dinosaurs, our own …
When Dreams become a Commodity
Koert van MensvoortAs neuroscience progresses, we gain access to previously inaccessible and unexplored areas of the human mind. Consequentially the intricate processes in our brain are cultivated …
Evolutionary Janitors
Allison GuyWe normally think of polluted water as the source of disease, not the cure for it. The Gowanus Canal in Brooklyn, affectionately known as the Super Fun Superfund , is one of the …
Monkey See, Monkey Buy
Allison GuyYale researchers and advertising executives have created the first ad campaign aimed at animals. The targets in question are a group of captive capuchin monkeys with a taste for …
New steps to meld mind and machine
Gabi RasUntil now we've seen the types of brain-computer interface where the human has to put on some sort of bulky hat full of wires to control a machine. It won't be like that for long: …
Next Nature Services
Bas HaringIntentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …
The Soul is a Plastic Bag
Allison GuyIn the film Plastic Bag , the title character spends a lifetime (or more) on a quest for a creator not even aware of his existence. A stunning short by Ramin Bahrani, director of …
Think Breast is Best? Try Udder
Allison GuyScientists in China have created transgenic cows that produce 'human' milk. The researchers boosted the fat content of the milk and added three types of proteins, unique to …
A Clockwork Forest
Hendrik-Jan GrievinkHas nature become a fairytale or do we want it to be one? In their installation The Clockwork Forest , artist collective Greyworld seems to opt for the latter. The work of art …
Christian Schwägerl - Riding the Anthropocene
Koert van MensvoortChristian Schwägerl , freelance journalist and biologist, author of the book The Anthropocene: The Human Era and How It Shapes Our Planet , introduces us into the Anthropocene , a …
Complete Computer Simulation of a Bacterium Holds Hope for Medicine
Allison GuyResearchers at Stanford and the J. Craig Venter Institute recently created the first complete computer model of an organism. The simulation models the genome and life processes …
Nature Ludens: The Natural World at Play
Rachel ArmstrongAn ingenious Russian crow that used a lid as a snowboard to slide down a snowy roof persuaded millions of YouTube viewers that animals are not merely beasts of burden – they also …
Robots Invade Stores to Steal Our Jobs
Allison GuyThere's a new threat to the world's unemployed. Researchers at Carnegie Mellon University have developed a robot that helps to organize shop inventories, making that trip to the …
Structuring biomimicry, improving building's resiliency
Wilfredo Mendez VazquezThe same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …
A Robot to Make Rats Depressed
Marco van BeersThe robot in the picture above chases and attacks the living rat rights besides it. The W-3, as the robot is named, is designed to make rats seriously depressed. In fact, this …
Anthropo-scene #4: Longing for Nature
ChristianWhat one ugly overpass in Berlin reveals about our attitudes towards nature.
Chinese Whisper Challenge Pits Man Against Machine
Jort BandEver played "telephone" or "chinese whispers" as a kid? Now, you can pit your speech recognition skills against a computer.
Customizing the Brain with Psychoactives
Jan Willem van der LindenIt’s long been a desire of the human species to have complete control over our own thoughts. We’ve all had these moments where we curse our brain. Asking questions like: “Why …
How to Turn Skin Cells into a Baby
Jonathon MarkowskiA stem cell experiment with mice may one day mean that same-sex couples could have bio children.
Implanted into Bacteria, Synthetic DNA Functions as a Diagnostic Computer
Jiwon KimIn the movie Fantastic Voyage, a submarine and its crew were shrunk and injected into the body of a sick man in an attempt to save his life. Despite the fictional nature of this …
Why Meat Grown in Labs is the Next Logical Step for Food Production
Avy RoyLab grown meat is part of the trajectory that agricultural technology is already following.
What Will We Look Like in 100,000 Years?
Alessia AndreottiIn 100,000 years human beings might look like a manga character: big intense eyes, high forehead, large head, straight nose, more pigmented skin, and perfect symmetry. “There will …
Domestication as a Last Refuge
NextNature.netIn glass capsules endangered rainforest flora will be able to survive regardless of what happens to their natural habitat.
Transportations Of The Future
Francesca BarchiesiA selection of nine enthralling and striking concepts of future way of transportation.
AI is as Intelligent as a Four-Year-Old Kid
Erik van der VeenComputer can already beat us in many tasks. Complicated calculation, processing speed and chess, to name a few. However, generally speaking, you’re still likely to be more …
Computer Generated Deep Dream
Erik van der VeenTurning a normal stroll through the supermarket into a psychedelic dream (or nightmare) of algorithmic pareidolia.
This Headset Will Widen Your View of Reality
Margherita OlivoThis augmented reality helmet allows the wearers to see all around them without having to turn their head.
IBM Predicts Artificial Intelligence Future
Koert van MensvoortWhile the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".
Plastivore – A Bird that Feeds on Plastic
Koert van MensvoortThe speculative 'Plastivore' bird thrives on a diet of fungi and plastics.
The "Dog" That Will Save Lives
Margherita OlivoA laboratory is developing a synthetic dog that will be used for surgery trials, saving many canine lives and changing the veterinary world.
Insects are helping us develop the future of hearing aids
Rob MalkinThe human ear is a miracle of mechanical evolution. It allows us to hear an astonishing range of sounds and to communicate and navigate in the world. It’s also easy to damage and …
Designer Dave Hakkens is putting plastic waste to better use
Ruben BaartWe recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.
Slenderman: the Modern Big Foot
Alejandro AlvarezThe new mythical creature hunting our imagination is called Slenderman and is born on the internet. But who is this being and how it came to be? It may just be the modern version of a much older myth.
Vacation in the Era of Marine Pollution
Megan Ray NicholsWhile we can’t just leave the coast permanently without upsetting the delicate balance of this new environment we created, we can take better care of it to ensure that it is around for years to come.
2014 - Womb Transplant Baby Born
Elle Zhan WeiA Swedish woman who had her uterus removed due to cancer in her twenties gave birth to her own child as the world's first person to undergo a uterus transplant. And the donor? Her own mother.
Design Your Own Vegetables
Ruben BaartWith her project Future Food Formula, food designer Chloé Rutzerveld is looking for innovative methods to design vegetables.
GM Ants Show How Insect Societies Work
Julie ReindlScientists gene modify ants in order to find out more about their social behavior.
NNN Presents HUBOT - The Job Agency for People and Robots
NextNature.netA horse can run faster than a human, yet nobody claims horses will make mankind dispensable. When a man rides a horse and the two work together, something new happens. Then, what …
Jobs for Entrepreneurs - Robots at Work #4
Mathilde NakkenThis is post number four of our serie 'Robots at Work'. In this episode we present you five jobs for entrepreneurs, the ones who love doing big business.
Slaughterbots Video Depicts Killer Bots Nightmare
Koert van MensvoortThis seven-minute video, titled 'Slaughterbots', shows a future in which palm-sized autonomous drones commit untraceable massacres.
Bacteria Are the New Hard Drives
Daniel FragaDNA is the densest known storage medium in the universe - and Harvard University researchers have managed to use it to store GIFs inside bacteria.
A Truly Exotic Fruit: the Space Mango
Julie ReindlScientists sent mango embryos to space lab in order to let them develop new genetic traits.
Virtual Networking, the Future Social Media
Megan Ray NicholsVirtual reality is already becoming a part of the conversation surrounding social media. Will it become the next popular social network?
Artificial Womb Workshop at Border Sessions
Elle Zhan WeiAt Border Sessions Festival in the Hague a workshop was hosted by Next Nature Network on the artificial womb.
Anthropomorphism Puts a Friendly Face on Autonomous Vehicles
Jack CaulfieldDo you ever look at the bonnet of a car and see a face? Now, designers are looking at how to give self-driving cars the friendliest "faces" they can through anthropomorphism.
How will the artificial womb affect society?
Natalja HeybroekWhere contraceptives such as the pill disconnect sex from reproduction, in vitro fertilisation disconnects contraception from sex, and the artificial womb would disconnect the …
How this self-sustainable microhome may change the future of housing
Belen MunozLooking for a self-sustainable mobile microhome? Ecocapsule got you covered. This cute-as-pie capsule pod allows you to live completely off the grid in a low-energy, mobile …
Next Nature Academy presents: A workshop-in-a-box for your team
NextNature.netAre you working on projects where technology and human interaction are involved, and are you looking for a new approach? As of today, we offer a brand new workshop concept for you …
Managing the data deluge: Twitter as a tool for ecological research
Marianne MessinaAs early as 2009-10 , researchers were looking at Twitter data mining as a way to predict the incidence of flu. At the time, the H1N1 virus, or “swine flu,” had made the jump from …
Turning cities into parks: In conversation with Raymond Brouwers on Urban Street Forests
Jack CaulfieldUrban neighborhoods with high-rise concrete buildings are often dreary and gray. Therefore, the Urban Street Forest project aims to color our cities with the planting of vertical …
Beyond biomimicry: a new urgency
William MyersDesigners face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …
5 things to do at DDW19
Freya HutchingsLining up plans for Dutch Design Week ? Once more, 2600 designers gather in over 120 locations during 450 events. So whether you're a local, new in town, or just passing through, …
Pirjo Kääriäinen on new ecological biomateriality
Freya HutchingsMeet Pirjo Kääriäinen, professor of design driven fibre innovation at Aalto University, Finland. Kääriäinen founded CHEMARTS —a collaborative program at the university that brings …
How modern technology is inspired by the natural world
John NychkaWhat do a kingfisher, cocklebur pods and a Namibian beetle have in common? Besides being living organisms, they have all served as inspiration for creative human technologies to …
NATURE is an exhibition where biology and design meet
Ruben BaartCube Design Museum in Kerkrade and Cooper Hewitt in New York present the comprehensive exhibition NATURE - in which internationally renowned designers, artists and inventors …
3 future farms that can feed the planet and heal it too
Karen Rial-LoveraIntensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …
Fake for real: Octopus lips
Freya HutchingsA recent lip filler trend blew up on social media. 'Devil lips' , or Octopus lips, have attracted divided opinion online. When the body modification hit Instagram, some spectators …
Her is an outlook on the possible future of dating a chatbot
Ruben BaartWith most of us stuck at home because of lockdown, for the singles around us intimacy may have turned into a distant dream. Could we find our salvation in technology? And what …
How my chatbot fell in love with me
Tim DaalderopThe virus is forcing all of us to sit at home. While we are allowed to have social contact—albeit at an appropriate distance, intimate contact is hard to find. How to cope with …
In vitro meat (finally) hits the market
Nellie FriedrichHumanity has an insatiable hunger for meat. Since 2013 we have been researching, developing and campaigning for a humane and eco-friendly way to get our protein fix. Since day one …
Next Generation: Creating utopian and dystopian futures with Bas Jansen
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Next Generation: Shimmering nature with Elissa Brunato
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Next Generation: Searching for Null Island with Deborah Mora
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Virtual makeup: maybe they're born with it, maybe it’s XR
Ruben BaartAs our reality exists increasingly within digital realms, our virtual world demands a virtual identity. Our work is hybrid, our social identity is online and our connection is …
Welcome to the Novacene
Ruben BaartJames Lovelock (1919) has lived on Earth for over a century. You may find that long, but it is short for himself. He thinks big and from a long-term awareness. At the age of …
CO2 injected volcanic rock could save the atmosphere
Kelly van GemertThe rapid technological advancement of the human race has led to many consequences, especially regarding the integrity of the atmosphere that protects all life on Earth. Although …
Cyborg mythologies #1: plastic surgery & techno-futuristic foretellings
MaithriThis is #1 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
Dune explores the geopolitics behind resource extraction
Oli MouldDune offers a useful allegorical narrative of the “scramble for Africa”, which saw European empires carve up the continent into colonized powers.
Next Generation: Pursuing digital tactility with Studio PMS
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next nature disasters: the Facebook outage of 2021
Veronica FanzioWhere were you on the 4th October 2021? During the day that will be remembered for the Facebook outage, not everyone was equally impacted.
Join the Next Nature Talkshow on biodesign!
Next Nature DevA living lamp that you need to feed, a tapestry made of animal waste streams and tableware made from algae. Welcome to the wonderful world of biodesign.
Turn your garden into living artworks for bees
Kelly van GemertArt not for people, but for insects. That is the goal of the Pollinator Pathway project by Alexandra Daisy Ginsberg. With her concept she wants to change the way we perceive our …
How technology will help us adapt to climate change
Ruben BaartClimate change will transform how we live, but these tech and policy experts see reason for optimism
FIBER Festival 2022: an exploration towards an alternative future
Marit BeerseFIBER Festival explores the future of a changing world through audiovisual art, daring conversations, and experimental electronic music.
Next Generation: Tasting Landless Food with Malu Luecking
Kelly van GemertRegeneration of extinct flavor families via microalgae
The Limits and Beyond: A report about the future
Marit BeerseIn 1972, the Club of Rome published The Limits to Growth, a report about the future of the world. They described the limits of the world’s resources and what it is capable of …
Next Generation: Changing the oceans chemistry with Santa Ramaherison
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
How to control electronic devices with your mind
Ghizlane OughzifControlling devices with your mind. Unreal? Think again. Brain-computer interfaces have been changing the game in healthcare, gaming, and accessibility lately.
What food design can do
Kelly van GemertFood design gives us a taste of innovation. It visualizes, speculates, challenges and problem-solves.
Building the farm of tomorrow
Kelly van GemertSeven examples of how design will help us built the farm of tomorrow.
Biosphere 2
Koert van MensvoortBiosphere 2 is a manmade closed ecological system in Oracle, Arizona. Constructed between 1987 and 1989, it was used to test if and how people could live and work in a closed …
N is for Nature
NextNature.netThere are people who think what makes a good wine comes from nature - factors like rain and soil and temperature. Then there are those who think it's a matter of second nature - …
Nature So-called
Michiel SchwarzNature is not what it used to be. Or at least that is what we may think, when we look at the way humans and their technologies have treated nature. When we speak of "nature", …
The infoBreath
KarlA flower arcing from a frosted pane of glass. Rigged with a breath sensor and connected to an internet packet sniffer, the flower is cued in to the wireless network flowing in the …
10 Biomimic Gadgets
Arnoud van den HeuvelComing across an image like this, makes one wonder at first: is it a giant punch-bag? Some sort of soft water-drop-sculpture? No, it is the Emergency Outdoor Survival Cocoon , …
CrackBerry addicts are suing their Employers
Dr NaturalNo self-respecting manager would be without a BlackBerry. But now these handheld gadgets, which provide workaholics with constant email updates, are being blamed for chronic …
Crop Circles
Arnoud van den HeuvelIn the UK farmers recall simple circles appearing on their land for generations. The British media first reported on the circles in the early 1980s. By 1990 crop circles had …
Digizerk
Arnoud van den HeuvelHenk Rozema displaying his invention (2006), the digital tombstone "Digizerk". It was only a question of time that global digitalization would be introduced on cemeteries. The …
Simulacra and Simulations
The simulacrum is never that which conceals the truth--it is the truth which conceals that there is none. The simulacrum is true. -Ecclesiastes If we were able to take as the …
The Professors Doppelgänger Robot
Dr NaturalAlthough there are numerous researchers out there creating humanoid robots, none are as explicit about the close relation between anthropomorphism and narcissism as professor …
Feelings Translated to Plants
Koert van MensvoortAmbient Biomedia is an investigative project about using living beings, in particular plants, to display human lifestyle problems information. The working principle of our systems …
Country looking for a new land
Rolf CoppensThe Maldives, a chain of islands off the coast of India is taking the possibility of disappearance into account. This little piece of paradise is so low above sea level that it …
Fake for Real
Koert van MensvoortFakeness has long been associated with inferiority. Fake Rolexes that break in two weeks, plastic Christmas trees, leaky silicone breasts that cause cancer, imitation caviar. Even …
Fake-Space Race
Koert van MensvoortSome weeks ago we pondered over the oddity of a space race in cyberspace . Rockets and jet-packs –so cool in the previous century– don't make sense in a virtual environment. The …
Join the Neolithic Revolution
Koert van MensvoortWhy hunt? Why gather? Join the Neolithic revolution! Somewhere around 9500 BC proto-farmers began to select and cultivate food plants with desired characteristics. While in their …
Modernistic Tree
Koert van MensvoortMondrian would have appreciated square trees. Furthermore, they would enable wood industry to lose less material, to cut easier with machines and to store more efficiently. Hence …
RepRap - a self-reproducing machine
GuustThe RepRap is a selfreproducing 3D printer. The 3D printer 'prints' his own components by melting tiny plastic particles together. Imagine what would happen if this 3D printer …
Robotic R)evolution
Arnoud van den HeuvelIn 1921 the word "Robot" (meaning "labor") was introduced by Czech writer Karel ?apek . In his play "R.U.R." (Rossum's Universal Robots), robots seem happy to work for humans. …
Slavoj Zizek - Ecology without Nature
Koert van MensvoortThis lecture by Marxist philosopher Slavoj Zizek – never mind the crappy sound & image quality: this is philosophy folks! – should provide all next nature explorers with a …
Software that Ranks Female Beauty
Koert van MensvoortEarlier we reported software that predicts how a wine will rate in reviews even before it is made . Now, for puber-geek delight, lets try that for women. Tel Aviv University …
Artificial 'Trees' to Stop Climate Change
Koert van MensvoortThe fabrication of forests with artificial trees is one of the best strategies to stop climate change, according to scientists of the Institution of Mechanical Engineers . The …
Bioinstinct
Koert van MensvoortDesigner Laura Boffi envisions a future in which human instincts will leap behind on technological progress. For example, once the 'disease called mortality' is cured with …
Brain Needs 'Nature'
Arnoud van den HeuvelScientists have begun to examine how the city affects the brain, and the results are chastening. Just being in an urban environment, they have found, impairs our basic mental …
Craig Venter – Catalyst of evolution
Koert van MensvoortIf the six hour crash course on synthetic genomics is a bit too much for you, there is always a more snappy TED lecture in which Craig Venter ponders on whether we can create new …
iReligion
Koert van MensvoortGraphic designer Roel Boonen takes the Apple cult to the extreme with this iReligion triptych. His piece is illustrative on how central corporations and digital technology have …
KOBIAN Shows Emotion
Arnoud van den HeuvelMeet KOBIAN, the humanoid robot that is not only able to walk about and interact with humans, but uses its entire body in addition to its facial expressions to display a full …
Millions of gadgets unused in Britain
Koert van MensvoortGadgets! You love them when you buy them, but what happens next? Over half of Brits have abandoned gadgets because they don't know how to use them properly. Seventy-one per cent …
Next Nest
Koert van MensvoortWhen a bird builds a nest, we call it nature, but when a human puts up an apartment building, suddenly it’s culture? As if the dividing line between nature and culture wasn't …
Stop continental drift
Koert van MensvoortIs it a cynical gesture to glue a 'Stop Continental Drift' bumper sticker on your gasoline addicted car? Absolutely. Yet indirectly it also criticizes the romantic …
The Hermaphrodite Effect
Florian Conradi and Michelle ChristensenAccording to research carried out by scientists from the Columbia Environmental Research Centre , sewage water containing hormones and pesticides caused by human consumption is …
Who designed the banana?
