Technology: Intrusive or Supportive?
Ioana TomiciIs the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?
Search results for technol
Technology vs Football: 4-4
Ties van de WerffSome matches remain interesting, even though they're predictable. Take the continuous battle between technology and football. Every time the stakes get high, such as at the World …
Technology: The 7th Kingdom of Life
Koert van MensvoortKevin Kelly, Senior Maverick at Wired Magazine talks about the nature of technology and propose to define technology as the 7th Kingdom of Life.
Technology Reflexology
Hendrik-Jan GrievinkPeople have complex relationships with their own (and other’s) bodies. In Traditional Chinese Medicine (TCM), it is believed that your feet are a map of your body and can provide …
Technology behind Google's results
Rolf CoppensAs a Google user, you're familiar with the speed and accuracy of a Google search. How exactly does Google manage to find the right results for every query as quickly as it does? …
Technology and Emotions
Margherita OlivoA wearable lighting device that changes color and shade according to movement, facial expressions, weather and mood.
Technology and Sports: Nutrigenomics
Megan Ray NicholsWe’ve been told since grade school that what we eat is important, but we’ve all been told to eat the same sort of healthy things. This isn’t bad, but with the up-and-coming …
Technology Costs Evolution
Alessia AndreottiProducing an iPhone in 1991 would have cost 3,56 million of dollars.
Technology Is Our Next Nature
NextNature.netVideo testimonial for our Next Nature Appzine, all the way from India!
Technology Made us Human
Koert van MensvoortBuckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.
Pyramid of Technology: How technology becomes nature in seven steps
Koert van MensvoortHow technology becomes nature in seven steps
The Pyramid of Technology: How will we co-evolve with technology?
Hendrik-Jan GrievinkThis question is an excerpt from the Pyramid of Technology toolkit Cooking is a process through which humans outsource part of their bodily functions to technology (think …
The Pyramid of Technology: How will a technology enter the human habitat?
Hendrik-Jan GrievinkThis question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …
The Pyramid of Technology: Could a technology establish new routines?
Hendrik-Jan GrievinkThis question is an excerpt from the Pyramid of Technology toolkit Imagine asking your grandparents if they ‘have googled anything lately?’ Chances are they actually did, …
The Pyramid of Technology: How will technology enchant us?
Hendrik-Jan GrievinkThis question is an excerpt from the Pyramid of Technology toolkit Take a mundane object from your house. Now ask yourself: How will this particular technology enchant me? …
A new mythology of technology
Ruben BaartIn conversation with architect Julia Watson, a leading expert on Indigenous technologies and author of 'Lo-TEK, Design by Radical Indigenism'.
The Pyramid of Technology: Is the technology outside or inside your body?
Hendrik-Jan GrievinkThis question is an excerpt from the Pyramid of Technology toolkit The first computers barely fit in your living room. This all changed with the introduction of the desktop …
Moral Shortcomings in the Technology Debate
Rinie van EstDigital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …
Intimate Technology: the Battle for Our Body and Behaviour
Rinie van EstTechnology is nestling itself within us and between us, has knowledge about us and can act just like us.
On inhumane technology
Jack CaulfieldStick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …
The World Without Technology
Kevin KellyI remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …
Can technology be humane?
Koert van MensvoortWe must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …
Nature Loves Technology
Next Nature DevWe interviewed William Myers and Emma van der Leest, curators of Nature Loves Technology, our exhibition at Floriade 2022
The six principles of humane technology
Allison GuyWe must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …
A path to humane technology
Koert van MensvoortIn 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …
The Technological Sublime
Jos de MulThe sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …
Can Life Be a Technology?
Rachel ArmstrongIn 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …
(Nano)technology imitating Nature
Koen BeumerOver the coming years, nanotechnology will invade our everyday lives. Nanotechnology, usually defined as the control and manipulation of matter at the nanoscale, will be …
Pre-Order the Pyramid of Technology Toolkit
NextNature.netThe Pyramid of Technology toolkit is a workshop-in-a-box that helps you better understand technology and catalyze innovative processes.
Humans Are the Sex Organs of Technology
Written by Kevin Kelly , published in The Technium . I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …
How to bingewatch the Intimate Technology series
Next Nature DevTechnology is coming closer to us. In the form of decades old headphones or state-of-art devices. It has always been a part of our lives and this only seems to develop further: …
Next Generation: Designing ecosystems of technology with Maike Gebker
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Intimate Technology Series on NNN
NextNature.netWe called upon artists, filmmakers and film enthusiasts around the world to create a one-minute videos for the intimate technology series.