Koert van MensvoortLooking at a banana from a design perspective, one immediately notices the fruit is highly ergonomic and sophisticated: Bananas fit perfectly in the human hand, they come with a …
Wrapping Greenland
kbohreThe Discovery series 'Ways to save the planet' the episode 'Wrapping Greenland ' shows how Dr. Jason Box uses reflective blankets to cover glaciers in Greenland. Due to global …
Digital Gastronomy
Koert van MensvoortThe food printer seems to be one of those lustrous concepts that continues to pop-up in the fantasy of techno-connoisseurs. Some years ago James King already proposed a printed …
Digitally Enhance your Ego
Tomas PietersAvatars, almost every internet user has at least one of them running around somewhere on the web. We control then in numerous games and forums, but do they also control us? …
FluDOC – Glowing Bacteria Show if You Have Influenza
Koert van MensvoortBacteria are traditionally perceived as infectious and unhealthy, but that is about to change. This week designer Jan van der Asdonk graduated from the Next Nature Lab at the TU/e …
![Visual of Manko & Zero [#4]](https://nextnature.net/media/pages/magazine/story/2010/manko-zero-4/c2cefab16a-1602632753/manco-51-868x486.jpg)
Manko & Zero [#4]
Aston RevolaThe way down was slow and somehow greasy. Total darkness surrounded them. Gill turned on the car radio and the LED's lit up their faces in a green pulsating glow. 'Jovi Rocks!', …
Nanoparticles in Sunscreen Damage Microbes
Koert van MensvoortNanotechnology has been hailed for its benefits because of the potential ability to create drugs that could cure cancer and radiation poisoning, make miniature pollutant filters …
Next Nature Movie #5: American Beauty
Koert van MensvoortDuring the selection of the top ten of next nature movies we’ve doubted quite a bit between the Truman Show (1998) and American Beauty (1999). The Truman Show tells the story of a …
Nomadic Plants
Koert van MensvoortNomadic Plants are a species assembled from a group of robotic-electronic-biological organisms living in symbiosis in order to survive in habitats affected by human activity. The …
Old People as Old Nature
Orestis TsinalisTwo grannies assessing the milk productivity of two goats by means of a chart: this is the story of the commercial behind this screenshot. The first granny is a data analysis …
To Milk the Cows, Click here
Koert van MensvoortIn millions of offices and homes around the world, people are hard at work planting crops, feeding cattle and tilling their land. Welcome to Farmville , the digital rural world …
Urban Dolls
Hendrik-Jan GrievinkThe idea of altering your body for aesthetic purposes is still somewhat frowned upon today. But more than because the very idea of improving yourself, this is about its …
Blue, Belgian and Beefy
Allison GuyThe Belgian Blue is a unique cattle breed that was developed quite accidentally in the late 1800s. An chance mutation lead the cattle to develop 'double muscling,' which occurs …
Drugs are Nuts
Stefan FinckenThinking about Next Nature can sometimes result in a feeling of vertigo. Normal standards are eroded and slowly replaced by next natural ones. A bewildering example can be found …
Get Vegetarian Teeth and Eat Less Meat
Koert van MensvoortWant to live a greener life? Eat less meat. Recently the UN appealed for a radical shift in diet , to improve individual health and ease conditions affecting the global …
![Visual of Manko & Death [#11]](https://nextnature.net/media/pages/magazine/story/2011/manko-death-11/e6665c445d-1602632753/manko11-868x486.jpg)
Manko & Death [#11]
Aston RevolaManko had been here before. Being just thoughts, surrounded by nothing. He felt glad his thoughts were there, one after the other, so there had to be a form of time and therefore …
Mapping the Utilisphere
Allison GuyEarth has had a geosphere, atmosphere and biosphere for a few billion years. Only within the last several thousand years has earth gained a global noosphere, the intangible …
Mushrooms in the Mokum
Allison GuyMediamatic is hosting a pop-up urban mushroom farm in the middle of Amsterdam. Rows and rows of shiitake, oyster, and the elusive almond-flavored Agaricus subrufescens are …
(Nano)technology imitating Nature
Koen BeumerOver the coming years, nanotechnology will invade our everyday lives. Nanotechnology, usually defined as the control and manipulation of matter at the nanoscale, will be …
Occasionally Extinct and Virtually Alive
Allison GuyJapanese researchers are currently working on cloning a mammoth, and plan to produce a fluffy new prehistoric calf within four or five years . The bucardo, an extinct subspecies …
Plastic Planet
Koert van MensvoortWe tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …
Protei, the Sail Bot that Cleans Up Oil
Allison GuyProtei is a sailing robot that's designed to clean up oil spills without human assistance. After sailing upwind, the bot drifts downwind, zigg-zagging across the surface to absorb …
Rainbow Tulips
Koert van MensvoortHuman design brings us ‘natural’ experiences that could not exist without the human hand, but can be appreciated nevertheless. Perhaps we are intuitively faked to believe …
Rule #1: Any Association that Can be Made, Will be Made
NextNature.netFor other entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. People have evolutionarily built-in mechanisms that help us to …
Sympathy for the Device
Robin PohlTweenbots are small robots that depend on the kindness of strangers. They are only able to move straight forward and do this constantly. Once they get stuck in a hole or at a …
The Story of our Food
Maartje SomersEvery time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …
#9: Be Aware of the Ecosystem You're Invading
NextNature.netPart 9 in the 11 part series Anthropomorphism and Design . With most products, one wouldn’t normally worry about the environment that it enters. However, anthropomorphic products …
Animals of the Future
Nick van der WeijdenNearly every adult in the Western world owns a personalized pet, sometimes more than one . It is treated with great care, fed when necessary and fitted to the owner’s wishes and …
Hidden Cities Emerge from the Amazon
Allison GuyFamed for its jaguars, orchids, and horrifying parasites, the Amazon is just as famous for what it lacks: human presence. For many years, the prevailing wisdom has been that …
Little Green Cows
Rachel ArmstrongThe world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …
Magnifiying the Universe
Koert van MensvoortNowadays the human impact on our planet can hardly be underestimated. Climate change, plastic islands, genetic manipulation – ‘We were here’ echoes all over. Yet, every now and …
Mice Reporting For Duty
Jeroen PillaerdsResearchers have developed genetic manipulated mice, with extra smell receptors that make them highly sensitive to the smell of explosives. Scientists hope to use these mice in the future to discover land mines
Replacing Synapses with a Single Switch
Allison GuyNeural synapses in the human brain are extraordinarily complex structures. Responsible for relaying information between neurons, chemical synapses govern the release of over 100 …
Rotund Rats, Fat Cats and Chubby Chimps
Allison GuyIt's nothing new that humanity is getting chubbier by the day. What's surprising is that we're bringing our animals along for the ride. A meta-analysis of animal weight has …
Rule #4: Complex Products Tend to Be Anthropomorphized
NextNature.netFor past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. Think about a spoon. Now think about a spoon with a face. What do you …
Tiny Amounts of Alcohol Might Extend Life
Stefan FinckenA new study on the effects of cholesterol on the life span of Caenorhabditis elegans, a tiny worm often used in experimentation, resulted in some surprising finds. The life span …
Demo Day at Next Nature Lab
Alessia AndreottiUnpolished creativity at the Next Nature lab from the Industrial Design Department at the Eindhoven University of Technology.
Tattoos that Make Everyone a Product
Alice FumeyQR and barcode tattoos turn an artist's body into a business card.
Ghost Imaging: Taking Pictures of the Invisible Thanks to a New 3D Technique
Alessia AndreottiBritish research group created anew scanning technique permits to obtain 3D images and detect wavelengths that our visual system is not able to see.
Have We Passed "Peak Automobile"?
Jonathon MarkowskiYou’ve heard about peak oil, but what about peak automobile?
Hire a Hyperreal Girlfriend to Look Better on Facebook
Insoo HwangBaudrillard intersects with social media in the world of fake online girlfriends.
Let's Build a Garden on Mars
Koert van MensvoortOne would need a gardening robot, fitted plant species and some kind of dome structure for the plants to grow in.
Manmade Global Warming Is at Least 15,000 Years Old
Allison GuyHow the extinction of mammoths changed the atmosphere.
Moments in Meat History Part II- The Last Mammoths
Jonathon MarkowskiThe Mammoth was the last of the giant land mammals of the Pleistocene era.
Moments in Meat History Part VI - Meat the Future
Jonathon MarkowskiBy the turn of the century, some people began raising questions about our meat consumption habits.
Nature through the Windshield
Brendan CormierVolume magazine interviews Next Nature founder Koert van Mensvoort.
Out of Network
Santiago ZabalaArtist Filippo Minelli aims to point out the gap between the reality we still live in and the ephemeral world of technologies.
Space Farming for Astronauts
Alessia AndreottiSpace Farming: NASA plans to grow a vegetable garden 230 miles above the Earth.
The Insect with Natural Mechanical Gears
Alessia AndreottiThe first – and only – mechanical gears found in nature.
The Prefuture of Synthetic Biology
Alexandra Daisy GinsbergAlexandra Daisy Ginsberg discusses the promises and realities of synthetic biology.
New Technologies to Make Us Sleep Less, and Better
Daniel BlokbergenHaving 50% more “conscious lifetime” might sound like an appealing proposition to anyone with a hectic schedule. This could be achieved not necessarily by living longer, but by …
Where the Other Half Lives
Allison GuyMap-enthusiast Valerie Pieris has created a fascinating visualization of human population centers. We all know that a huge fraction of humanity lives in Asia, but this map really …
Anthropocene: the Shrinking of Aral Sea
Alessia AndreottiAs a consequence of a big water diversion project to irrigate surrounding areas the Aral Sea is drying up.
Fish Fins vs Bones
Lotte BiesheuvelZebrafish can regrow fins. Is there a possibility we can regrow bones in the near future?
Floating Underwater Self-Sufficient City
Francesca BarchiesiAsian architects of AT Design Office want to build an incredible floating underwater metropolis that is also self-sufficient.
NANO Supermarket Best Product 2014
Alessia AndreottiA jury of design and science experts awarded the best NANO Supermarket product a € 2.500 prize.
New Plant Paradigms
Alessia AndreottiIn this approaching era, what might be biologically possible for plants?
No Future for Traditional Meat
Alessia AndreottiAt Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook
OpenWorm: The First Digital Organism
Alessia AndreottiThe first digital life form is an interactive worm based on its real biology.
Our Tribal Gut Bacteria Are Disappearing (And Why We're Getting Fat)
Allison GuyHealthy gut bacteria may hold the key to weight loss – but only isolated communities may preserve "natural" intestinal biomes.
Shock Therapy for a Better Self
Julia WeberThe Pavlok wristband gives its wearers an electric shock if they fail at hitting work deadlines or completing fitness goals.
Bowerbirds' Plastic Love Nest
Lotte BiesheuvelTo attract a female, male bower birds build structures and adorn these with colorful plastic decoration.
Artificial Brain Able to Perceive, Learn and Forget
Alexandra BremersScientists in Russia have taken a next step in the development of artificial intelligence by creating a "brain" that is able to educate itself.
Cities Evolve in Similar Ways as Galaxies
Koert van MensvoortScientists think the laws governing the structure of galaxies in outer space are the same laws underlying the growth of cities.
DOUG: the First Robot Able to Draw
Margherita OlivoRobots can already read, talk and reason. Yet, they do not seem to have found limits to their artistic skills either. Meet DOUG_1, first the drawing robot.
Experimental Office: No Chairs, No Desks
Koert van MensvoortTo counter the sitting dogma, design firm RAAAF and artist Barbara Visser created a dynamic office concept, entirely based on movement and leaning.
From the Super Muscular Pig to the Hypoallergenic Cow: New GMOs May Soon Be on Your Plate
Alessia AndreottiThe acronym that keeps Europe awake at night is TTIP (Transatlantic Trade and Investment Partnership), a trade and investment deal that the EU is negotiating with the US. From …
Hair Matter(s)
Alessia AndreottiFrench student at the Design Academy Eindhoven collected hair from African American hairdressers to create jackets and hats.
Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory
Alessia AndreottiWe recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.
Tracking Employees' Body Functions to Improve Business Performance
Alessia AndreottiIn the quest for competitive advantage, companies adopt wearable biometric technologies to monitor employees and improve business results.
Art Installation Submerges Amsterdam
Hessel HoogerhuisWaterlicht shows how the Netherlands would look without waterworks — a virtual flood.
Smog: an Augmented Reality?
Hendrik-Jan GrievinkA few days ago, these images of iconic buildings in Beijing as they look with and without intense smog have been posted on Weibo, one of China’s most popular social media …
Let’s Sweat the Heat Out: Sweating Wall Concept
Wei Lun WangHydroceramic: a composite material able to lower the temperature of an interior space by five degrees Celsius.
Gameplay of the Crowds
Len KromkampAustralian programmer started a social experiment called “Twitch Plays Pokémon”. Over a Million People Play Pokémon in Social Experiment
3D-Printed Shell to Save Tortoise's Life
Margherita OlivoA severely injured tortoise was saved by a team of doctors thanks to a 3D printed shell.
Agriculture Isn’t as Green as You Think
Megan Ray NicholsAgriculture today isn’t where it needs to be. Here’s how farmers are taking the next step for better agriculture tomorrow
Anonymity Becomes the New Privacy
Ioana TomiciArtists respond to biometric technology and data collecting software through subversive projects.
Who Are These Trolls Invading China?
Margherita OlivoChina's government fabricates about 488 Million social media posts every year as a strategy to distract from critics to the regime.
Brexit: the Cultural Climate Warms Up
Daniel FragaOn the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.
Cellphones Go Feral
Alejandro AlvarezAfter reports of Samsung phones causing serious damage, plane delays and even hospitalization, the company made a first recall. However, the new phones were still bursting into flames.
Cockroach Milk: the Next Superfood?
Monika KozubA recent research reveals that the next extra nutritious ingredient may be the liquid produced by cockrach mothers to feed their offsprings. Are you willing to try it?
Difficulty in Voting for Trump or Hillary?Elect an Artificial Intelligence for President
Koert van MensvoortWould you vote for an artificial intelligence to govern our society?
Edible Crops Grown in Martian Soil
Margherita OlivoScientists at Wageningen University, The Netherlands, grew edible crops in Martian soil.
King Bee Inspecting His Drones?
Koert van MensvoortFacebook boss Mark Zuckerberg at the Mobile World Congress, in Barcelona.
We Love Cities, so Do Wild Animals
Alessia AndreottiHow wild animals and cities are adapting to each other.
Meet the Firefighter Drone
NextNature.netMeet the firefighter drone, she is the best at extinguishing fires and keep every species safe!
A Search Engine for Satellite Imagery
Margherita OlivoTerrapattern is a search engine that gathers similar elements of satellite imagery, giving surprising results.
The Movie Written by Artificial Intelligence
Margherita OlivoSunspring is a Sci-Fi short movie entrirely written by an artificial intelligence.
Bodily Currencies: Blood, Sweat and Tears
Lewis JustWelcome to the access and experience economy. Currency: sweat, blood and action.
A Taste of RoboBee Honey
Mathilde NakkenWhere most researchers are focusing on keeping bees alive, researchers of Harvard are developing a bee replacement; the Robobee. The Robobee is only the size of half a paperclip, with ultra thin wings flapping 120 times per second. The main goal is to build a mechanic pollinator.
Watch the First Movie Trailer Made by AI
Ruben BaartIBM's Watson succeeded in creating its first-ever movie trailer for the upcoming sci-fi thriller Morgan.
1923 - Term 'Ectogenesis' Coined
Elle Zhan WeiThe term "ecotogenesis" was first coined in 1923 in "Daedalus".
2015: Artificial Placenta Approaches
Elle Zhan WeiIn 2015, a group of scientists from the University of Michigan claimed to have made the world's first artificial placenta.
AI Tries to Decode Dolphins
Julie ReindlOver a four year project period, researchers will use artificial intelligence to understand the dolphin language, creating a dolphin dictionary.
Barbie Becomes a Hologram of Herself
Julie ReindlBarbie has been turned into a hologram version of herself and will now be your kids assistend.
DNA Hacking: Catch a Computer Virus
Jack CaulfieldWe know how it feels to catch a cold; how might it feel to catch malware?
Cognitive Cooking with Chef Watson
Elle Zhan WeiThe AI chef nows more than 10,000 recipes from all over the world and is capable of combining any ingredient while following your personal food preferences.
Circular Runway for Airport Efficiency
Elle Zhan WeiThe endless runway is a new airport concept by Dutch scientist Henk Hesselink.
Drones and Robots Co-Work in Solar Farms
Alessia AndreottiBladeRanger might have found the ultimate solution for solar panels cleaning putting drones and robots together at work.
Fellow Day 2017: Next Habitat
Ruben BaartLast week, our NNN fellows gathered to discuss the Next Habitat; how will we work in the future? And how does this affect our personal lives?
HUBOT: Take the Jobtest!
NextNature.netThe robots are coming! They’re getting smarter, cheaper and more reliable. How long will I have my job before a robot steals it? The industrial revolution made muscular power …
In Conversation with Yoyo Yogasmana, Winner of the First ECO Coin Award
Ruben BaartRead our conversation with the ECO Coin Award Winner of 2015: Yoyo Yogasmana.
Intimate Technology S01E03: A iReal
NextNature.netWhat if your devices had a life of their own? Guy Farber’s playful short movie "An iReal" explores this very possibility.
New in: Next Nature Memory Game
NextNature.netWe are pleased to announce the launch of the Next Nature Memory Game. Now available in our web shop, it playfully explores the shifting borders between biology and technology.
The Next Nature Guide to Games in 2017
Jack CaulfieldIn the next nature, many people spend as much time in the digital world of gaming as they do in the real world. We have covered video games before, but this year we thought it …
Solar Powered Electric Cars
Daniel FragaThe sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.
Building a City on Mars by 2117
Elle Zhan WeiThe United Arab Emirates released plans to build a city on Mars.
The World's First Floating City
Elle Zhan WeiIn effort of protecting and prospering their country, the Polynesian government has signed an agreement to realize the world’s first floating city.
The age of cyborgs has arrived
Vanessa Bates RamirezHow many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …
MIT's new voiceless interface can read the words in your head
Vanessa Bates RamirezThe way we interact with the technology in our lives is getting progressively more seamless. If typing terms or addresses into your phone wasn’t easy enough, now you can just tell …
Give AI curiosity and it plays video games all day
Tristan GreeneIf you teach a robot to fish, it’ll probably catch fish. However, if you teach it to be curious, it’ll just watch TV and play video games all day. Researchers from Open AI …
Should lab-grown meat be labelled as meat when it's available for sale?
Hope JohnsonAustralian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …
Next Nature baby care
Charlotte KuijpersBabies' needs aren't complex. And yet, they are. Over the years, parents have found some tricks to ease their babies as well as themselves. Taking a baby for a drive to make them …
The next sexual revolution is going to be all about technology
Peter DiamandisSex is one of the most powerful, fundamental human drives. It’s caused wars, and built and destroyed kingdoms. It occupies a significant percentage of most people’s thoughts. As …
Struck by lightning: Shipping emissions double frequency of lightning storms
Jack CaulfieldThey say lightning never strikes twice, but it appears to be striking a lot more often in some areas of ocean than others. New research published in Geophysical Research Letters …
Aleph Farms grew meat in space
Freya HutchingsHello meat lovers! In vitro meat innovator Aleph Farms has taken the saying 'one small step for man and one giant leap for mankind' to a whole new level. The startup has succeeded …
6 designers changing the future of fashion
Meike SchipperWe live in a world of fast or disposable fashion. This industry is increasingly impacting the environment due to the use of toxic chemicals, water and energy consumption, heavy …
Join us for the closing event of Reprodutopia!
Next Nature DevShould men be able to give birth to children? Should we externalize pregnancy with artificial wombs? And are these feminist dreams or frankenstein nightmares? Welcome to …
How cities are cutting out cars
Vanessa Bates RamirezIt’s common consensus in the tech industry that the days of cars as we know them—powered by gas, driven by humans, and individually owned by all who want and can afford one—are …
Towards collective standpoints on the future of babymaking
Freya HutchingsFor the closing event of Reprodutopia , a true meeting of minds took place as we discussed the social implications surrounding the future of reproductive technologies. Multiple …
The GOGBOT Conference 2019 is your guide to biotech futures
Ruben BaartLook around you and try to find the most natural thing in the room you are in now. It is you. But for how long? Welcome to the wonderful world of bio design ; a world full of …
Sophia the Robot has a sister: Little Sophia
Ruben BaartRobot Sophia is pretty much the international face of the ‘modern robot’. Sophia is the Audrey Hepburn-inspired humanoid robot who stands out for multiple reasons. She is the …
Emma is your colleague of the future
Freya HutchingsEmma is in poor health. She has painful varicose veins, stress-related eczema, puffy skin, a grey complexion, red eyes and a hunch-back. She is an imagined office worker of the …
This exhibition looks at how robots are changing the world we live in
Ruben BaartDelve into the science and fiction of robots at V&A Dundee’s latest exhibition: Hello, Robot . Contemplate the existence of robots and how they have both shaped, and been …
10 Next Nature dinner table conversation starters
Ruben BaartSummer is here and the sun is out, and yes, this is awesome. After a long day in the sizzling summer sun, you get a group of people together to share some delicious food, …
Watch this robot fish swim through the ocean
Vanessa Bates RamirezEarth’s oceans are having a rough go of it these days. On top of being the repository for millions of tons of plastic waste , global warming is affecting the oceans and upsetting …
Next Generation: Growing technology with Prosthetic X
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Perfect Sense explores what it means to love in turbulent times
Ruben BaartImagine you are single and you finally meet that someone you like. You are in the early stages of dating, but then a virus appears and compromises everything. For some of us this …
A countryside dweller's guide to the future
Ruben BaartThe current lockdown in much of Europe has city-dwellers flocking to the countryside to wait out the outbreak sweeping the continent. Seeking relief from coronavirus, urbanites …
Design your Self!
Next Nature DevWho are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …
COVID-19 is a virus, corona is a meme
Ruben BaartAs the viral pandemic continues to spread, so too does the world’s collective uncertainty. As a result, people are turning to media for some levity. And can you blame them. …
Cooling buildings with ultra-white paint
Andrew ParnellFrom icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …
Bio textiles: meet three designers reimagining materials using biotechnology
Alexandra KisielewskiThe world needs interdisciplinary creators who are designing not just for humans, but for the rest of the living planet. To foster this thinking, Biodesign Challenge (BDC) pairs …
A digital twin of the Earth could make the planet climate-neutral
MaithriWhile Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …
Track freshness and reduce food waste with Rui Xu
Ruben BaartImagine this: you wake up on a lazy Sunday morning, trudging your way to the fridge only to be welcomed with the smell of something rotting. Did the meat expire sooner than …
The Institute of Digital Fashion explores what's next in the industry
Ruben BaartTrading animal skins for pixels, our digital selves call for a digital wardrobe. The Institute of Digital Fashion , led by CommuneEast founder Leanne Elliott Young and Digi-Gxl …
La Belle Verte imagines a world of harmonious existence
Leanne VoshellUtopianism and dystopianism are themes often found in today’s movies, especially considering the increased awareness of the damage done to the Earth by human activities. Often …
Next Generation: Exploring non-binary futures with Lena Kuzmich
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Screen mutations and reframing perspectives with Louisa Zahareas
Ruben BaartIn the digital era of a globalized world, our screens have become a second set of eyes. Communication has advanced leaps and bounds, to a point where we cannot imagine a world …
Donna Haraway rejects the doomsday rhetoric of the Anthropocene
Ruben BaartFor multispecies feminist theorist Donna J. Haraway, “it matters what stories make worlds, what worlds make stories.” She studies the current age as the Chthulucene (chthon, …
That modernist dream of the house as butler is not going to happen
Helmke van GeelLooking at evolution, we see that there’s always a next nature. Nature changes along with us. How will that influence our way of life in the future?
To save forests, researchers are hooking trees up to Twitter (again)
Ruben BaartIn July 2018, a century-old red oak went live on Twitter. The account @awitnesstree , tweeting from the Harvard Forest in Petersham, Massachusetts, introduces itself in its bio: …
What Julia Watson is reading this summer
Ruben BaartIn an era of high-tech and climate extremes, we are drowning in information while starving for wisdom. Architect Julia Watson imagines a design movement building on indigenous …
What Rachel Armstrong is reading this summer
Ruben BaartArchitect Rachel Armstrong establishes an alternative approach to sustainability. Through a close reading of computational properties of the natural world, Armstrong develops a …
Why urban gardens are crucial for conserving bees and butterflies
Ruben BaartAs humans have industrialised farming to feed a growing global population, pollinators – animals vital for plant reproduction – have seen their food supply decline. In the UK, …
Five things not to miss at Floriade
Veronica FanzioHere are 5 things you cannot miss at Floriade Expo 2022
Chloé Rutzerveld designs the food of tomorrow
Eleni MaragkouYou are in for a surprise when you look at food and concept designer Chloé Rutzerveld 's portfolio. It is hard to believe that somebody so young - she is just 25 - has already …
Fermenting Futures and the beauty of biotechnology
Kelly van GemertExploring the co-evolution of yeast and humans, while discovering the aesthetic value of yeast biotechnology, is what designers Anna Dumitriu and Alex May have been concocting. …
This expo explores technological nature and indigenous insight
NextNature.netTechnology brings us closer to nature, and indigenous insight reconnects us to our roots.
We’re all radioactive – life isn't possible without it
Marit BeerseMost radiation is natural and life on Earth wouldn’t be possible without it.
Are plants our new co-composers?
Lucas ZarzosoMusicians have stumbled upon an unconventional and intriguing creative partner: plants. Yes, that's right, plants. Through the use of advanced sensors and software, …
Bacteria might have eaten the Titanic's wreckage by 2030
Selin KirIn 1912, the RMS Titanic met a fateful demise as it crashed into the depths of the North Atlantic Ocean, leaving a mark on the world's collective memory, and igniting a lasting …
ChatGPT is getting stupider and we don't know why - so I asked ChatGPT
Kelly van GemertAI language model ChatGPT has hit the mainstream last year when it became widely accessible to everyone. Next to doing our (home)work, it became also a D&D Dungeon Master , …
People are now having sex in self-driving taxis
Selin KirIn the evolving scenery of self-driving taxis in San Francisco, passengers are getting frisky in the backseat of driverless taxis.
Dubai will soon house the world's largest artificial coral reef
Kelly van GemertA floating sustainable city where humans can live, work and study while supporting aquatic ecosystems. Soon this will become a reality in Dubai, as sustainable real estate company …
Hurray! There are now vaccines for honeybees
Kelly van GemertA significant milestone has been reached as the US Department of Agriculture has granted approval to a vaccine for insects for the very first time. An important breakthrough, …
Meet Indonesia's virtual news anchors
Kelly van GemertVirtual news anchors seem to spread like wildfire across Asia. We've witnessed Xinhua present the news from China and applauded Lisa on becoming India’s first regional AI news …
Whoops! Our sustainability efforts are warming the oceans
Koert van MensvoortCleaning up ships' pollution is making the ocean warmer than expected. Less pollution means less cooling clouds, heating up the Atlantic.
We can now grow insulin from lettuce
Selin KirIn a ground-breaking discovery, researchers at the University of Pennsylvania have achieved to produce insulin out of lettuce. There's no need for needles and injections anymore, …
How WhatsApp voice memos help Senegal's farmers
Selin KirWithin the digital realms of our smartphones, WhatsApp groups cater to diverse intents: exchanging witty dad jokes, soliciting style counsel ahead of night-outs with friends, or …
Next Gen: Watching our collective heartbeats with Nino Basilashvili
Kelly van GemertHeartsync is an interactive art installation crafted by artist Nino Basilashvili that syncs up your heartbeat with others.
We now have satellite traffic jams in space
Kelly van GemertIt seems that traffic jams aren't just a problem confined to Earth's highways and byways. How did this happen? And should we be concerned?
Why looking at beaver dams might save the world
Méline MaquartEddie Corwin studies beaver dams and ponds from satellite images in order to restore watercourses and wetlands, and establish nature reserves.
The Petunia Carnage
Kelly van GemertTo pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.
Sonograms of planet earth
Eleni Maragkou, Kelly van GemertTechnology can help us to connect with our surroundings. Think about the microscope: it revealed ecosystems beyond our visual reach allowing us to look at the smallest inhabitants …
Better than the real thing
Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …
Biomimicmarketing
Koert van MensvoortThe sciences of biomimicry studies nature's models and then imitates or takes inspiration from these designs to solve human problems: Culture imitates nature. The Black&Decker …
Bird radio
Arnoud van den HeuvelInstruction for the Birds: Land on perch->trigger sound file->observe human response-->behave accordingly. Instructions for People: Listen, you'll be able to understand. The sound …
Child Care Robot
Koert van MensvoortNEC corporation is developping a "Childcare Robot PaPeRo" capable to play with and watch over children. The Childcare Robot is capable of recognizing and verbally communicating …
Crowd counter
Arnoud van den HeuvelCrowd counter is a piece of software able to track moving features within a video clip. It works on the assumption that points that move together are most likely part of the same …
Cutters
Arnoud van den HeuvelHope you have a strong stomach for this one: There are many ways known for decorating the body (both human and f.e. swine ). But it's fascinating to see that so many "cutters" …
Entry 2006 exhibition opened
Koert van MensvoortToday the Entry 2006 exhibition opened in the coalwashe building, Zollverein. For 100 days 'perspectives and visions in design' with over 300 exhibits from more than 20 countries …
Erkundungen im Nächste Natur (D)
Die Natur verändert sich mit uns (English version: Exploring Next Nature ) by Koert van Mensvoort , published in Entry Paradise, Neue Welten des Designs, Gerhard Seltman, Werner …
Featherless Chicken
Koert van MensvoortBehold the featherless chicken, created by Scientists at the genetics faculty at the Rehovot Agronomy Institute near Tel Aviv, Israel. The idea behind the development of this …
Ideology becomes nature
Hendrik-Jan GrievinkIs this fake nature? Surely, it's nature altered by human hands. Somewhere in the East German forest these trees started to change color in autumn a little earlier than all the …
Klima Kontrolle
Koert van MensvoortKlima Kontrolle (video) is a project by Roel Wouters and Luna Maurer . A fan is placed in front of a computer screen and accelerates until it blows away the entire desktop. …
Metalosis Maligna
Koert van MensvoortMetalosis Maligna is a documentary by Floris Kaayk about a disease which affects patients with medical implants. Sourcing from such implants a wild metal growth ultimately …
Post History
Jos de Mul (Erasmus University Rotterdam), published in Next Nature Paperback, 2005 For someone whose main instrument is a computer, the world becomes a gigantic database. We see …
The Animal Sweater
KarlThe pattern on the Animal Sweater suggests a new way to experience commercial imagery. The Animal sweater, designed by Karl Grandin, was first shown at The Biggest Visual Power …
Utility Pets
Koert van MensvoortIn the not-so-distant future people will be given a pig with their own DNA engineered into it. The pig, known as a "knockout" pig in the scientific jargon, is a form of living …
Walls with Ears
ricardoportilhoA traditional textile heritage is celebrated with flocked wallpaper that comes to life as it reacts to ambient noise levels. The louder the space the brighter the wallpaper glows. …
What's Epic?
Arnoud van den HeuvelEpic is a fictional prospect (from 2004) on the future culture of media and internet-corporations. The human addiction to news and information must - according to this video - …
Wildgruen
Dr NaturalMandy Meißner's "Wildgruen", a plant that can move and communicate. In her view, plants need to be freed from their isolation, both in the way that they can only lean towards the …
A hunt for hightech
Rolf CoppensIn "A Hunt for High Tech", Bart Hess seeks to harness both nature and technology and create armoured skin and fur for a new human archetype incorporating animalistic and …
A Tomb for All People
Rolf CoppensThose crazy Germans are planning to build modern versions of pyramids that will function as gigantic burial sites. "The Great Pyramid can potentially be any human being's grave or …
Augmented Animals
Dr NaturalAnimals do not shape their living environment as radically as humans, but why don't we give them some help. James Auger envisions animals, birds, reptiles and even fish becoming …
Augmented Fish Reality
Koert van MensvoortAugmented Fish Reality is an interactive installation of five rolling robotic fish-bowl sculptures. These sculptures allow Siamese Fighting fish (Betta Splendons) to use …
Barcode Tattoos
Koert van MensvoortBarcode tatoos . An intuitive manifestation of the decreasing border between humans and products?
Bio inspired Architecture
Koert van MensvoortThis cell-shaped building for the institute for Nanobiomedical Technology & Membrane Biology in Chengdu, China, is an unusual croos-disciplinary collaboration between MIT …
Bonsai tree table
Koert van MensvoortSomehow next nature seems to reveal itself through furniture. Earlier we've featured the treetrunk bench , the bone chair , the folding chair , sketch furniture and how to grow a …
Botanicalls: The Plants have your Number
Koert van MensvoortBotanicalls is a system that allows plants to call their owner when they need more (or less) sunlight or water. It works by placing moisture and light sensors in plants and then …
Brain biometric key
Arnoud van den HeuvelUsing electrodes positioned around a person's scalp, scientists from the Centre for Research and Technology Hellas in Greece are developping a method for electronic identification …
Brain-computer interface for Second Life
Dr NaturalWhile recent developments in brain-computer interface (BCI) technology have given humans the power to mentally control computers, nobody has used the technology in conjunction …
Flesh Nike
Koert van MensvoortA Nike shoe stapled together with human flesh, created by Adam Brandejs .
Global Warming Mug
Arnoud van den HeuvelAl Gore would love one of these mugs; displaying what happens when the world heats up and oceans begin to rise. Via Shikake | See also: ScaryIdeas.com | Related posts: Design A …
How to print an Organ?
Koert van MensvoortWhat to do about the shortage of human organ donors? An emerging branch of medicine, called organ printing (future vision alert) , takes a patient's own healthy cells and uses a …
Modernistic Vaginas
Dr NaturalThe influence of modernism and its trend of thought that affirms the power of human beings to create, improve, and reshape the world, along with its clear universal style of …
Magical Interaction
Koert van MensvoortMan's ability to control illumination is magical in itself but is seldom experienced as such because light switches are purely functional and generally don't stir up imagination. …
Peach Nipple Handbags and Shoes
Koert van MensvoortArtist Nicola Costantino creates objects that comment on the meat and leather industries. In the surrealist tratdition, these handbags and shoes are imprinted with tiny images of …
Philips Vibe Emotion Sensor
Arnoud van den HeuvelThe VIBE - emotional sensing necklace combines conductive ink and textile sensors. The necklace can read multiple biometric signals of the wearer and communicates them to other …
Philips Wake Up Light - Sunrise Alarm Clock
Koert van MensvoortPhilips hits the shops with a product that aims to naturalize alarm clocks. The annoying buzzing machines were once invented to cultivate our day/night rhythms, formerly connected …
Printing virtuality
Arnoud van den HeuvelPhone, internet, television, photography, even books or music: today it is hard for the mind to escape from virtual worlds. A day without communication or interaction could make …
RedesignMe
Koert van MensvoortWe are all born in a world that has been designed already. Cars, dishwashers, dildo's, remote controls, ATM machines. Although these products are supposed to make life better, …
Robot farmer Mr Woo
Arnoud van den HeuvelComedian Paul Merton went to China for Five.tv (early 2007) and near Beijing he reads the following headline: This farmer grows robots...
Robotarium - Zoo for Artificial Life
Koert van MensvoortRobotarium X , the first zoo for artificial life, approaches robots very much in the way as we are used to look at life in old nature. We, humans, enjoy watching and studying …
Robots in disguise
Rolf Coppens"Every year, in Germany alone, around 7000 people wait for a new cornea to save their eyesight. But donor corneas are in short supply. In an EU project, researchers have developed …
Second Life is not Sustainable
Koert van MensvoortWhat has a virtual world got to do with CO2 emissions? Electricity. Second Hype creator Linden Lab consumes an enormous amount of electricity on its 4,000 servers that support …
Skyscreen - largest urban LED screen in Asia
Koert van MensvoortAlright, we can agree most of old nature has been altered by human activity. We're not just talking rain forest, icecaps and genetically modified fruit and kittens . Now you might …
Slogan: The Future is Analog
Koert van MensvoortI first saw this statement on the Artvertising building . Let this be our slogan of the week.
Stoneage noodles
Arnoud van den Heuvel15.000 Years ago we lived in caves, wore animal-fur and ate mammut- noodles !? Oh well, though our knowledge has grown a bit, the human nature hasn't changed that much: every …
Switch Critters - Can you make them switch?
Koert van MensvoortEarlier we discussed the Magical Interaction project, in which Joris van Gelder rethought the boring activity of switching on/off a light by transforming it into a magical …
The objectuals
Rolf CoppensThe Objectuals is a series of work by artist Hyung Koo Lee , it features an interesting mix of visual distortion apparatus for the human body. Lee says that he experienced …
The things we design end up designing us
Dr Natural"While battling the forces of nature, man has become more and more independent of physical conditions. At the same time, however, he has become more and more dependent of …
Tickle Massage Robot
Koert van MensvoortTickle is a small robot that walks on the human body to generate a pleasant, tickling sensation.It has two motors and rubber feet for a good grip on the skin. When it encounters a …
Typosperma
Rolf CoppensAnother project by Oded Ezer, Typosperma is the second experimental typo project in his 'Biotypography' series. As a paraphrase on the biotechnology definition, 'Biotypography' is …
Victoria 4.0
Arnoud van den HeuvelVictoria has great realism, perfect imperfections, and incredible ease of use. Based on live human models she is trying to close the gap between real life and models typically …
All Is Full Of Love
Arnoud van den HeuvelWhile time seems to flow in this one direction, some people just know how to walk straight through that fourth dimension; catch it in a videoclip and throw the message into …
Avatarian Graveyard
Koert van MensvoortAvatarian Graveyard supplies a service for virtual addicts – people who excessively or compulsively spend time in virtual environments – to help them reintegrate into everyday …
BicycleBot
Arnoud van den HeuvelMurata Boy, is a robot capable of riding bicycles unassisted. Balancing, pedaling and directing the bicyclee, turning the bike to avoid obstacles, etc. And this is his nephew, …
Biomechanical Energy Harvesting
Arnoud van den HeuvelLet's face it: every time your cellphone battery runs empty you feel amputated and you quickly run back to your house to connect to a powering-adapter. Bionic Power Inc. is now …
Build a better being
Koert van MensvoortWill Wright's hugely successful games SimCity and The Sims let players shape the structure of urban areas and the lives of virtual humans; his upcoming game, Spore , lets them …
Corpus 2.0
Koert van MensvoortCorpus 2.0 by Marcia Nolte is a set of seven portraits illustrating how the human body could adjust itself to the design of products, including an enlarged SMS thumb (above), an …
Dying ships
Koert van MensvoortThese ships were abandoned over twenty years ago. Their owners left them to die after the Chernobyl disaster due to their high levels of radiation. One of the great ironies of the …
Enjoying Nature in the Cave
Koert van MensvoortNow let us analyze this setup for a moment: You are looking at an avatar character inside a 3D model of a virtual reality cave, enjoying a 'natural' landscape – welcome in the …
Fun begins in 2029
Rolf CoppensFamous technologist and futurist Ray Kurzweil states: it's going down by 2029, so be prepared to get digital on entirely new levels. According to Kurzweil, machines will have both …
Genetic Map of Europe
Koert van MensvoortEuropean biologists have constructed a genetic map of Europe showing the relations between its various populations. The right part of the map shows the location in Europe where …
Google tracks flue spread via sick searchers
Koert van MensvoortThis Tuesday, search giant Google released an experimental tool that tracks the intensity and movement of the influenza virus across the United States by monitoring the number of …
Hemp–Mote
Arnoud van den HeuvelThis weeks peculiar image gives gaming that "natural" touch: the Hemp–Mote by dhrek.com Made from 3 kinds of 100% natural hemp string on the outside, while remaining 100% …
High Performance Hip
Arnoud van den HeuvelA commercial by an orthopaedic reconstruction company introducing the next generation of joint replacements: " Highly advanced hips and knees. Engineered to meet the needs of your …
Organic Coca-Cola
Koert van MensvoortWhoever you are, whatever you do, wherever you may be. You can’t beat the real thing. It really refreshes and brings real satisfaction in every glass. It was not until America’s …
Light weeds
SaraLightweeds is a project by Simon Heijdens and currently exhibited at the MoMA - part of the Design and the Elastic Mind exhibition . The organisms - plants, weeds, trees - exist …
Man Charged for Dumping Silicone Girlfriend
Koert van MensvoortFifteen policemen rushed to the scene, after a couple reported to have bumped into a "corpse" while out walking their dog in a mountain forest in Izu, central Japan. The officers …
Modernistic Chair
Koert van MensvoortIn the category: Creativity with modernistic tree trunks . Created by the good people of Draw me a sheep , who with this project aim to explore today’s human relationship with …
PacMan's Skull
Koert van MensvoortPacMan's skeleton is our peculiar object of the week. It was created by Le Gentil Garcon , in collaboration with Fransois Escuilia, palaeontologist, from the comparative …
Robot asimo conducts concert
Dr NaturalAt a recent Yo-Yo Ma concert at the Detroit Opera House, Honda's ASIMO robot took the stage and conducted. Blame Honda when the robots take over. Thanks Paul .