How Technology becomes Nature
NextNature.netIn this talk at TEDxGhent, our own Dr. Van Mensvoort shows how technology becomes nature in seven steps and what engineers, inventors, designers and entrepreneurs can learn from that.
The prehistoric importance of trading technology
Nicholas R. LongrichThen, as now, one person could literally change the course of history, with nothing more than an idea.
How technology bridges the generational communication gap
Freya HutchingsEmoji, Skype, Selfies - can these communication technologies close the generation gap? In part, yes! Young people are teaching senior citizens how to use technology, and it’s …
The Risk of Technological Unemployment
Daniel FragaStephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.
Intimate Technology Series: Watch the Trailer
NextNature.netWe are happy to announce our new upcoming weekly video-series on the 'Intimate Technology' theme.
Intimate Technology S01E06: Also, the Dichotomy of Pragmatism and Perversion
NextNature.netDo we treat our technologies with more care and sentimentality these days than we did in the past?
Call for Videos: Intimate Technology
NextNature.netNext Nature Network is curating the One Minutes series for September 2017.
Design on the Border of Technology and Biology Demands Us to 'Mother' Nature
Koert van MensvoortDesigner and architect Neri Oxman explores how digital fabrication technologies can interact with the biological world. Watch the TED talk.
Intimate Technology S01E01: All My Clothes
NextNature.netThis movie titled "All My Clothes" reminds us of a more straightforward example of intimate technology: the clothes we wear every day.
Humane Technology #1: Feels Natural
Allison GuyAll too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …
Intimate Technology Evening at Droog
NextNature.netDroog Foundation and Next Nature Network invites you to join the conversation about Intimate Technology: April 23, in Amsterdam.
Intimate Technology S01E08: Scroll
NextNature.netThe last episode of our Intimate Technology series follows a minute in the life of a hyperconnected family in the digital era.
The City as Technology in Tokyo
NextNature.netAre cities in their current form really the future of the human habitat? What is a next nature version of the city and how would it look like? In line with this perspective, NNN designer Hendrik-Jan Grievink led two workshops in Tokyo.
Reimagining popular apps with the Pyramid of Technology
Alejandro AlvarezToday, there's an app for everything. They help us satisfy our cravings, allow us to communicate at all times and make it easier to share special moments. But the dark, cold …
Intimate Technology S01E07: Our Selves
NextNature.netWe think of selfhood as residing in our everyday stream of consciousness. But could we possibly have a second digital self in our online behaviors? Watch episode 3 of our Intimate Technology series.
Bio textiles: meet three designers reimagining materials using biotechnology
Alexandra KisielewskiThe world needs interdisciplinary creators who are designing not just for humans, but for the rest of the living planet. To foster this thinking, Biodesign Challenge (BDC) pairs …
5 unusual technologies for harvesting water in dry areas
Manzoor QadirWater scarcity is among the top five global risks affecting people’s wellbeing. In water-scarce areas, the situation is grim. Conventional sources like snowfall, rainfall, river …
Humane Technology #3: Take Human Values as a Cornerstone
Allison GuyThe third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …
Wearable Technologies for Dummies
Koert van MensvoortOn the emerging field of technologies that are worn close to or on the body
Intimate Technology S01E02: Misbehaving (Ro)bots
NextNature.net"Misbehaving (Ro)bots" asks whether technology could hope to replicate these small bothersome quirks that instill a feeling of intimacy.
Blaming Car Technology for Dumb Drivers
Alessia AndreottiCars increasingly rely on technology designed to make driving easier and safer. But are these improvements creating less-skilled drivers?
Changing your Mood on Demand with Brain-Altering Wearable Technology
Alessia AndreottiThync, is a new brain-altering wearable technology that promises to “shift your state of mind and conquer life” by allowing its users to change their mood whenever they need it.
Intimate Technology S01E04: So Happy Together
NextNature.netWhat if you could upload your fondest memories to the cloud? Watch episode 4 of our Intimate Technology video series.
How technology keeps us connected
Britta de VriesAt this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …
Humane Technology #6: Improve the Human Condition
Allison GuyAnd now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …
Haptic technology
Arnoud van den HeuvelHaptic technology refers to technology which interfaces the user via the sense of touch by applying forces, vibrations and/or motions to the user (Just think of the Wii ). At the …
Humane Technology #2: Revive Human Intuitions
Allison GuyOur second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …
How Technology is Becoming More and More Sensitive
Margherita OlivoOver the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …
Intimate Technology S01E05: The Modular Body
NextNature.netThe body, like any technology, is made up of countless individual components. Yet, apart from dire medical emergency, have you ever thought about mixing and matching these …
Humane Technology #4: Resonate with human senses
Allison GuyPrinciple number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …
Wearing Technology Under the Skin
Alessia AndreottiUnderSkin is a device that would be implanted beneath the skin on your hand and charge off your body’s energy.