A robot that controls your remote controls
Dr NaturalConfused with the pile of remote controls in your house? Now here is an idea: get a robot to control them. Researchers at Toshiba have developed a talking robot, named ApriPoko, …
Saturn (Directors Cut)
Arnoud van den HeuvelThe struggle between the born and the made is being fought out in a wardrobe on Saturn. By: 1stavemachine.com | Related: Sixties Last
Scientists Extract Images Directly from Brain
Arnoud van den Heuvel(Extracted directly from Pink Tentacle , thanks!): Researchers from Japan’s ATR Computational Neuroscience Laboratories have developed new brain analysis technology that can …
Sneakpreview
This week we are sneak previewing our forthcoming compilation DVD featuring the best of the Biggest Visual Power Shows at the Picnic 08 - E-art event on 24,25,26 September at …
The Blogging Houseplant
BramMeet midori-san , the first blogging houseplant! Through sensors connected to the leaves of this Sweetheart Hoya reads bioelectric currents through the plant, this gives …
The Breathe Table - Visceral Interaction
Koert van MensvoortNow why is that girl so excitingly staring at a few blurry blobs on a flat screen? Is it because these blobs are connected to her breath... What? Yes that is right, you are …
The mobile evolution
Arnoud van den HeuvelIn our NextNature event BVPS (May 2008), Kevin Kelly spoke of technology as the 7th kingdom of life : a form of evolution whithout the nasty side–effect of dying (Every object …
The Order Electrus
Koert van Mensvoort"Nature adapts, even to human actions that seem to destroy everything. The amazing power of evolution has given birth to a new species of insect. Their ideal habitats are old …
The Telepresence Frame
Rolf CoppensThe Telepresence Frame is a domestic object which utilises the fact that one's bodily functions are digitised in order to create a new form of telepresence. Allowing loved ones to …
Traffic nature
Rolf CoppensJapanese scientists made people drive in circles to find out how traffic jams get born. Related: Human Swarms | Harvesting Traffic Information through GSMs | The things we design …
When Facebook gets Physical
Koert van MensvoortWhat would it be like if the communication on a social networking site like Facebook was actually played out in everyday life? Hilarious sketch by Idiots of Ants (thanks Martijn ).
A hermit crab in a glass house
Koert van MensvoortNever thought I would ever empathize with a hermit crab. But somehow the 'situation' the creature is in, provides me with a feeling of recognition. According to this video marine …
A plate that regulates the speed of eating
Koert van MensvoortMany people tend to eat too fast. As a result they do not receive signals from the stomach that they are in fact full. The result can be overeating and obesity . To encounter …
Anthropomorphic 3d webcam
Dr NaturalThis new 3D webcam with two cameras spaced approximately as far apart as human eyes is our anthropomorphic object of the week. Can you feel it, watching you? The little brother …
Augmented Phone Browsing
Arnoud van den HeuvelThis video shows the first beta version of TwittARound – an augmented reality Twitter viewer on the iPhone 3Gs. It shows live tweets around your location on the horizon. Because …
Battery-Free Implantable Neural Sensor
Koert van MensvoortThe shrinking size of electronics allows for the implantation of increasingly sophisticated electronic devices in the human body, paving the way for new prosthetics and …
Bioluminescent Trees will Replace Streetlights?
Koert van MensvoortMost people know about light emitting organisms such as jellyfishes, fireflies and mushrooms . Some time ago, genetic engineers transferred genes responsible for the luciferin and …
Brain Scan Replaces Job Interview in 5 Years?
Dr NaturalForget about palmistry! MRI scans for candidates in top jobs such as bank directors could soon become part of the job-application package, says Erasmus University researcher Prof …
Brainwave Binoculars
Arnoud van den HeuvelThe eye passes on more information to the brain than the brain will process. In that sense, the brain functions as a filter. But on the battlefield the risk of neglecting …
Colalife
Rolf CoppensCoca-Cola© succeeds in what most NGO's try to achieve: getting the goods to the poor in the 3rd world Africa. For most people there, a Coke is easier to get and cheaper than a …
Escape of the Prairiedogs
Arnoud van den Heuvel" It took just 10 minutes for a dozen prairie dogs to outwit the creators of the Maryland Zoo's new $500,000 habitat. Aircraft wire, poured concrete and slick plastic walls proved …
Exmovere Chariot: the wearable wheelchair
federicaExmovere Holdings , a biomedical engineering company, is focused on government and consumer applications for healthcare, security and mobility. This company developed Exmovere …
Eyeborg
Arnoud van den HeuvelThe Eyeborg Project is the work of Rob Spence, a 36 year old filmmaker residing in Toronto, Canada and Kosta Grammatis – an unemployed engineer from San Francisco, California. …
Field of Waves
Koert van MensvoortParks are not nature. Parks are culture: man-made simulations of nature, carefully constructed to provide walkers, runners and mountain bikers with a recreational, yet confined – …
Fresh from the Pharm
Gordon TiemstraWill we in the future still buy several needs according food in shops, or will we grow M&M’s ourselves? There is a lot happening on in the field of food technology , think for …
Future babes
Arnoud van den HeuvelA future in which prosthetic patches prevent bodies from aging? Or a sexists view on femininity in robotics? Either way, the question is whether they are up- or downgrades of …
Green Vibes
Arnoud van den HeuvelThe big lobby to endeavor for a climate neutral lifestyle must have reached its peak. It is common knowledge that recycling electronic and battery operated utensils is better for …
How do Bacteria Communicate?
Arnoud van den HeuvelSo here we are; bragging about our discoveries and great new ways of living... meanwhile we tend to forget that we are NOT the dominant species on the surface of the earth. …
Living Doll
Arnoud van den HeuvelCrying, talking, sleeping, walking... not really, but this is what Cliff Richard's concept could look like when laboratorised. "To demonstrate a new method for fabricating …
Melting polar bear reveals a metal skeleton
Koert van MensvoortUnsure how this melting polar bear ice sculpture created by artist Mark Coreth fits in Next Nature mythology. The art piece was presented last week in Copenhagen and is sponsored …
Nano snowman
Rolf CoppensThis snowman is 10 µm across, 1/5th the width of a human hair. The snowman was made from two tin beads used to calibrate electron microscope astigmatism. The eyes and smile were …
New Media 80.000 BC
Hendrik-Jan GrievinkEvery medium was new oneday . This point is beautifully illustrated in the movie Quest for fire ( La Guerre de feu by Jean-Jacques Annaud, 1981), a must-see for Next Nature …
No Signal
Arnoud van den HeuvelAs technology evolves, people are more and more depending on it to function properly. But the nature of technology is that it needs networks, sources, software, batteries and …
Nocturnal Life of Diurnal Birds
Matthijs.KwakEnglish Robins are forced to sing their song during the night. Not because they have figured out that music just sounds better in the dark, but because they can't compete with the …
Pelvis Rocking Chair
Arnoud van den HeuvelIt is nature, but not like we know it when chairs biomimic the pelvis. This anatomic Ruby rockingchair was designed by Pouyan Mokhtarani , Tehran (Iran). Via b oingboing.net | …
Plastic Birds
Koert van MensvoortBird spotting is not a typical activity for us next nature explorers, yet occasionally we bump into some birds worth mentioning (remember the amazing copy-paste bird , rubber duck …
Project Natal: You are the Cursor
Arnoud van den HeuvelToday browsing and gaming is dominated by the shortcomings of machines, for machines simply do not know who is on the other end. Man needs to interact; therefore man needs to …
Recycling Robot Takes the Streets of Italy
Koert van MensvoortLet the robots do the dirty work! This real-life Wall-E Recycling robot, part of the $3.9 million DustBot research program that is trying to improve urban hygiene, collects trash …
Reprogramming Skin Cells into Stem Cells
Arnoud van den HeuvelA major breakthrough in the world of genetics: Researchers have successfully reprogrammed skin cells into stem cells. Using a technique called iPS cell reprogramming (developed in …
Sunflowers – electric gardening
Koert van MensvoortA retail lot in Austin, Texas recently sprouted a field of solar photovoltaic sunflowers that soak up the sun’s rays to provide shade while generating a steady stream of …
The Eye of a Cyber Sapien
BartAn earlier post on this blog already displayed the possible future of sight using augmented contact lenses. Researchers at MIT take this second sight to a next level by …
Virtual Characters tortured for Science
Koert van MensvoortIn the classic Milgram Experiment conducted in the 1960s, volunteers were told by an authority figure to deliver electric shocks to another person as punishment for incorrect …
![Visual of Wetware [definition]](https://nextnature.net/media/pages/magazine/story/2009/wetware-definition/03c3434b26-1602632752/wetware-868x486.jpg)
Wetware [definition]
Arnoud van den HeuvelThough its exact definition has shifted over time, the term "wetware" and its fundamental reference to "the physical mind" has been around from the mid-1950s. In its original, …
Artificial Shrub Observatories
Arnoud van den HeuvelJustin Shull investigates the born and the made by mixing them up in mobile installations like the "Terrestrial Shrub Rover" and the "Porta Hedge" . His designs consist of several …
Beware of the Virtual Squirrels
Koert van MensvoortKasey McMahon and Derek Doublin demonstrate the tension between people and their environment through the eyes of its non-human inhabitants. Beware of the Virtual Squirrels ! The …
Death: An in your Face type of Business
Marco van BeersEveryone wants to be remembered after his or her death. Some choose to be buried, others to be cremated. The company Cremation Solutions has a new service which ensures you will …
Design Fiction – Medical Bill of the Future
Koert van MensvoortAccording to this fictitious future medical bill almost every part of the human body will be repairable in 2028. Gut bacteria replacement, Bone tissue growth for skull repair, …
Doll Box Coffins
Koert van MensvoortThis interactive piece called Boys & Girls was made by artist Job Koelewijn , who invites people to take place in the life size coffin–style Barbie & Ken packages, where …
Douglas Coupland: A radical pessimist's guide to the next 10 years
Hendrik-Jan GrievinkDouglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …
ECO Currency – A Proposal to Balance Economical and Environmental Value
Koert van MensvoortImagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …
European Parliament goes Next Nature
Koert van MensvoortAlright the title "Making Perfect Life" ' may sound a bit 20th-century-modernistic-techno-optimistic-naive, but for the rest we are confident this conference is going to be pretty …
Experiments in the Revival of Organisms
Hendrik-Jan GrievinkExperiments in the Revival of Organisms is a 1940 motion picture which documents Soviet research into the resuscitation of clinically dead organisms by Doctor Sergey Sergeyevich …
There’s Plenty of Room at the Bottom
Hendrik-Jan GrievinkSo you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …
First man infected with computer virus
Arnoud van den HeuvelDoctor gets chip. Chip gets virus. Virus infects other devices... Dalek shoots doctor? Dr. Mark Gasson of Reading University implanted a RFID chip under his skin last year. It is …
From Main Street to the Mansion: Disney, Playboy and the Next Nature of Sex and Death
Peter LunenfeldNature demanded that we make a choice between immortality and sex, but the Next Nature of the 21st century may not. For help, we can look back to the 20th Century, which had many …
Google Earth Alphabet
Hendrik-Jan GrievinkLanguage is communication technology. As Marshall McLuhan said, the spoken word was ‘the first technology by which man was able to let go of his environment in order to grasp it …
How to Grow an Organ
Koert van MensvoortBuckle up for the state of the art in the fusion of the made & the born. Anthony Atala of the Wake Forest Institute for Regenerative Medicine presented footage of his …
HP Computers are Racist
Koert van MensvoortThese two co-workers found out the face tracking feature of the utterly advanced HP webcam will not recognize or track black faces. Hewlett Packard says it's because the program …
iBookshelf: Simulation before Extinction
Koert van MensvoortAs technology progresses we constantly have to adapt ourselves to an ever changing media landscape. Designers try to smooth the changes with a ' progressive nostalgic ' strategy: …
Inkjet Bio-Printing the Skin
Niko VegtIn the series of bio-printer stories this inkjet-like bio-printer seems to be the most convincing product to hit the market soon. It sprays skin cells directly onto burn victims, …
Intimacy Dress
Koert van MensvoortThe Intimacy dress takes our notion personal space to a next level: the closer someone approaches, the more transparent the dress becomes. As such, the garment becomes a sort of …
Invisibility Cloak Hides Objects Visible To The Naked Eye
Koert van MensvoortSome years ago scientists managed to build a rudimentary invisibility cloak, which was an impressive device but it had some important limitations, not least of which was that it …
Making a Telegraph with Stone Age Tools
Koert van MensvoortThe suited guy in the video is an employee from the office of materials that goes into the wilderness to test if it would have been possible to create a fully functioning …
Matt Ridley – When Ideas have Sex
Koert van MensvoortAt TEDGlobal 2010 , author Matt Ridley argues how, throughout history, the engine of human progress has been the meeting and mating of ideas to make new ideas. According to …
Meat Stylus
Koert van Mensvoort“ Who wants a stylus? ” Words by Apple’s Steve Jobs when introducing the iPhone that uses a revolutionary input device: the finger. And it works wonderfully, yet in some …
Memory Helmet
Arnoud van den HeuvelProtection is the fundamental purpose of the helmet. This helmet, a conceptual design project by Seungjoo Lee , enables the storage and protection of memories. Plug in your USB to …
Nature is an Agreement
Tracy MetzNature is an agreement. Just like the nude beach. Here you keep your breasts and your crotch covered, There you drop everything and act like it is the most ordinary thing in the …
Next Nature Movie #10 – Idiocracy
Koert van MensvoortAs we are nearing the end of the year, and anticipate you might have some time to watch a film, we discus our top 10 Next Nature movies. Idiocracy (2006) is not a great film, …
Next Nature Movie #2: Being There
Koert van MensvoortThe main character in ‘Being There’ (1979) is a simple-minded gardener named Chance, played brilliantly by Peter Sellars, who has spent all his life as a servant in the Washington …
Next Nature Movie #6: The Matrix
Koert van MensvoortIn the last few decades there have been numerous films that take the struggle between mankind and its increasingly intelligent and autonomous technology as a leitmotif. Ranging …
Next Nature Movie #7 – Grizzly Man
Koert van MensvoortThe sad story of Timothy Treadwell is the ultimate example of the drama a naive notion of nature can bring about. Grizzly Man (2005) opens with the facts surrounding Timothy …
Onion Pill
Koert van MensvoortSince the intake of medicines has become a mundane ritual nowadays, why not naturalize the interface? French artist Mathieu Lehanneur is rethinking the pill-person interface in …
Outer-Space as Local-Space
Florian Conradi and Michelle ChristensenIn 1977, NASA launched Voyager 1 and Voyager 2, two unmanned interplanetary space probes that were sent out to explore the outer space. Aboard each was a record which intended to …
Rocky Messages
Koert van MensvoortThese SMS-style messages scribbled into the mountains by Belgian artist Wim Delvoye , make us so humbly aware of the discrepancy between our everyday human experience and some of …
Search Stories
TimoOnce upon a time humans told stories by painting on cave walls, showing plays in an amphitheater, pressing text on paper and shining light trough pieces of film. Today we tell our …
Self-healing Surfaces
Arnoud van den HeuvelWhat if a scratch on your car door could heal itself, just like the human skin does? Engineers are working on a way to transfer the self-healing ability of the skin to surfaces …
Skin Paper
Koert van MensvoortSkinpaper is a speculative work by Tommaso Lanza and Vanessa Harden that explores the cross section between a living specimen and paper. "Skin paper is made of breathable …
Space Monkey
Arnoud van den HeuvelDuring the 1960s, monkeys were sent into outer space as part of the US space exploration program. But they didn’t all return, until now. Via scaryideas.com | Related: WWF
Squamata headset dances with the Music
Koert van MensvoortInspired by body language of animals (in particular squamates and porcupines), designer Jop Japenga created a headphone with an adaptive skin that responds to the music played on …
Stelarc wins Prix Ars Electronica
Koert van MensvoortGlad to announce that performance artist Stelarc – who already for some decades incorporates themes of cyborgization and other human-machine interfaces in his (very bodily) work – …
Sign Out Forever
Hendrik-Jan GrievinkAn earlier post on Next Nature learned that The Good People behind Webwill provide us with a service to extend our lives on social networks after our physical death. But what if …
The Buttons
Koert van MensvoortNowadays buttons are completely mundane and natural objects in our environment. You find them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the …
The Footsticker
Rolf CoppensThere are many advantages of bare feet sporting: better motion control, more feeling in your feet and direct floor contact, etc. In this way you are more grounded and more aware …
The Stray Shopping Cart Project
Koert van Mensvoort"Until now, the major obstacle that has prevented people from thinking critically about stray shopping carts has been that we have not had any formalized language to differentiate …
X-Ray Visions
Hendrik-Jan GrievinkAnyone who ever saw an x-ray picture of himself will probably recognise the uncanny feeling of staring at your own skull or bones and being confronted by one of nature’s grim …
A bacteria of a different color
Allison GuyIn 2009, undergraduates at the University of Cambridge worked with scientists and artists to engineer E. coli into E. chromi , a new type of bacteria that secretes a range of …
Afterlife for Atheists
Lisa van der VoortWhere religions promise their believers a life after death and cryonics also needs a kind of belief in future technological development, designers James Auger and Jimmy Loizeau …
Amber Case: We are all Cyborgs Now
Koert van MensvoortTechnology is evolving us, says cyborg anthropologist Amber Case in her 8 minutes of TED . We become a screen-staring, button-clicking new version of homo sapiens, relying on …
Animals Made from Other Animals
Allison GuyThat's no reindeer, and it's certainly no moose. It's an Irish Elk, Megaloceros giganteous , a deer that happens to be neither an elk, nor really all that Irish. What it does …
Anthropocene for Dummies
Koert van MensvoortThe Anthropocene is the recently proposed epoch of Earth history that, proponents say, has begun with the rise of the human species as a globally potent biogeophysical force, …
Birds Change Along with Us
MaikelMouraoA 'treasure in the trees' reveals the exchange of materials between man and animal. This beautiful house finch nest, made of natural resources and manmade garbage, demonstrates …
Blinky – Does what we want it to do
Sebastiaan WolzakIn the short movie Blinky, on a boy and his robot, director Ruari Robinson reflects on our daily dealings with technology and its risks. Alex is a child growing up in a family …
Body Manipulation and Music
Allison GuyLucy McRae uses spandex to deterritorialize the body. #powershow #bodyart http://bit.ly/th7KyR
Brainscan App
Arnoud van den HeuvelBy hooking up a commercially available EEG headset to a Nokia N900 smartphone, Jakob Eg Larsen and colleagues at the Technical University of Denmark in Kongens Lyngby have created …
Browsing the Technological Sublime
Allison GuyIn this video, Geert Mul uses online photos to tap into the divine presence in image search #powershow http://bit.ly/uk79b0
Catalytic Clothing
Koert van MensvoortCatalytic Clothing is a fashionably calm technology that aims to tackle air pollution by embedding a substance in the clothing that purifies air when you wear it. The purifying …
Cheiracanthium drives a Mazda
Allison GuyIn March, Mazda recalled 65,000 cars, not because of any structural faults in the vehicle, but because the engineers had inadvertently created the perfect habitat for a tiny …
Crows crack nuts... and traffic patterns
Allison Guyhttp://www.youtube.com/ watch?v=BGPGknpq3e0 Narrated by the incomparable David Attenborough, this footage goes to show that urban birds really are smarter . The cross-walking …
Deus Ex: The EyeBorg Documentary
Marco van BeersBack in 2009 Rob Spence, a cyborg film maker, worked together with a team of ocularists, inventors, engineering specialists on a prosthetic eye which can capture and stream video. …
Disgusting Switches
Koert van MensvoortIf a light switch would be hairy or snotty nobody would want to turn on the light anymore, which is exactly why designer Katrin Baumgarten created some of the most one nauseating …
Facing your Car
MattijsDo cars have a face? You would be inclined to say yes immediately. And you would be right as well, because they do. Study has confirmed through a complex statistical analysis that …
Information Decoration Scarf
Koert van MensvoortRemember the Information Decoration essay which argued our so-called information society barely employs our human bandwidth, as most of the data in our lives is presented in …
It's a plane!
Arnoud van den HeuvelBy nature, man is not meant to fly. But while we're at it, we may as well turn it into an experience . Charles Champion, Airbus Executive Vice President Engineering, envisions a …
Kitten Ears – Blushing 2.0
Koert van MensvoortAlways wanted a pair of kitten ears to express your feelings to the world? Well, you probably never thought of that – as you have to be a Japanese genius to come up with such an …
Labradoodle
Koert van MensvoortIndulge in its cuteness. The Labradoodle brings us the finest blend between the labrador and the poodle. Combining sociability with beauty, they are the perfect human companion. …
Let the Algorithms Roam Free
Bastiaan EkelerIn this TED talk, Kevin Slavin explains how computer algorithms are breaking free of their virtual habitats and changing the physical world to their liking. Through algorithms, …
![Visual of Manko & Soup [#6]](https://nextnature.net/media/pages/magazine/story/2011/manko-soup-6/b9aa51ad29-1602632753/manco-7-868x486.jpg)
Manko & Soup [#6]
Aston RevolaWhen Nada returned as promised with a small bowl of soup in her hands, Manko was sitting upright with a grumbling stomach. Even now that Manko could see normal again, Nada's hair …
![Visual of Manko & The Children [#9]](https://nextnature.net/media/pages/magazine/story/2011/manko-the-children-9/3d8fe20352-1602632753/manko9-868x486.jpg)
Manko & The Children [#9]
Aston RevolaAs they went down the elevator shaft, going deeper underground, neither Nada nor Manko spoke a word. To Manko it seemed to take forever. In his mind, he went over the long …
Mastering Bambi
Allison GuyIn the film Mastering Bambi, artists Persijn Broersen and Margit Lukacs have stripped the landscape of its cuddly, anthropomorphic characters. Over the course of the film, the …
Morphing Cutlery
Koert van MensvoortImagine a world where the shapes of all objects around you would be able to change on the fly. Envision a future where nanotechnology and morphing become ubiquitous and blend in …
My Fetal Pony: Neoteny in Girls' Toys
Allison GuyIt's no secret that Mickey Mouse has evolved in response to consumer pressures. Once a violent river-rat, he became the boy scout of rodents with good looks to match. Steven Jay …
Negative Islands
Allison GuyRecent flooding along the Mississippi River has broken records first set 70 years ago. As always, it's hard to attribute local weather to global patterns, but the heavier rainfall …
Next Nature Hands Out Performance-Enhancing Pills
Allison GuyRecently Google slapped our site with a warning that "something's not right here!" It seems that the Drug Enforcement Agency has caught the Next Nature staff handing out baggies …
One Chicken Feeds 100 People
Koert van MensvoortOur peculiar image of the week is not what it seems. Rather than a man with a gigantic chicken on a leash, you are looking at a normal chicken with an incredibly shrunken man …
Pregnant Avatars
Arnoud van den HeuvelThis interview from 2008 is exemplary for a time when people started experimenting on humanizing anonymous avatars in the virtual realm. Shopping, building, going on holiday, …
Remote Kissing Device
Arnoud van den HeuvelNobuhiru Takahashi, student at the Kajimoto Laboratory of the University of Electro-Communications in Chofu City, Tokyo, invented this Internet French kissing device. When a …
Resizing Daddy
Allison GuyA little girl gets angry at her father, and uses her index finger and thumb to make a pinching motion . No, she's not trying to hurt him. She's using iPad sign language to say, "I …
Robot Guide Dog
Stefan Fincken#! Possibly the answer for blind people with cynophobia, the fear of dogs. This robot guide dog is stil a bit slow compared to the old nature version, but as technology advances …
Rule #2: Different People Anthropomorphize Differently
NextNature.netFor past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. What people experience as anthropomorphic is highly personal. Tests have …
Rule #3: Keep it ASS: Abstract, Simple and Subtle
NextNature.netFor past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. Making good use of anthropomorphism isn’t easy. As you’ve probably …
Sin free for just €1.59
Marco van BeersFor just £1.19 ($1.99, €1,59) you can download an app for your iPhone which offers tips and guidelines with the sacrament, "the perfect aid for every penitent" as the description …
Social Microbial life
Marco van BeersMyMicrobes , interestingly dubbed "Fecesbook" by ABC News , is the new social network for your gastrointestinal bacteria. For only $2,100 and a bit of poo you can become a member …
Spidergoats & Superskin
Stefan FinckenWhile some of us might have heard of the humorous but fictional ' spider pig ,' spidergoats are the real deal. Although you might expect to see them lounging in giant webs or …
Technology: The 7th Kingdom of Life
Koert van MensvoortKevin Kelly, Senior Maverick at Wired Magazine talks about the nature of technology and propose to define technology as the 7th Kingdom of Life.
The Banana Gets a Second Skin
Allison GuyWe already know that bananas are evidence of intelligent design – by farmers, not by god. All commercial crops have been tweaked by the hand of agriculture, but modern bananas …
The Pigeon that Shat the Golden Soap
Allison GuyEver wished you could take a shower with pigeon poop? Artist Tuur van Balen proposes changing pigeons from flying rats to cleaning agents. A speculative, specially engineered …
Theriomorphous Cyborg
Allison GuyThe Animal Architecture Awards have just announced the winners of their 2011 contest. Taking first place is Simone Ferracina's Theriomorphous Cyborg , a (speculative) augmented …
Typing Out Evolution
Allison GuyFrom the exhibit "What Machines Dream Of" in Berlin comes Life Writer , a work by Christa Sommerer and Laurent Mignonneau. As the participant types, letters are projected on a …
Welcome to Earth, Number 7,000,000,000!
Allison GuyWelcome to earth, #7,000,000,000! Hope you like the #anthropocene. Learn more: http://bit.ly/se1SQc
Why Handwriting Must Die
Koert van MensvoortAssociate professor Anne Trubek argues that handwriting will soon be history , because writing words by hand is a technology that's just too slow for our times, and our minds. A …
#11: Don’t Use Anthropomorphism if it Does Not Serve Any Purpose
NextNature.netPart 11 of the series 11 Golden Rules of Anthropomorphism and Design Anthropomorphism can be a powerful tool in product design. But there are also risks involved that urge …
3D Printing a New Face
Koert van MensvoortEarlier this year, Belgian surgeons successfully performed the country's first full-face transplant using 3D printing. The operation was conducted by a medical team of Ghent …
A Computer that Nods and Waves When You Do
Allison GuyEver wish you could express yourself better over Skype? Tired of being a disconnected head-in-a-box? A team at Stanford University has rigged a Mac computer screen to shake its …
A More Realistic Mermaid
Koert van MensvoortAfter being denied permission to reproduce the famed Little Mermaid statue from Copenhagen, the authorities of Vancouver decided to go for something more realistic.
A Second Life for Rescued Plastic Pens
Allison GuyArtist Willis Elkins "rescues" plastic detritus from the sea. His most recent venture, the Jamaica Bay Pen Project , retrieves sun-baked, useless pens from the shores of New …
Bioinspired Robojelly Can Swim Forever
JenniferScientists have developed a biomimetic robot that will be able to swim forever, since its artificial muscles are powered by water. And since Robojelly lives underwater, it will …
Braille 2.0
Jeroen van PeltText for blind people using the Braille alphabet has been around for some time. But instead of making separate books for the visually impaired, why not change the way we all read? …
Charging Phones by (and with) Camp Fire
Allison GuyWith areas of New York still without electricity, BioLite recently came to the rescue of Brooklynites by setting up a charging station with camping stoves that convert excess …
Complexity and Evolving Synthetic Soil
Rachel ArmstrongTwenty-first century society draws from a world that is less determined by objects and increasingly shaped by connectivity. The clear either/or distinctions that formerly informed …
Conservationists Turn Their Sights on Urban Habitats
Allison GuyFor city-dwellers, the closest 'true wilderness' to be found is usually the weeds sprouting in abandoned lots. Snow-capped, postcard nature might be beautiful but is …
Darwinian Selection of the Cowboy Hat
Allison GuyThe standard story of the cowboy hat goes something like this: In 1865, J.B. Stetson went out west during the California gold rush. He observed that bowlers, raccoon hats, and …
Does Chocolate Milk Come From Brown Cows?
Gillis van de ZandeAlthough chocolate milk producing cows may sound silly, scientists are seriously analyzing the feasibility of the idea. Why not add genes of cocoa and sugar to a cow, in order to create a cow that produces sweet chocolate milk?
Meat, the Expectations
Koert van MensvoortAs the planet’s population speeds towards 9 billion, it’s becomes impossible to continue consuming meat like we do today. Will we all be eating rice and beans? Grasshoppers …
Everything is an Event on the Skin
Koert van Mensvoortwrote 19th-century scientist and philosopher Hermann von Helmholtz. It was Helmholtz who inspired body-architect Lucy McRae to create Morph?.
Featured Page #01: Hypernature
Hendrik-Jan GrievinkDuring the coming weeks, we will present a selection of our favourite pages from the Next Nature book . To kick the series off, we’ll start with a spread about hypernature; the …
Featured Page #02: Google Nature
NextNature.netDuring the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week the second one in this series: Google Nature. Imagine you are an …
First "Farm"aceuticals Grown in Carrots
Allison GuyThe United States Food and Drug Administration recently approved Elelyso, the first drug to be grown in genetically modified plant cells. Produced in carrot cells, this drug helps …
Free Range Robot Filters Out the Ocean's Plastic
Allison GuyWhale sharks are great at filtering; plastic needs to be filtered. For now, however, whale sharks only have an appetite for plankton. Industrial designer Elie Ahovi has jumped …
Goats Replace Lawnmowers in San Francisco
Allison GuyThey might not be as fast, but goats offer several advantages over diesel-powered lawnmowers. They're quieter, they emit fewer greenhouse gases, and they fertilize soil as they go …
Eating In-Vitro: Instant Meat Powder
Koert van MensvoortThe number one argument for eating meat: it provides nutritious proteins that cannot be entirely supplied by vegetarian alternatives. Like it or not, humans are omnivores. Meat is …
Jellyfish built from Rat Cells
Koert van MensvoortAnother step in the fusion of the made & the born: Researchers at Harvard University managed to make an artificial jellyfish using a sheet of silicone and rat heart cells. The …
Jet Powered Barbecue
Koert van MensvoortAt first sight it seems plain wrong to roast your burgers on this utterly technological machine: barbecuing is supposed to be a nostalgic low-tech activity that brings us back to …
Let the Robotic Farmers feed the World
Koert van MensvoortThe future of farming is not to be found in further mass-industrialization nor in the return to traditional farming with man and horse power, but rather in swarms of smart, cheap robotic farmers that patiently seed, tend and harvest fields one plant at a time without the need for damaging pesticides.
Lucy McRay - Swallowable Parfum
Koert van MensvoortKnow garlic? Now imagine we could make something that functions alike, but smells a lot better. That's what Swallowable parfum is about.
Macbook Pro Fragrance
Arnoud van den HeuvelNothing beats the factory-scent of expensive, freshly unboxed technology! Artist group Greatest Hits produced the Apple Unboxing Scent for use at an exhibition in Melbourne, where …
Mobile Phone Avant La Lettre
Koert van MensvoortOur peculiar image of the week is exemplary of our human longing for technology that intimately integrates with our body & senses. We are all cyborgs .
Nano Product: Nansense
NextNature.netFor years, people have relied on harsh drugs and irritating alarms to control when they sleep and when they wake. Now, the Nansense wristwatch offers an all-natural way to …
NANO Product: The Necklace
Koert van MensvoortBreast cancer is a disease that comes with feelings of helplessness and loneliness. This nanotechnological necklace allows you to regain some control regarding your disease, in …
Nanotech Bracelet Detects Allergies
NextNature.netDesigned by Luc de Smet, Awear is a speculative bracelet that can detect and record the sources of allergies for children in uncontrolled environments, such as schools and …
Nanotech Water Bottle Harvests Water from the Air
Allison GuyThe Namib desert gets less than a half an inch of rain per year, yet the stenocara beetle manages to survive in these punishing conditions. The beetle's secret lies in an array of …
Nature Disappears from Childrens' Books
Allison GuyIn an analysis of Caldecott Medal winning children's books, sociologist Allen Williams recently discovered that depictions of nature have dramatically declined from 1938 to …
New Robot Turns Poo into Energy
Allison GuyThough disgusting, sewage is an abundant, nutrient-rich resource. Researchers at the University of West England have taken advantage of this fact by creating a robot that turns …
New Volvo Recognizes Shapes of Animals like Deer & Elk to Reduce Crash Impact.
Koert van MensvoortVolvo cars is testing a new safety system that automatically hits the brakes once an animal is detected in the vehicles vicinity. The Animal Detection System expands the range and …
Pantone SkinTone
Rolf CoppensShould made-to-order babies become a reality in the near future, one piece of the design puzzle has been solved now Pantone has release their SkinTone system. Indexing 110 skin …
Playing With Pigs
Lisa van der VoortBesides children and pets , it turns out that pigs are also attracted to interactive interfaces. Pig Chase is a computer game in which pigs and people can play together. The aim …
Raise Crops on the Moon with Plant-Growing Jelly
NextNature.netIn dry areas like the desert, on mountain tops or on the moon it’s impossible to grow anything. Or is it? A rain in the desert sparks extreme plant growth from the moment the …
Robot Fridge Forces You to Smile for Food
Allison GuyFeeling grumpy and hungry? Unfortunately, the University of Tokyo's Happiness Counter refrigerator won't open up until you give it a big smile. The concept is based on the fact …
Rule #6: Meet People’s Expectations
NextNature.netFor past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. People expect many things from each other: Expect them to say hi in the …
Screw Technology
Hendrik-Jan GrievinkIn this particular piece of video art, loyal readers of nextnature.net might recognise the building as Zeche Zollverein in Germany, where we organized the Biggest Visual Power …
Seaside Swimming Pool
Koert van MensvoortAlways good to see a swimming pool exactly where you need it. At San Alfonso del Mar resort in Chili they know how to cater people that love nature – except for the rocks, bites …
Should I be Afraid of...
Koert van MensvoortFor doom-mongers delight, the Berlin-based design studio Bold Futures made a handy interactive graph of the fatal disasters that might snuff us.
Surviving Progress
Koert van MensvoortMontreal filmmakers Mathieu Roy and Harold Crooks’ documentary feature, Surviving Progress presents the story of human advancement and reveals the risk of running the 21st …
Swiss Army Nails
Koert van MensvoortFunctional multi-tool manicure. Comes in handy at a party where you can't find a bottle opener. Peculiar image of the week. Unfortunately, neither the human responsible for the …
That Website Smells!
Jesper van den ToornDo you ever miss being able to smell the woods in an online travel journal? The odor of a new leather jacket in an online shop? Or perhaps you just couldn’t find the words in an …
Is Life on Earth Suicidal?
Allison GuyAt Next Nature, we often argue that "our image of nature as static, balanced and harmonious is naive and up for reconsideration ." Paleontologist Peter J. Ward happens to agree. …
The Right to Privacy
Orestis TsinalisPrivacy is a right. A right given to people by telecommunications companies and social networking websites. It can be described by multiple-choice lists of settings. And it seems …
The Sound of Silence? An Aircraft Engine.
Allison GuySilence is a thing of the past. Just as no place has been left untouched by climate change, there is no place on earth that is not 'polluted' by the sounds of planes, ships, and …
To Generate Electricity, Just Tap on this Virus
Allison GuyIs your friend impatiently tapping on her phone, or is she just charging the battery? Researchers at the Berkeley Lab have produced the first virus-powered generator that runs off …
Transfer Your Window!
Jaap ArtsImagine you buy a special kind of window which you can place on your wall wherever you want, enabling you to get different views, not always looking at the same tree or house of your neighbors.
Turning Wind Farms into Seaweed Farms
Allison GuyClosed to commercial shipping and fishing, offshore wind farms aren't put to much use besides generating clean energy. Ecofys , a Dutch sustainable consulting company, hopes to …
Welcome to the Anthropocene
Rolf CoppensWatch human and urban life evolve in this 3-minute journey through the last 250 years of our history, starting at the beginning of the Industrial Revolution.
Why It's Time to Calm Down about "Invasive" GM GloFish
Allison GuyIs the neon green tetra GloFish soon to be the florescent, transgenic terror of America's waterways? The internet hype machine has repeated ad infinitum the Washington Post's …
Will a Cockroach Save Your Life?
Steef PeppingOften cockroaches aren’t people's best friends, but maybe in a few years you will be relieved when you see a cockroach. Researchers of the North Carolina State University …
“Soccket” Ball Generates Free Electricity
Alessia AndreottiIt looks like a normal soccer ball, but Soccket has a secret: a hole for a charging cable. Designed by two Harvard students, the ball has a pendulum-like mechanism inside that …
3D Print a New House in One Day
Jonathon Markowski3D printers using concrete can now create complete houses from the ground-up.
Are We Seeing the Same Thing?
Stephen PerryA fundamental philosophical question, how do we know my blue isn't your yellow? The current human and "natural" understanding of color is fundamentally based on a …
Bored with Sex? There's a Pill for That
Allison GuyTrials for new drugs hold promise for a "cure" for female boredom in the sack.
CAMOVER: Destroy All CCTV Cameras!
Silvia CelibertiEarn points in an online game by destroying real-life CCTVs.
Pick Pig - Name Pig - Love Pig - Eat Pig
Stephen PerryIn a time of all-horse hamburgers and E. coli outbreaks, food provenance has become a huge issue. Consumers are becoming increasingly aware of the lack of traceability within the …
Clothes that Turn Heat into Electricity
Allison GuyWith rising energy costs and our growing arsenal of iPads, smart phones, and wearable monitors, we're always on the lookout for new ways to power our devices. Perpetua Power , an …
Cockroach Farms Do Big Business for Food and Pharmaceuticals
Allison GuyBig bugs make big bucks for Chinese farmers turning to roach ranching.
Software Fakes an Active Social Life While You're on the Sofa
Allison GuyCouchCachet promises to give you the fully-booked, in-the-know life while you are on the Sofa.
Deliver us from Digital Bluntness
Stephen PerryPeoples attitudes online are wholly different from their behaviours in real life
Seven Future Visions on In-Vitro Meat
Koert van MensvoortBefore we can decide if we will ever be willing to eat in-vitro, we need to explore the food culture it will bring us.
Digital Sharing Becomes Physical
Wout KregtingThe embedded "share" button in the new Playstation assumes that sharing is at the center of our existence.