The New Technology in Agriculture: Trees
Jack CaulfieldNew technologies are changing the landscape, but the latest trend reshaping rural environments and agriculture is agroforestry: the art of planting trees.
Humane Technology #5: Empower People
Allison GuyPrinciple number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …
Googles Natural Tracking Technology
Koert van MensvoortWe may soon all be making natural gestures to interact with our digital devices.
Intimate Technology S01E03: A iReal
NextNature.netWhat if your devices had a life of their own? Guy Farber’s playful short movie "An iReal" explores this very possibility.
Nanotechnology Crashcourse
Koert van MensvoortThis mashup video project integrates various video clips that ask: What is nanotechnology? Via Posthumanblues , via Futureblogger . See also: Small Talks , Bacteria Bots , …
Map of Emerging Technologies
Ties van de WerffThis nice interactive map makes it clear what’s awaiting us in the near future. Presumably.
Co-Evolving with Technology
Koert van MensvoortLooking at this nextnatural comic, our co-evolutionary relationship with technology might need some work.
Body hair helps animals stay clean – and could inspire self-cleaning technologies
David HuWatch a fly land on the kitchen table, and the first thing it does is clean itself, very, very carefully. Although we can’t see it, the animal’s surface is covered with dust, …
How modern technology is inspired by the natural world
John NychkaWhat do a kingfisher, cocklebur pods and a Namibian beetle have in common? Besides being living organisms, they have all served as inspiration for creative human technologies to …
Tribal Communication Technology
Koert van MensvoortMobile phones are nextnature: Twenty years ago they didn't exist, now everyone has one and when you leave your house without it, you feel amputated. Like you are missing a limb …
What does Technology want?
Koert van MensvoortTechnologist, environmentalist and nextnature thinker avant la lettre Kevin Kelly , muses on what technology means in our lives – from its impact at the personal level to its …
Browsing the Technological Sublime
Allison GuyIn this video, Geert Mul uses online photos to tap into the divine presence in image search #powershow http://bit.ly/uk79b0
Sexual Fetishes Evolve with Technology
Allison GuyOnce common, statue-loving has disappeared from the sexual landscape.
Animals Love Technology
Alessia AndreottiA macaque stole a tourist's iPhone and fiddled around with it like a human would.
Screw Technology
Hendrik-Jan GrievinkIn this particular piece of video art, loyal readers of nextnature.net might recognise the building as Zeche Zollverein in Germany, where we organized the Biggest Visual Power …
Why human enhancement requires technological citizenship
Ira van Keulen and Rinie van EstNew technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …
How biotechnology could shape the future of product design
Ruben BaartHumans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …
Interview: Pauline Van Dongen, Designer Merging Fashion and Technology
Margherita OlivoDutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.
Our Relationship with Tech Is Growing Stronger
Megan Ray NicholsIt's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.
Why superhuman technologies will affect us all
Ruben BaartWhen you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …
Next Generation: Growing technology with Prosthetic X
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This expo explores technological nature and indigenous insight
NextNature.netTechnology brings us closer to nature, and indigenous insight reconnects us to our roots.
Fermenting Futures and the beauty of biotechnology
Kelly van GemertExploring the co-evolution of yeast and humans, while discovering the aesthetic value of yeast biotechnology, is what designers Anna Dumitriu and Alex May have been concocting. …
Meat & Greet Workshop Report
Insoo HwangLast week, Next Nature Lab had the first Meat & Greet to explore the future of in vitro meet.
The next sexual revolution is going to be all about technology
Peter DiamandisSex is one of the most powerful, fundamental human drives. It’s caused wars, and built and destroyed kingdoms. It occupies a significant percentage of most people’s thoughts. As …
THRIVE: an expo in designing nature and growing technology
Ruben BaartTHRIVE expo showcases the latest works at the convergence of art, design, and biology, which examine current and future uses of biotechnology.
The Biofabricate Summit '24 is coming to Paris!
Kelly van GemertBiosequin, seaweed textiles, and microbe sunscreen: these ideas and more are marking the next wave of bio-innovators during the Biofabricate Summit 2024.