DIY Body Modification to Hack Evolution
Alessia AndreottiBiohacker Tim Cannon inserted a chip into his arm to monitor his bodily data and transmit it to an Android device.
Empathy for the Device
Robin PohlKate Darling argues that society needs to update its ethical landscape to include thinking machines.
Exploring the Offline World, if It Still Exists
Bram de VogelThe surprising results of a year offline in the "real" world.
Bionic Eye: Limited Vision to the Blind
Marco van BeersA new implant lets blind people see letters, crosswalks and people.
Food Simulator to Fulfill the Desire to Eat
Alessia AndreottiTwo master's students have created a speculative device to simulate the sensations of eating.
Google Birdhouse Shows Birds Their Way
Alessia AndreottiPutting the birds into the bird's eye view of Google Maps.
Google's Shoes Talk to Runners
Alice FumeyNeed a personal trainer? Google's new sneakers fulfill the role of a human coach.
Grossed Out by Lab-Grown Meat? Here's 7 Reasons Why You Shouldn't Be
Allison GuyIn vitro meat is creepy, unnatural and downright disgusting – and so is every other kind of food we eat.
How Much is a Polar Bear Worth?
Jonathon MarkowskiPolar bears bring only $9 million to the Canadian economy, but citizens put their collective value at $6.3 billion. Why?
Hug & Pay
Koert van MensvoortThe rise of digital currencies reduces the need for physical interaction and communication between people. At the same time every payment method still leans on trust. But how can …
I’ll Take A Variety of Fried Gadgets, Please
Alessia AndreottiIs a deep-fried iPad as unhealthy as a McDonald's meal?
Implantable Microchip Controls Appetite
Adriaan de RegtBy attaching to the vagus nerve, a chip can contribute to "natural" weight-loss.
Invasive Crab Restores Damaged Habitat
Allison GuyA strange set of coincidences turn an invasive species into a hero
Jellyfish Ice Cream Glows When Licked
Alessia Andreotti$220 ice cream glows thanks to synthetic bioluminescent proteins derived from jellyfish.
Join the Buckminster Fuller Challenge
Koert van MensvoortPick up your $100,000 to materialize your revolutionary vision. This is not a spam message.
Living Among Pests – Designing the Biosynthetic City
Joyce HwangJoyce Hwang discusses the challenges for designers, and gains for citizens, of living in a truly biosynthetic city.
Making Fake Eggs to Beat the Real Thing
Allison GuyTech experts are betting that they can make vegetarian eggs that outperform the real thing.
Modifying Milk and Glowing Livestock
Emilija MarinkovicGenetically modified glowing sheep make it harder to count sheep at night.
Moments in Meat History Part III- Preservation
Jonathon MarkowskiThe oldest evidence of cold food storage dates back to 1700 BCE.
New in Store: Volume Magazine
NextNature.netNew in our store: Two very next natural issues of Volume Magazine.
Next Nature Interview on London Real
NextNature.netLondon Real interviewed Koert Van Mensvoort on the concept of Next Nature and its implications on our planet.
Next Nature TEDx Talk in Budapest
NextNature.netIndulge in the Next Nature stump speech at TEDx from Dr. Van Mensvoort
Our Electronics, 100 Years Later
Alessia AndreottiAn artist envisions our consumer electronics in a century, moss-covered and half-decayed.
Plastic makes the world go round
Rolf CoppensCockroaches will inherit the world after humans are gone? Maybe not. Seeing plastic as the new moss, or algae, photographer Jeanny Kaethoven makes this beautiful pictures of …
Protocell Shoe Mends Itself
Rachel ArmstrongThe self-repairing sole is a dynamic solution to an everyday problem.
"Responsive Typography" Tracks Your Location to Automatically Resize Text
Hendrik-Jan GrievinkA new website changes the text's font size depending on your distance from the computer.
Robots Cooperate to Save Coral Reefs
Alessia AndreottiRobots use swarm intelligence to rebuild coral reefs.
Serious Gamers Assist Society
Martijn PeetersNew citizen science games are bringing gamification to serious issues.
Swallow a Pill to Turn Your Body into a Living Password
Jonathon MarkowskiNeed a password that you'll never forget and can never be stolen? Try storing it in a pill in your gut.
Swans Float through Flooded Streets
Allison GuyA raft of swans blithely adopts an artificial habitat.
The 10th Anniversary of the World's First Lab-Grown Steak
Allison GuyMany people don't know that growing and cooking in vitro meat is a decade old.
The Brain Is as Complex as All the World's Digital Data
Alessia AndreottiWith advances in genomics, imaging and other technology,scientists have to face the age of big data.
The First Recorded Attack on a Cyborg
Stefan FinckenLooking back on the first recorded attack on a human cyborg.
The Hedonometer Uses Social Media to Measure Global Happiness
Orfeas LyrasScientists are using Twitter, blogs, and news sites to categorize the global psyche.
The Smart Desk: Exercise While Working
Alessia AndreottiA "breathing" desk that reminds you to change positions throughout the day.
Treating Mental Illness with Video Games
Ken ChenNeurofeedback shows promises in treating a range of mental ailments.
Use a Touchscreen Without Touching it
Alessia AndreottiUltraHaptics is a system for creating haptic feedback in mid-air, offering new kind of interactions with our touchscreens.
What You Feel Is What You Get - Smartphone for the Blind
Shikha SacharA revolutionary new smartphone for the blind uses a completely tactile interface.
With "Stealth Wear", Hide from Unmanned Drones in Style
Daniel van PaesschenTired your ugly duds? Sick of surveillance drones? Does Adam Harvey have the clothing for you!
Yes Naturally: How Art Saves the World
Allison GuyA new book explores who (or what) gets to define what is "natural".
50 Years Ago Asimov Predicted WiFi, Smartphones and Today's World Features
Alessia AndreottiIsaac Asimov predicts in 1964 what the world will look like today, in 2014.
A Jewel That Stops You From Checking Your Phone
Rolf CoppensFor every smartphone user to recognize, is that merely the lighting of your screen, a vibration or ring distracts you from almost every activity. Even when you are spending time …
A Registered Landscape
Lotte BiesheuvelTuscany is known for its natural beauty. But only a few know that this wonderful landscape is actually a really good design work.
Anthropocene Exhibition
NextNature.netNext Nature Network will take part in the Deutsches Museum exhibit "Welcome to the Anthropocene: The Earth in Our Hands".
Anti-Drone Tent
Koert van MensvoortAnti Drone Tent is a small construction of emergency blankets that blocks infrared sensing, making it invisible to drones.
Balloon-Powered Internet For Everyone
Alessia AndreottiProject Loon by Google has the mission of providing Internet access to rural and remote areas, with a hot air balloon network.
BAT Flies High in the Sky to Make Energy
Francesca BarchiesiBuoyant Airborne Turbine is a giant high altitude wind turbine that brings low cost energy to remote areas and off-grid sites.
Binary Code Able to Act Like DNA
Alessia AndreottiThere is a similarity between strings of binary and strands of organic DNA: they both carry actionable information encoded into reconfigurable symbols. Using nature’s biodiversity …
Bionic Hand with Real Sense of Touch
Mateja VidakovicLifeHand 2: a prosthetic hand that infers the ability to feel rudimentary shapes and forms by touch.
Bionic Plants
Alessia AndreottiScientists designed a way to improve the efficiency of plants light harvesting during the photosynthesis, using nanotechnology.
Blaming Car Technology for Dumb Drivers
Alessia AndreottiCars increasingly rely on technology designed to make driving easier and safer. But are these improvements creating less-skilled drivers?
Cosmos Tourism
Alessia AndreottiThe World View Experience offers an expensive journey to the edge of space.
Digital Native
NextNature.netDigital natives have trouble understanding life before 24/7 online connectivity.
Divine Nature
Alessia AndreottiPhotographer Holly Wilmeth seeks to capture the encounter between women and nature, symbolized into animal form.
DIY Wire Networks In India
Robin BergmanIndian fragile DIY electronic infrastructure gives an insight into our complex electronic wire systems.
Electronic Make Up
Koert van MensvoortIf this technique become widely accessible it could allow you to regain anonymity in webcam and facetime conversations.
Exploring the City Soundscape
Alessia AndreottiBuq are electronic life forms that shift the experience of the street scape from the primarily visual to a more auditory experience.
First 3D-printed Skull implanted
Julia WeberFirst 3D-printed skull has been implanted on a 22 years old dutch women.
First Completely Artificial Heart Transplant
Alessia AndreottiWorld's first self-regulating artificial heart transplanted in France.
Growing the Future of Meat
Christina AgapakisOutside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.
In Vitro Celebrity Meat, for Real this Time?
Allison GuyA company is working on culturing celebrity stem cells for cannibal cuisine.
In Vitro Recipe #6: 3D Printed Marrowbone
NextNature.netLab-grown marrow bones lend meaty notes to vegetarian soups, and taste delicious when roasted and spread on toast – no stone bludgeon required.
Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food
Alessia AndreottiFood and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.
Learning Circuits While Playing With Clay
Robin BergmanKids learn the basics of electric circuits while playing with clay.
Let the Drones take care of the Biosphere
Koert van MensvoortDrones are typically thought of as flying spying robots, or even worse flying spying shooting robots. But could we also employ drones for good? The people of …
Listening to Wi-Fi
NextNature.netModern technologies give deaf people the ability to hear again, not only regular sounds but also the invisible Wi-Fi signals.
Living in the Forest in the 21st Century
Alessia AndreottiPortraits of people who live alone in the forest.
Lonely Sculpture Your Next Tinder Match?
Koert van MensvoortTinder users beware: somewhere out there a mechanical finger is surfing the popular dating smartphone app. This could be your next match.
My Device is in the Sky
Koert van MensvoortTruly advanced technology will be light as sunshine and indistinguishable from nature.
Nature Learned to Turn Plastic into Rocks
Alessia AndreottiPlastic can fuse with rocks to form a new material: plastiglomerate.
Need to Unplug? There is an App for that
Koert van MensvoortAt times it seems we serve our technology as much as it serves us. The OFFTIME App wants to save us from our own devices.
Now Wait, Did Tanks Have Lasers WWII?
Koert van MensvoortRealistic WOII movie Fury had to cater to the gaming generation with hyperrealistic Star Wars style laser shooting tanks.
Printing with Grass
Alessia AndreottiThis 3D Grass Printer can print a garden in any shape you can imagine
Razorius Gilletus Flexball Subspecies
Koert van MensvoortThe latest subspecies in the Razorius line is the Razorius Gilletus Flexball. While Gillete proclaims they reinvented shaving, others argue Gillette's new razor is everything that's wrong with America.
Razorius Gilletus Gold Plastic
Koert van MensvoortLike the exorbitant feathers of the peacock, which only function is to aesthetically stand out amid its competitors, this new species of Razorius Gilletus only differs from its predecessor aesthetically.
Robotic Easter Egg Decorator
Alessia AndreottiA robot that applies computer controlled motion to precisely decorate your Easter eggs.
Show Dem Guts
Hendrik-Jan GrievinkSexy girls and organ meat was never a good combination to me, but the people from Black Milk Clothing that created this swimsuit seem to think it makes a pretty nice product. Am …
Smart Tags Change Color as Food Spoils
Alessia AndreottiSmart Tags stick to containers of food and change color when something has expired.
Spend Eternity As An Artificial Coral Reef
Alessia AndreottiAfter death you could have your ashes made into a rock to form the base of an “eternal memorial reef” .
Super Computer Chips
Robin BergmanIndium gallium arsenide couldbe the material of the new super computer chips of the future.
Technology Costs Evolution
Alessia AndreottiProducing an iPhone in 1991 would have cost 3,56 million of dollars.
Technology Reflexology
Hendrik-Jan GrievinkPeople have complex relationships with their own (and other’s) bodies. In Traditional Chinese Medicine (TCM), it is believed that your feet are a map of your body and can provide …
The Bionic Kangaroo
Alessia AndreottiThe BionicKangaroo technologically reproducesthe unique way a kangaroo moves.
The Earth As You've Never Seen It Before
Alessia AndreottiBreathtaking satellite images that will change how you see the World.
The First 3D Printed Canal House
Francesca BarchiesiThe first 3D printed house is a recognisable and attractive Dutch Canal House, an exhibition and building site in the heart of Amsterdam.
The Flying Car
Alessia AndreottiFrom automobile to airplane: the flying car is built to travel as easily on the road as in the sky.
The Ideal Phone Might Be The noPhone
Rolf CoppensYour next phone could be the noPhone: a technology-free alternative to any smart mobile device.
The Robotic 3D Printed Spider Dress
Alessia AndreottiThe Spider Dress is programmed to define and protect the personal space of the wearer.
Three Points in Support of In Vitro Meat
Alessia AndreottiThe top three aspects why people should support cultured meat.
Touching your Unborn Child
Marco van BeersThanks to 3D Babies and a mere $600,- you can now experience that excitement of holding your baby in your hands before he or she is born.
Urban Green
Alessia AndreottiThese pictures by photographer Jacob Gesink show how the urban green is carefully manufactured.
Using Wood to Purify Water
Lotte BiesheuvelResearchers at the MIT institute recently discovered an amazing low-tech way to filter water.
Veggie Burger That Bleeds Like Real Meat
Alessia AndreottiProf. Patrick Brown developed a meatless burger that look and taste like meat, made out of plant ingredients.
Virtual Reality Headset for Chickens
Alessia AndreottiA virtual reality headset could give chickens the freedom to roam without the roaming.
Wearable Antenna for Health Monitoring
Julia WeberWearable multifunctional antenna made of silver nano wires to monitor recovering people.
Weaving a Home
Alessia AndreottiA lightweight and mobile structural fabric based on ancient traditions of weaving fibers.
What Bits Want
Kevin KellyDigital bits have lives. They work for us, but we totally ignore them. What do bits really want? Here are the life stories of four different bits.
What Is This Strange Device?
Alessia AndreottiKids try to figure out what the "prehistoric" Walkman is and how it works.
What Will Life Be Like Inside A Computer?
John MesserlyMany scientists believe that we will soon be able to preserve our consciousness indefinitely. This could be done by copying and transferring these contents into a computer, or by piecemeal replacement with parts of the brain gradually replaced by hardware.
3D Holography: the Future of Medicine
Yunus Emre DuyarA new technology aims to provide doctors with a true hologram of organs.
3D Printed Eyes with WiFi Connection
Alessia AndreottiItalian research studio is working on EYE: a 3D bioprinted sight augmentation.
A Pop-Up Forest in Times Square
Yunus Emre DuyarA new Kickstarter project aims to bring the forest into Times Square.
Ambient City
Koert van MensvoortHow cities will function when there are more robots than people working in factories, everything is intelligently interlinked, autos drive autonomously and drones deliver the mail?
Analogue vs Digital: Never Lost with GPS
NextNature.netBefore global positioning systems, we all used maps. And they could be very annoying.
Analogue vs Digital: Phoning
NextNature.netRemember these? If you are a digital native there is a chance you never noticed one of them.
Analogue vs Digital: Self-Driving Cars
NextNature.netThe image on the left is a car, as we know them. It has a lot of digital technology in it already, but not nearly as much as the other one.
Analogue vs Digital: Still Antisocial
NextNature.netSome modern thinkers argue that new technology is making us antisocial.
Artificial Intelligence Able to Create Music
Tijs DuelEmily Howell is an interactive interface able to compose and perform her own pieces of music.
Bionic Ants That Work Together
Louise HuyghebaertThese robotic ants by Festo are learning to work together, like real ants do.
Bistro In Vitro to Be Launched
NextNature.netInspired by the award winning In Vitro Meat Cookbook , Next Nature Network and Submarine Channel present Bistro In Vitro : an online design fiction documentary about the future …
Communicating with City Infrastructures
Yunus Emre DuyarA recent project, named GENESI, might make it possible for city infrastructures to communicate with us.
Computer Generated… Errrmm?
Hendrik-Jan GrievinkThis image, generated by a computer, portrays a representation of what seems to be some kind of squirrel-meets-sea-lion-meets-slug-type of creature.
Controlling the Weather with Drones
Hessel HoogerhuisThe Federal Aviation Administration (FAA) picked six test sites throughout the US to experiment with drone-based cloud seeding.
Converting Gestures into Concrete Action
Yunus Emre DuyarFrancesca Barchiesi's glove concept allows the user to translate hand gestures into images and information.
Cybernetic Bugs
Alessia AndreottiBeetles, dragonflies, butterflies and bugs made from recycled deconstructed computers, smartphones and consoles.
Drone Maps Christ the Redeemer
Yunus Emre DuyarThe current technology has not been able to replicate Christ the Redeemer perfectly, until now.
Ever-Changing Sceneries with Microbots
Yunus Emre DuyarKirsten Zirngibl's illustrations depict imaginary landscapes that are formed by microbots.
Facebook's Internet Drone Unveiled
Yunus Emre DuyarFacebook introduced its solar-powered drone project aimed to provide internet access to rural areas.
Fast Food = Lower Test Scores
Alessia AndreottiThe amount of fast food children eat may be linked to how well they do in school, a study suggests.
Feeding the World with Insects
Abby QinShould we make a next step in what we serve at the table? What about insects? Would you give them a try?
First Bionic Rose with Electronic Circuits
Margherita OlivoFor the first time, researchers at the University of Linkoping , Sweden, have succeeded in establishing organic circuits within living plants. They combined electronics with the …
First Entirely Transparent Solar Panel Could Transform our Cities
Margherita OlivoOur constant need of new, cleaner energy led a Michigan State University research group to conceive a fully transparent solar panel that could replace ordinary windows.
First Puppies Born by In Vitro Fertilization
Margherita OlivoThanks to the work of researchers at Cornell University (USA), for the first time a litter of puppies was born entirely from in vitro fertilization.
Genetic Modification Could Prevent TB
Yunus Emre DuyarIt was announced this week that genetic modification allowed scientists to produce cattle resistant to tuberculosis.
Googles Natural Tracking Technology
Koert van MensvoortWe may soon all be making natural gestures to interact with our digital devices.
Heart Tissue Grown with Spider Silk
Yunus Emre DuyarIt might be possible to grow a new heart in labs using spider silk.
Hyperform: the Future of 3D Printing
Louise Huyghebaert"However, while 3D printers are becoming increasingly accessible and capable of rivalling the quality of professional equipment, they are still inherently limited by a small print …
The Ice Cream That Doesn't Melt
Margherita OlivoResearchers discovered a protein that can be used to produce the first ice cream that melts more slowly that the normal products on the market today.
Intelligent Bikini Tells You How to Tan
Alessia AndreottiThink you've had enough sun? Ask your bikini!
Intimate Technology Evening at Droog
NextNature.netDroog Foundation and Next Nature Network invites you to join the conversation about Intimate Technology: April 23, in Amsterdam.
Jewelry Harvests Energy from Veins
Yunus Emre DuyarNaomi Kizhner designed jewelry that can theoretically harvest energy from the body of the person wearing it.
Possibilities for Drones in Performing Arts
Alexandra BremersJapanese fashion brand Buyma created this video with a wink, wherein drones play a crucial role.
Let Strangers Cheer You up on Twitter
Yunus Emre DuyarThere is now a new application that allows random people to cheer you up on Twitter.
Mark Zuckerberg Discovers 'Books'
Koert van MensvoortBooks allow you to fully explore a topic and immerse yourself in a deeper way than most media today.
Meet the Hospital of the Future
Margherita OlivoWith its 656 beds, this hospital offers unconventional and leading computerized assistance for all sorts of patients.
Mini's Augmented Reality Driving Goggles
Yunus Emre DuyarThe popular car brand is working on augmented reality goggles that enhance the driving experience.
Modern Times Emergency Kit
Alexandra BremersIn these modern times a traditional first aid kit won't do anymore. As the world around us innovates, our needs in case of an emergency change as well.
MyWebwill Dead Before its Subscribers
Koert van MensvoortThe company MyWebwill helped you to manage your digital afterlife. Unfortunately for its subscribers the company itself has now deceased.
New Friends? Let Social Textiles Help You
Yunus Emre DuyarA group of students at the MIT Media Lab are working on an electronic textile that might help us interact with people more easily.
First Testings of Google's Project Loon Announced
Margherita OlivoGoogle plans to connect more than 100 million people in a cheap, new and sustainable way, in a territory where only one person on three has access to the Internet.
Next Nature Book Second Edition
NextNature.netAfter it sold out, the Next Nature book has been reprinted with a brand new cover.
Permanent Eye-Color Change
Alessia AndreottiA new laser surgery can permanently turn eyes from brown to blue.
Robot Swans Monitor Water Quality
Alessia AndreottiThe National University of Singapore released a group of robot swans in the Pandan Reservoir to swim around and keep an eye on water quality.
Seconds for Sale: Domestication of Time
Sander DijkhuisTime Ingot is a solid piece of lead alloy, its mass can slow down time in the immediate vicinity.
Self-Driving Cars Practice Kids Recognition
Alexandra BremersThis year's Halloween, Google asked children from the neighborhood to come by in their spooky outfits and play around the self-driving cars.
Sharing Your Newborn's Heartbeat
Yunus Emre DuyarThese parents use the Apple Watch to share their newborn child's heartbeats with friends and family.
Solar Eclipse May Impact Power Supply Due to Increased Use of Solar Panels
Koert van MensvoortSolar eclipse may impact power supply due to increased use of solar panels
Speculative Sensing at WDCD 2015
NextNature.netOn may 21st, Next Nature Network art director Hendrik-Jan Grievink will host a workshop around the idea of Speculative Sensing: exploring the potential of senses found in nature …
Bacteria and Drones: New Ways to Collect Samples
Erik van der VeenWhile a hipster-drink bacteria are hunting space organisms, robots are catching whale snot in the open ocean.
The Drone Circus
Alessia AndreottiThe first ever circus consisting entirely of drones is coming to Amsterdam. This fall the Amsterdam Arena will host a choreographed airshow using nothing but drones combined with …
The World’s Largest Indoor Farm
Alessia AndreottiThe world’s largest indoor farm in Japan is 100 times more productive than traditional agriculture.
Talkable Vegetables
Wei Lun WangBreaking the silence, vegetables in a Japanese supermarket start to talk to the customers.
Solutions to Virtual Reality's Big Problem
Erik van der VeenIf you experience virtual reality sickness, here some solutions for you.
Wasps Inspire Robotic Needle for Surgery
Daniel FragaThe Wood-Boring Wasp inspired scientists to create a new robotic needle which will be used in brain surgery.
Wearable Device For Tomato Lovers
Louise HuyghebaertThe Wearable Tomato Project consists in a robot that dispenses tomatoes.
Let the WiFi Angels app soundtrack your holidays!
NextNature.nethe WiFi Angels app lets you sense electromagnetic radiations by turning the WiFi networks around you into a celestial choir.
Wireless Controlled Mouse, the Animal!
Alessia AndreottiA remote-controlled LED chip can make a mouse walk in circles.
72h Offline Challenge for Teenagers
Monika KozubAround 100 Polish teenagers aged between 12 and 18 agreed to withstand 72 hours totally offline: no phone, no computer, no TV. What were the results?
The Advent of Connected Toys
Margherita OlivoIt is the era of smart toys, but they certainly raise difficult questions for parents.
The First Beauty Contest Judged by AI
Ruben BaartThe first beauty contest judged by complex algorithms has sparked controversy after biased results.
Begging Ghetto Blasters Hack the System
Ingmar NieuweboerBegging ghetto blasters in Utrecht are making you question poverty.
Breaking Language Barriers
Margherita OlivoWe have witnessed significant progresses in the field of real-time translation, and this new wearable translator, called ili, sums up perfectly this essence.
Cars Are Ready to Recognize Us
Alejandro AlvarezWe already recognize faces in our cars, now it is time for our cars to recognize our faces.
Colorless coral: How climate change is affecting the great barrier reef
Jack CaulfieldOur peculiar image of the week comes from the Great Barrier Reef. You've probably seen images of this vibrant underwater attraction before. If you're lucky, maybe you've seen it …
Coming Soon: Video Face Hacking for All
Alejandro Alvarezteam of computer scientists at the universities of Germany and California has created what they call photoshoping videos in real time.
A Cryptocurrency Helping to Cure Cancer
Lewis JustPart two of a ten part series exploring the design of an invisible technology: money.
The Danger of a Plastic Sea
Margherita OlivoBy 2050 plastic waste will outnumber the number of fish in the sea. These Surfers are taking action and raising awareness.
"Death School" to Learn Love Life Again
Monika KozubAt Hyowon Healing Centre in Seoul you can experience the emotional cost of a suicide during "Death School" classes.
Banana by Design
Koert van MensvoortIf you compare the supermarket banana with the original wild banana the differences in size, look and taste are striking.
The Digital Life Project
Alejandro AlvarezResearchers are creating accurate 3D models of living organisms to preserve the heritage of life on Earth.
Disney-Themed Prosthetics for Children
Ruben BaartOpen Bionics is helping children in need for bionic hands. With Iron Man, Frozen, or Star Wars-themed prosthetics, their fantasies become reality.
Drones in Agriculture
Megan Ray NicholsHere's a look at how drones can and will impact the agriculture and farming industry.
Earth Next to the Sun Makes Us Modest
Koert van MensvoortThe realization that the volume of the Earth would fit over a million times in the volume of the Sun kind of makes you modest. No, we are not the Masters of the Universe.
Fake-for-Real: Who Is Lil Miquela?
Ruben BaartThis Instagram model makes her fans wondering whether she is fake or real.
Safe Driving Rewarded with Free Coffee
Ruben BaartAs part of a new traffic safety initiative, a car manufacturer, a telecommunications operator, and a coffee chain have joined forces to develop a new app designed to promote safer driving.
Future of Food: Eating From the Ditch
Mathilde NakkenFor years scientist and farmers are researching the possibilities of eating duckweed, shoveling it out of the ditches onto our plates. This proteinrich plants can be used in animal fodders or be eaten by humans.
Getting Wasted on Plastics
Lewis JustA new community currency that rewards recyclers with local discounts and deals.
Goodbye Password, Hello Selfie!
Margherita OlivoCompanies try a new, more secure payment system using selfies.
Greetings from Mars
Monika KozubSince plans for conquering the Red Planet are becoming more serious we should get acquainted with the possible view from up there.
Growing Drones From Chemicals
Ruben BaartResearchers are experimenting with a new technology that would be able to grow drones from chemical compounds.
Body hair helps animals stay clean – and could inspire self-cleaning technologies
David HuWatch a fly land on the kitchen table, and the first thing it does is clean itself, very, very carefully. Although we can’t see it, the animal’s surface is covered with dust, …
Hyperloop Set to Change Mass Transit
Megan Ray NicholsThe Hyperloop is a future transportation means that is safer, faster, and cheaper than current forms of mass transit.
Iconic Buildings in Untouched Lands
Margherita OlivoAnton Repponen's project places iconic NY buildings in organic, untouched environments to put them in the spotlight.
Designer Govert Flint applies motion to everyday life
Ingmar NieuweboerInterview with Govert Flint, designer, architect and self-taught artist.
Let's Talk About Virtue Signalling
Daniel FragaWith virtue signalling, the joys of moral superiority are just one click away!
Meet the Buddy Drone
NextNature.netMeet the Buddy Drone: it protects your from danger and helps you with everyday tasks, but most of all it's a friend for life!
Turning Contact Lenses into Screens
Margherita OlivoA polymer film coating can turn contact lenses into computer screens.
Meet the Farmer Drone
NextNature.netThe Farmer Drone is a hardworking drone that ploughs land, grows crops and milks the cows, all on the same day.
Meet the Queen Bee Drone
NextNature.netThe Queen Bee Drone helps solving the bee crisis of the last decade, not intruding, just bringing help and assistance.
Meet the Vaccinator Drone
NextNature.netThe Vaccinator Drone will provide you with the medicine you need.
Meet the Weather Drone
NextNature.netThe Weather Drone controls the weather, it makes sure the sun will shine on your birthday, or that the rain will fall during a period of drought.
Meet the WiFi Drone
NextNature.netThis is the WiFi drone, a useful companion that perfectly blend into our environment while providing us with information and connectivity.
Morality of an Autonomous Car
Monika KozubWhen an autonomous car has to make a decision, will self-interest or the public good predominate?
VR Days Europe: Next Nature Habitat
Monika KozubNext Nature Habitat premiered at VR Days Europe in Amsterdam last weekend.
There Are More People Flying in Airplanes right Now, than there were Alive on Earth in the Stone Age
Koert van MensvoortToday there are on average there are some 8000 planes in the sky carrying at least half a million people. On average during the Stone Age there must have been less.
More People Are Too Fat Than Too Thin
Ingmar NieuweboerFor the first time in history the world population counts more people who are too fat than too thin.
Using Nanobots to Treat Depression
Alejandro AlvarezA team of scientists has developed a way to deliver drugs into our body using nanobots as vehicles and our toughts as controllers.
Preventing Data Leaks with Smell
Ruben BaartThe Smell of Data alerts Internet users in any case of data leakage and communicates digital hazards by means of smell.
Bionic Prosthetic Arm with Personal Drone
Ingmar NieuweboerWhy would you stick to an elbow, a wrist and five fingers if you could make anything? This guy got a game-inspired bionic arm.
New Diets for Cows Can Stop Gas Emissions
Mathilde NakkenYearly 90 million metric tonnes of methane are burped and farted into the atmosphere by cattle with effects on climate change. Researchers are looking for ways to change the cow's diet, feeding it oregano, seaweed and super grass.
Rainforests Regrowth Boosts CO2 Capture
Margherita OlivoNewly grown rainforests can absorb 11 times as much carbon from the atmosphere as old-growth forests, a study has shown.
How Rare Is Virtual Gold?
Lewis JustPart one of a ten part series exploring the design of an invisible technology: money.
Re-introducing Extinct Species
Margherita OlivoExtinct European bisons are being reintroduced in parks. But what makes a national park?
Reversing Evolution with a Legless Mouse
Mathilde NakkenAt a lab in Berkeley, California, there’s a mouse with no legs. Its head, torso, and tail are normal. It just lacks limbs. It didn’t lose those limbs; it just never grew them originally.
Robot Breaks Rubik's Cube World Record
Alessia AndreottiWatch this robot solving the Rubik's Cube in 1.047 second.
This Robot will Grow Food in Your Backyard
Koert van MensvoortFarmBot Genesis is humanity's first open-source CNC farming machine designed for at-home automated food production.
This Robotic Stingray is Alive
Ruben BaartBy way of reverse engineering and taking heart cells from a rat, researchers at Harvard University have designed a miniature robotic stingray that is alive.
Self-Driving Cars Are Here to Stay
Megan Ray NicholsThe first time you switch on your self-driving car, punch in your coordinates and cruise off to the soulless thrum of an electric motor you’ve got to wonder: does this thing know what it’s doing?
Setting Aside Half the Earth for Nature
Ingmar NieuweboerE.O. Wilson, a respected biologist, has proposed a radical idea: set aside half of the planet as nature preserves.
Solar-Powered Donkeys to Stay Online
Margherita OlivoTurkish shepherds are installing solar panels on their donkeys to stay connected.
A System that Predicts Crime
Ingmar NieuweboerAn experiment tries to prevent crime by identifying aggressive behavior with new surveillance technology before actual violence is used.
Your Teaching Assistant Is a Robot
Margherita OlivoJill Watson has been performing as teaching assistant for 5 months, but she is not a real person, and students didn't notice.
Rio 2016: the Olympic (Green) Abyss
Ruben BaartLast week the Olympic women’s diving pool at the Maria Lenk Aquatics Centre mysteriously turned swampy green overnight.
The Wordless Language
Margherita OlivoEmoji are taking our communication to a faster, simpler level.
Time Is a Universal Currency
Lewis JustThe principle behind a time based currency is usually very simple: one hour of work equals a unit of time.
Our Tribal Genes Affect Politics
Alejandro AlvarezWhat if the cause of our politic choice was in our evolution, hidden deep in our genes and digging up our tribal instincts?
Turning Leaves into Batteries
Margherita OlivoOther than decompose and give nutrition to the soil, leaves can be used to store energy, becoming the raw material of batteries.
A Robotic Suit to Update Your Granny
Mathilde NakkenThe elderly may toss their walkers for this robotic suit.
Men Pregnancy: Reality or Science-fiction?
Margherita OlivoThe first uterus transplant in the United States raises the question: could uterus transplants allow men to get pregnant too?
A Village Made of Plastic
Daniel FragaA canadian entrepreneur is trying to help reduce plastic pollution by building a village made out of plastic in Panama.
VR Surgery and Live Stream Operations
Mathilde NakkenThere is a new breakthrough coming from the operating room: an app, called MDLinking, that connects 8.5 million doctors world wide.
Walk, Talk and Get Paid
Monika KozubAs the digital age makes people more lonely, Chuck McCarthy created a service to walk with strangers.
Web Training Collar
Ruben BaartJasper van Loenen developed a wearable that sends a corrective electrostatic shock to its wearer when visiting an unprotected website.
What Is the Selfie Elbow?
Ruben BaartThe advent of digital communications media is bringing along some health conditions.
1978 - World’s First ‘Test Tube Baby’ Born
Elle Zhan WeiIn 1978, the world's first test-tube baby was born, her name is Louise Brown.
1996 - First Artificial Womb Experimented
Elle Zhan WeiIn 1996, Yoshinori Kuwabara at Juntendo University in Tokyo incubated a premature goat fetus by using extrauterine fetal incubation.
3D Print Your Pizza in Six Minutes
Ruben BaartMeet the commercial 3D pizza printer that takes your order via a smartphone app.
AI Draws New Worlds from Its Artificial Memory
Siebren de VosAn AI draws streets and spaces stitching together its artificial memories of real places.
AI & VR Impact on Architects and Engineers
Megan Ray NicholsFuture workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.
Animal Guided Mediation
Elle Zhan WeiAnimal Meditation uses meditation guiding sounds to to enable user to feel as if he is an animal.
Animal Tsunami Alerts from Space
Alejandro AlvarezGlobal data about animal movements are indispensable in our today international networked world to understand how to safe human health and wildlife simultaneously.
What You Should Know About Artificial Intelligence Changing Jobs
Megan Ray NicholsIt should come as no surprise that artificial intelligence naturally extends into the way we work. Let's look at how AI changes the way we relate to work.
Become an Emoji Translator
Ruben BaartEmoji translator wanted! London firm is looking for an emoji translator, take the test to find out if you're good enough.
Bionic Leaf Helps Vegetables to Grow
Julie ReindlBionic leaf fertilizes crops to make them weigh 150 percent more
Boat Noise Makes Fish Bad Parents
Julie ReindlA study revealed that the sound of motorboat engines disturbs coral reef fish so acutely it changes their behavior, making them bad parents.
Antarctica Is Turning Green
Ruben BaartRising temperatures have boosted the growth rates of seasonal mosses on Antarctica, turning the continent green.
Cruising Critters Travel the Ocean on Plastic
Charlotte KuijpersTons of living animals have floated from Japan to the United States traveling across the ocean on plastic junk and debris.
Teaching Crows to Clean Up Cigarette Butts
Jack CaulfieldCigarette butts are littered everywhere. But now, two Dutch designers have come up with a unique solution to the problem: the Crowbar.
Cyborg Dragonfly for Special Service
Ruben BaartA Biomedical solutions company is developing a system for insects to wear, allowing engineers to steer it remotely.
Designer babies: the kids of the future?
Megan Ray NicholsWhat if you had the choice of sparing your child from diseases and disorders such as Alzheimer’s disease, heart disease or autism?
Drone Hits Crash Test Dummy for Your Safety
Ruben BaartResearchers at Virginia Tech are studying the risk of injury from a drone collision by hitting a crash test dummy in the head.
ECO Coin Award Interviews: Ritsert Mans
Jack CaulfieldWe asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.
ECO Coin Award Interviews: Sandra Rey
Jack CaulfieldWe asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.
Experience Death with VR
Julie ReindlVirtual reality experiment tries to help people frightened of death with outer-body experience.
A Fake City for Real Self-Driving Cars
Siebren de VosUber built a fake city called Almono to train self-driving cars. This town is full of fake houses, mannequins and chaotic intersections.
Sustainable Flying with Electric Planes
Elle Zhan WeiGerman company revealed fastest electric plane.
How to Fool a Neural Network
Jack CaulfieldA neural network helps computers with image recognition. It is usually tough to fool. But one group of researchers has found a way to reliably trick it.
Fungal Futures: the Mushrooms Utopia
Federico AndreottiExhibition Fungal Futures: design with mushrooms.
Greenhouse for Space Colonies
Elle Zhan WeiResearchers from Arizona and NASA unveiled a plan to sustainably provide food in space, growing it in an inflatable greenhouse.
Next Nature Habitat VR Wins Sweden VR Award
NextNature.netOur Next Nature Habitat VR experience has won the Sweden International Virtual Reality Award in the category Best 360 Video!
Helix, the App Store for Your Genome
Charlotte KuijpersStartup Helix launched an online hub where you can digitally explore your genetic code by downloading different apps on your computer or smartphone.
After Horsepower Comes Robotpower?
Jack CaulfieldWe fear being replaced by robots. They have the potential to be smarter, stronger and more hardworking than us, but so do horses.
HUBOT: Meet the Home Healthcare Professional
NextNature.netThe home healthcare professional is one of the 16 positions from HUBOT, the job agency for people and robots.
HUBOT: Meet the Air Traffic Security Worker
NextNature.netAs air traffic security you make sure that birds stay away from the airport using your eagle drone. With an accessory console, you fly the quadcopter from the sideline to scare …
Internship at Next Nature Network
NextNature.netTo all students! It's that time of the year again. We have six wonderful intern positions opening up in February 2018. Six! From editorial talent to design heroes to marketing …
Intimate Technology S01E01: All My Clothes
NextNature.netThis movie titled "All My Clothes" reminds us of a more straightforward example of intimate technology: the clothes we wear every day.
Intimate Technology S01E02: Misbehaving (Ro)bots
NextNature.net"Misbehaving (Ro)bots" asks whether technology could hope to replicate these small bothersome quirks that instill a feeling of intimacy.
Intimate Technology Series on NNN
NextNature.netWe called upon artists, filmmakers and film enthusiasts around the world to create a one-minute videos for the intimate technology series.
Kangaroos Confuse Self-Driving Cars
Julie ReindlVolvo's driverless car system has trouble recognizing kangaroos because it gets confused by the hopping of the marsupial.
Lazy Worker Ants
Charlotte KuijpersA study reveals that about 40% of "worker" ants spend most of their days doing nothing, but those lazy ants make themselves useful in unexpected ways.
Space Television Network
Julie ReindlSen is a space television network that provides visuals from other planets in order to prepare us for our multi-planetary life.
iPhones Are Happy to See Us
Jack CaulfieldWhat if you could unlock your phone by simply looking at the camera? According to Apple, this is precisely how the iPhone X will work. But how secure is it?
Do a Next Nature Workshop!
NextNature.netNNN organizes workshops using a physical Pyramid of Technology as conceptual tool.
NNN Is Hiring: Managing Director
NextNature.netNNN is looking for a Managing Director to join our office in Amsterdam.
One Minute on the Internet
Ruben BaartWith the rise of modernity, we have domesticated ourselves with new technology: discover how the world spends one minute on the Internet.
Call for Videos: Intimate Technology
NextNature.netNext Nature Network is curating the One Minutes series for September 2017.
Pink GM Chicken Marks Anthropocene
Julie ReindlThe Pink Chicken Project suggests modifying chickens’ DNA in order to send a message about our Earth health.
Plants + Science = Meat!
Daniel FragaWhat if you could have the taste of a juicy, sizzling burger without the destructive impact of using animals for meat? That is what Impossible Foods wants to do with its new burger.
Plastic Exoskeletons for Turtles
Nadine RoestenburgAntonio Esparza designed the TurtleBag: a 3D printable exoskeleton to help turtles distinguish plastic bags from jellyfish and extend their lifespan.
Want Plastic with Your Salt?
Koert van MensvoortA recent study examining the purity of 17 commercial sea salt brands from eight different countries found microplastics in all 17 samples.
Plastic Beach
Alejandro AlvarezWhile this image seems like another polluted beach after spring break, it was taken on a remote uninhabited world heritage site in the Polynesia.
Print Your House in a Day!
Julie ReindlA Russian construction firm prints houses in 24 hours on site with their mobile 3D printer.
Read the Entire Artificial Womb Series
NextNature.netWe published a timeline series to explore medical, cultural and technological developments in relation to the ectogenesis concept.
Robot Librarians Instruct Young Generations
Ruben BaartThe Dutch province Gelderland-South uses two educational robots to increase kids' knowledge on such a technology.
FarmVille Turns into Real-Life Agriculture
Julie ReindlA Japanese Start up brings Farmville back into real life by letting players grow physical food.
Your First AI Friend for Life
Elle Zhan WeiReplika is your friend for life. He is 100% AI chatbot that you “raise” by chatting with it.
Robo-Bee Pollinated a Japanese Lily
Nadine RoestenburgA video of a robotic bee pollinating a flower (looking more like Loopin' Louie spinning off the board game and hitting a flower) recently caught our attention. What at first sight …
Dubai Employs First Robotic Police Officer
Julie ReindlThe first robotic officer will soon report for duty in Dubai.
Robotic Pillow Breathes to Help You Sleep
Charlotte KuijpersA smart, huggable bed partner, who also improves your sleep quality. Sounds great, right? Soon, you might be able to order one yourself: Somnox is a soft robotic pillow that gently breathes as you hold it.
Rothko in Salts
Alec SchellinxThe multiplication of bacteria "paints" this lake with peculiar colours. Tints vary along magenta, green and yellow, giving it Rothko-like appearance.
GM Self-Destroying Moths
Julie ReindlOpen-air tests of self-destructing moths mark a new frontier for GMOs.
Selfie Time with Your Dead Beloved One
Julie ReindlForever by your side. Elrois a South Korean firm developed an app that allows you to engage with your dead friends lovers or idols.
Sexy Cyborg Sports Her Prosthetic Limb
Koert van MensvoortThe Brazilian model Paola Antonini uses her Instagram to show off her prosthetic limb.
Smartphones Will Soon Be a Thing of the Past
Megan Ray NicholsSmartphones have become almost a part of who we are. According to tech industry experts, however, the smartphone's days are numbered and that number is lower than you might expect.
Drones Are Coloring Your Summer
NextNature.netLooking for a summer book? Wherever your vacation takes you, our drones coloring book What’s Flying There? should be on your holiday packing list!
Chat with Plants in the Botanical Garden
Camille CharluetExploring methods to better connect people to the natural world, Waag Society, in collaboration with the Dutch Botanical Gardens Association, have developed an app that allows visitors to talk with plants.
Robotic Tarzan Controls Crops
Julie ReindlA robot inspired by a sloth was developed in order to control crops growing in our fields.
Your Smartphone Is Your New Eye Doctor
Ruben BaartThe EyeQue personal vision tracker is a smartphone app that allows you to test your eyes from the comfort of your couch.
Tinder for Orangutans
Ruben BaartThe Apenheul primate park in Apeldoorn, the Netherlands, has launched a four-year experiment to study how the primates make their mating choices.
A Virtual Counselor for Mental Health
Siebren de VosA Facebook chatbot that offers interactive cognitive behavioral therapy. It’s called Woebot and it's your personal virtual counselor.
Visit the Garden of Eden
NextNature.netDiscover the Next Nature Habitat VR and explore four future environments we might live in someday.
The Water-Cleaning Bike
Elle Zhan WeiHow about a peddling ride accompanied by the sound of babbling water, with the awareness that what you are leaving behind is nothing else but clean water?
World’s First Lab-Grown Chicken Is Here
Elle Zhan WeiMemphis Meats reveals world’s first lab-grown chicken.
Your Virtual Midwife Is Here
Charlotte KuijpersAn external device that helps you conceive, carry and raise a child. Too scary? Or extremely useful? It's up to you to decide, your virtual midwife is here!
AR City: Paving the Way for Augmented Reality Navigation
Belen MunozAugmented reality applications are a promising alternative to GPS. At least that is what Blippar’s AR City app claims to be.
Envisioning the future of artificial biological reproduction in Mexico
Hendrik-Jan GrievinkThe debate on the future of artificial biological reproduction is moving to Mexico. C Minds, an impact innovation agency that believes in ‘a 4th Industrial Revolution that brings …
Turning surplus bread into craft beer
Meike SchipperGlobally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
Ermi van Oers wants to bring living light to your living room
Jack CaulfieldThe Living Light harnesses plant energy to provide light. We spoke to its designer, Ermi van Oers, to find out more about the unique product.
HUBOT: Meet the Cybercrime Detective
NextNature.netAs a cybercrime detective, you search for suspicious patterns that indicate crime in the digital domain.
Interview: Huub Ehlhardt on the evolution of products
Kelly van Gemert"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …
Interview: Jeremy Bailenson on his latest book "Experience on Demand"
Katherine Oktober MatthewsVirtual reality has come a long way. Like most technological leaps, it’s had a huge push from the entertainment industry, but current applications span a wide range of social and …
Aleph Farms wants to bring clean meat from the lab to the next farming industry
Kelly van GemertGrowing meat artificially, instead of within an animal, may soon be an available reality. Meet one of the pioneering developers of this product of the future: Aleph Farms. With …
Scientists accidentally create mutant enzyme that eats plastic bottles
Damian CarringtonScientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …
A next natural landscape of bikes
Alec SchellinxIt was just little over a year ago that bike sharing schemes started to take off in China. Yet in the blink of an eye, millions of bikes painted in vivid colours, popped up in and …
Next Nature Gift Guide 2018
The season of giving has come and to make sure you can find the perfect gift for your loved ones we have brought together a collection of Next Nature inspired goodies. Whether you …
Researchers are developing a device that can edit brain activity
Tristan GreeneNeuroscientists at the University of California Berkely are building a device that’ll hack our brains so we can ‘edit’ what we feel and remember. It looks like we’ve drawn “ Total …
Robo Wunderkind is a modular robot even a five-year-old can program
Kelly van GemertMeet the Robo Wunderkind, a new breed of smart toys that introduces children to the basics of coding and robotics in a playful way. Advanced technologies are increasingly embedded …
Making Seawater into Clean Fuel
Jack CaulfieldScientists have been hard at work searching for renewable energy sources. Now, a new breakthrough: the ability to produce hydrogen fuel from seawater.
Skiing on Mars? It's possible!
Kelly van GemertFor those experiencing symptoms of motion sickness in VR , it’s now possible to step inside a real-life simulation of what it could be like to ski on mars. Last week, desert dust …
Space Tourism: Your next vacation destination might not be on Earth
Jack CaulfieldBack in the mid-twentieth century, before the first moon landing, people had all sorts of ideas about the golden age of space travel in front of them. Colonize the moon! Fly …
The New Technology in Agriculture: Trees
Jack CaulfieldNew technologies are changing the landscape, but the latest trend reshaping rural environments and agriculture is agroforestry: the art of planting trees.
'Thrillification' is thrill about getting notifications
TeyoshChecking for new notifications has become a habit that is hard to resist. For some users of social networks it is a kind of an impulse. When receiving and opening notifications, …
How an app is helping restaurants cut food waste
Meike SchipperGlobally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
3D-printing food waste into tasty products
Meike SchipperGlobally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
Here’s what manufacturing enhanced with virtual reality will look like
Megan Ray NicholsRobots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …
China's state news agency has unveiled a virtual newsreader
bryan clarkDon’t adjust your TV set, that’s just a new computer-generated news anchor working out the bugs. Xinhua, a Chinese state-run media company, and Sogou, a Beijing-based search …
Why you should attend ADE Green
Ruben BaartADE Green returns for the seventh consecutive year to the DeLaMar Theater in Amsterdam. Once more, Amsterdam Dance Event organizes this leading event to ignite sustainable action, …
How to bingewatch the Intimate Technology series
Next Nature DevTechnology is coming closer to us. In the form of decades old headphones or state-of-art devices. It has always been a part of our lives and this only seems to develop further: …
Why digital detoxes are a solution looking for a problem
David EllisWith New Year’s resolutions in full swing, many people may have chosen to cut down on their tech use – or even give it up altogether. The growing popularity of such “digital …
This exhibition confronts a planet in a state of emergency
Ruben BaartMeet the 'Eco-Visionaries' , these are the architects, artists and designers who respond to some of the most urgent ecological issues of our times. This exhibition reveals how …
The remaining numbers of endangered animal species shown in pixels
Ruben BaartToday is World Animal Day , a day to put the spotlight on man's best friends in order to improve their welfare standards around the globe. At Next Nature HQ, we honor this day by …
Why not all buildings have sustainable green roofs
Michael HardmanRooftops covered with grass, vegetable gardens and lush foliage are now a common sight in many cities around the world. More and more private companies and city authorities are …
How technology bridges the generational communication gap
Freya HutchingsEmoji, Skype, Selfies - can these communication technologies close the generation gap? In part, yes! Young people are teaching senior citizens how to use technology, and it’s …
The path towards solar democracy with Marjan van Aubel
Meike SchipperSolar cells are often considered an eyesore, used for their sustainability yet not for their beauty. Installed on roofs or in solar parks, they take up precious space. Well that’s …
Artificial bones for the natural meat experience
Ruben BaartThe world is developing, climate change is happening and it's time for us to do something. Now. One strategy would be to simply stop eating meat — or at least reduce the amount of …
Discover the art of the living at Centre Pompidou
Ruben BaartGo forward to nature at the La Fabrique du Vivant (the Factory of Life), the newly opened exhibition at the Centre Pompidou in Paris. Exhibiting the recent works of fifty …
These are the meltwater lakes of Antartica
Jennifer ArthurDuring the Antarctic summer, thousands of mesmerising blue lakes form around the edges of the continent’s ice sheet, as warmer temperatures cause snow and ice to melt and collect …
The Next Nature gift guide 2019
Next Nature DevWhether you're in need of a holiday gift for your techie spouse or tech-adverse grandpa, the truth is, your loved ones deserve better than a generic gift card. Now we understand …
Pack your bags: Next Nature is going to China
Next Nature DevTo our Chinese friends (and beyond)! From 2 November 2019 to 1 February 2020, we'll be crossing the globe for a large showcase at the OCT Art and Design Gallery in Shenzhen, …
Next Nature went to China!
Next Nature DevWe are proud to invite you to our largest showcase (so far), currently on display at OCT Art & Design in Shenzhen, China. Spanning across three floors, with a total surface of …
Taco futures: In vitro meat in Mexico City
Alejandro AlvarezOur In Vitro Meat Cookbook has inspired many people around the world. Just recently, we had the BBC over at our headquarters to see what makes us thick. This idea of in vitro meat …
The Next Nature guide to Transmediale 2019
Ruben BaartBerlin is kicking off its cultural season with the not-to-miss 23th installment of Transmediale . This year the digital art/culture festival focuses on how feelings are made into …
Build an organisation that lasts by creating a superorganism
Tamsin Woolley-BarkerFor the past 25 years, I’ve studied everything from baboon cooperation in Ethiopia and orca whale innovation in the Bering Sea, to the Argentine ant invasion in my kitchen, and my …
This startup is growing sushi-grade salmon from cells in a lab
Vanessa Bates RamirezAs the ills of factory farming become more pronounced, people are increasingly gravitating towards vegetarian or pescatarian diets. Besides producing a large percentage of our …
How fungi can help create a green construction industry
Ian FletcherThe world of fungi has attracted a lot of interest and seems to be becoming very fashionable of late. A new exhibition at Somerset House in London, for example, is dedicated to …
9 creatives in biotech you need to know right now
Ruben BaartThe field of biofabrication is still new to most people. As founder and CEO of Biofabricate, Suzanne Lee shared with us this exciting online event series Creatives in Biotech . If …
Author Jenny Kleeman is meeting the people creating our future
Ruben BaartMeet Jenny Kleeman , journalist and documentary-maker. Sex Robots & Vegan Meat is her first book for anyone interested in, well, sex robots, vegan meat, out of body birth bags …
Have you thought about your social media death?
Freya HutchingsRecently, Twitter announced it would be clearing all inactive accounts in an effort to free up dormant usernames and prevent the risk of old accounts being hacked. The new policy …
The Invention of Morel is a techno-lovestory from the future
Ruben BaartOctavio Paz says calls The Invention of Morel , “ without exaggeration… a perfect novel. ” According to Borges, “ to classify [it] as perfect is neither an …
How a giant robot learns its true nature
Ruben BaartAt first glance, the premise of the film 'The Iron Giant' (1999) seems to be a total failure. An animation film set in the United States in 1957; while the Russian satellite …
This artist carried 99 smartphones and caused a virtual traffic jam
Claire Ouwejan“ Google choose the fastest route to home.” Today, drivers are better informed about routes and traffic than ever before . Using 'mapping apps', drivers can see traffic before …
Exploring the society of trees
Tracy MetzIn conversation with Canadian researcher Suzanne Simard, inventor of the Wood Wide Web.
Blind woman sees with new implant and plays video game sent straight to her brain
Ruben BaartIt’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …
Cyborg mythologies #2: Jesus was a cyborg
MaithriThis is #2 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
Next Nature plans for Evoluon honored with Region Deal
Next Nature DevGood day astronauts of spaceship Earth! Today it was announced that Next Nature's plans for the Evoluon have been awarded a financial contribution of €7.6 million from the Region …
Evolving In Vitro with Yuval Yancovitch
Kelly van GemertWith 7.9 billion people and counting, the Food and Agricultural Organisation of the United Nations predicts that by 2050, food supply needs to grow by 70% in order to accommodate …
Fish-inspired soft robot takes a deep dive
Dimitris TsakirisThe deepest regions of the oceans still remain one of the least explored areas on Earth, despite their considerable scientific interest and the richness of lifeforms inhabiting …
5 unusual technologies for harvesting water in dry areas
Manzoor QadirWater scarcity is among the top five global risks affecting people’s wellbeing. In water-scarce areas, the situation is grim. Conventional sources like snowfall, rainfall, river …
Gear up for our VR timemachine!
Next Nature DevTravel to big future in our VR timemachine at the Evoluon in Eindhoven
Lab or nature: scientists are debating the origins of COVID-19
Ruben BaartWe need to talk about COVID-19. Again (or, still). One of the main questions about SARS-CoV-2, the virus that causes COVID-19, has for a while been about its origins. Most viruses …
Leonardo DiCaprio is investing in future meat startups
Leanne VoshellGlobally, humanity consumes almost 350 million tons of meat a year. In the next 10 years, this number is expected to increase by a significant percentage. Scientists believe that …
Max Liboiron: pollution is colonialism
Ruben BaartWe now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …
Roman Krznaric contemplates on becoming a good ancestor
Ruben BaartRoman Krznaric's ultimate guide to radically change our perception of time and become good grand-grandparents
The Internet of Mycelium
Kelly van GemertA lot of the ground we live on is polluted. More than a third of our soils are moderately or heavily degraded; heavy metals such as lead are increasingly found in urban soils, …
Working with microbes to clean up electronic waste
Sebastien FarnaudIf you were to stack up all the electronic waste produced annually around the world it would weigh as much as all the commercial aircrafts ever produced, or 5,000 Eiffel towers. …
Exploring public spaces, landmarks and landscapes in Beneath the Surface expo
Marit BeerseThe ‘Beneath the Surface’ exhibition organized by Taiwan Designers’ Web at the Chiayi Art Museum teaches us about unconventional connections, past and future.
Visit the Embassy of Food conference during DDW22
Eloise MaraisWill there still be a supermarket as we know it today in 2050?
Next Generation: Producing glass from ashes with Benedikt Peirotén
Marit BeerseBenedikt Peirotén has started a project called ‘From the Ashes’ proposing using waste streams to replace the energy-intensive ingredients in glass.
The long history of the metaverse
Tom BoellstorffMany aspects of the current metaverse were already familiar 143 years ago.
Personalise your gut health with Microbiota To Go
Ruben BaartIn the supermarket of the future, part of the Embassy of Food at Dutch Design Week, designer Merle Bergers will present her project Microbiota To Go.
Next Generation: Emptying Out with Natasja Bökkerink
Kelly van GemertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: (Un)learning Time By Light with Valentine Maurice
Kelly van GemertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Publish your graduation project
Next Nature Dev*Our open call will continue for another month due to popular demand* Calling all art students, academics and everything in between. Are you a recent graduate (or soon to be)? Do …
The Solar Biennale brings new perspectives on the energy of the sun
Ruben BaartThe sun lies at the heart of our solar system, providing life-giving light, heat and energy to Earth. The sun always gives, without asking for anything in return. In the …
What's solar geoeneering and why is it controversial?
James W. HurrellA report from 2021 from the National Academies of Sciences, Engineering and Medicine tackles a controversial question : Is solar geoengineering – an approach designed to cool the …
Bluehouses are the new greenhouses
Kelly van GemertFishfarming , or aquaculture has been the fastest growing food-sector for decades. This is nothing to be surprised about: fishing as a practice has been in existence since the …
A Dutch startup is saving the banana from extinction
Selin KirThere is a banana crisis happening right now. Our beloved yellow fruits are being threatened with extinction due to a fungal infection called Panama disease, which can wipe out …
A shoebox of fractal flowers
Koert van MensvoortIt's not every day that someone walks into your office with a shoebox, and even more rare when that shoebox contains a potential future.
Paco Rabanne's AI-designed perfume can connect with your phone while making you smell sexier
Selin KirPaco Rabanne already positioned himself as a cutting-edge designer by establishing his reputation as one of the trailblazers during the space age movement of the 1960s. With his …
Gigantic lab-grown mammoth meatball feeds an entire family
Saskia WesselingResearchers used genetic information from an extinct mammoth to create a lab-grown meatball.
All aboard the world's first hydrogen passenger train!
Selin KirAs the world is trying to keep carbon emissions under control, humans are also looking for viable carbon-neutral transportation options. The people from French rolling stock …
This vending machine gives out health advice in exchange for your personal data
Kelly van GemertYour biggest wealth is health, but what it the costs you your anonymity? This vending machine gives you nutritional advice based on the information you give it.
Soon you can have dinner in space in a low-carbon balloon (if you're rich)
Kelly van GemertGet ready to take your dining experience to literal new heights, soon we are able to enjoy high cuisine at the edge of space. French company Zephalto is introducing extravagant …
Food after flood: what's on the menu when sea levels rise?
Kelly van GemertAs sea levels climb, coastal communities brace for floods and erosion. Artist Allie Wist asked herself: what will we eat in a flood-filled future?
Obese mice are losing weight without breaking a sweat
Kelly van GemertBye-bye gym membership, hello losing pounds. Scientists have found a new drug that helped obese mice lose weight.
Using bacteria to create self-fired and biologically glazed ceramics
Kelly van GemertEmbracing nature's ingenuity, designer Nicole Chrysikou harnesses the power of bacteria for her pottery practices.
Furniture futures
Nellie FriedrichWondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?
Future Festive Feast
Kelly van GemertAs the year is coming to a close, many of us are preparing our homes and dinner tables for a festive meal.
Enter Spa Sybarite: the luxury wellness center of our dreams and nightmares
Kelly van GemertIn conversation with film director Joshua Ashish Dawson about the future of wellness, climate anxiety and healthy cynicism India-born, Los Angeles-based film director Joshua …