This bin transforms household waste into chicken food
Selin KirImagine a trash can that matches the size of your ordinary bin, yet it scoffs at weeks' worth of discarded food before even considering fullness. You're off the hook, as there's …
These Next Senses allow you to augment your senses with technology
Ruben BaartImagine you could communicate telepathically with a whale, listen to the WiFi networks in your environment, or experience smells through seeing color. Developments in technology …
Close to skin technology
Wearable Interfaces, Smart Materials and Living Fabrics. V2_, Institute for the Unstable Media, Rotterdam, and Amsterdam-based Virtueel Platform, the expertise centre for …
Which Technologies will 2016 Bring?
Wei Lun WangThe new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …
With this technology we can shake hands during the pandemic
Claire Ouwejan“Please refrain from hand shaking" is a common sign we now see as a result of public health organizations advising people to avoid shaking hands as a greeting. As people still …
Exploring speculative developments of reproductive technology
Next Nature DevWhat if women of childbearing age no longer had to interrupt their careers for a pregnancy? In Kuang-Yi Ku ’s project Grandmom Mom, we take a look into the future. In 2050, the …
Smartphones Will Soon Be a Thing of the Past
Megan Ray NicholsSmartphones have become almost a part of who we are. According to tech industry experts, however, the smartphone's days are numbered and that number is lower than you might expect.
How technology will help us adapt to climate change
Ruben BaartClimate change will transform how we live, but these tech and policy experts see reason for optimism
With this sound recognition technology scientists can eavesdrop on nature
Lucas ZarzosoWhat if humans would be able to listen to what nature has to say? Conservationists are trying to grasp non-human sounds , which might help us to better understand environmental …
New Technologies to Make Us Sleep Less, and Better
Daniel BlokbergenHaving 50% more “conscious lifetime” might sound like an appealing proposition to anyone with a hectic schedule. This could be achieved not necessarily by living longer, but by …
How blockchain technology is changing the agriculture industry
Megan Ray NicholsBlockchain is useful for more than cryptocurrency. It’s revolutionizing industry after industry. Next, it may change the way we get our food. The agriculture industry is complex. …
The return of trade: Blockchain technology is enabling trade to make a fierce comeback
Koen WeselBefore money came into existence, trading was all we knew. Farmers in China traded their spades for food and other goods, and this continued up until a point where most spades …
The Playboy Interview
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture
Alessia AndreottiRachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.
Check your technoprivilege!
Hendrik-Jan GrievinkTechnology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.
An Ecstatic Dialogue with Richard Doyle
Jason SilvaWhen techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
Interview: Liam Young on Speculative Architecture and Engineering the Future
NextNature.netInterview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.
Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology
NextNature.netAn interview about the history and promises of synthetic biology, and the problem with the word "nature".
Letter to Humanity
Koert van MensvoortNNN director Koert van Mensvoort writes a letter to humanity.
Face the future of intimacy with Kiiroo
Ruben BaartMeet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …
Next Generation: Shaping intimacy through objects with Pleun van Dijk
Ruben BaartPleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.
Entryparadise
Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …
Next What?
John ZerzanIn this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …
Next Nature Academy presents: A workshop-in-a-box for your team
NextNature.netAre you working on projects where technology and human interaction are involved, and are you looking for a new approach? As of today, we offer a brand new workshop concept for you …
Next Nature and the Curse of Oil
Tere VadénThe next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.
Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society
NextNature.netWe recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between biosciences and society and the importance of communication to overcome the fear of new technologies.
Innovative Nostalgia
Koert van MensvoortWe humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.
The Anthropocene Explosion
Koert van MensvoortWe have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
Nano Supermarket – Jury Report
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
I Want Wings!!!!!!!!!!!!!!
Nicholas CarrRead Nicholas Carr's essay on the transhumanist dream of having wings.
Next Nature's must reads
Ruben BaartTen books that continue to inspire the next nature philosophy—gathered for you to read this summer.
How to design a digital democracy
Rinie van Est10 design requirements to fully immerse ourselves into the 21st Century—in which technology makes our world richer, not poorer.
Why I'm turning my son into a cyborg
Vivienne MingImagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …
Sónar Lisboa: a festival for body and brain
Ruben BaartSometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …
Ectogenesis, Artificial Womb, Human Egg?
Hendrik-Jan GrievinkThe artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.
If you could have another sense, which sense would you choose?
Meike SchipperColor-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …
Here’s how the Dutch are embracing blockchain in the polder
Coen van de VenSmiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …
Why digital detoxes are a solution looking for a problem
David EllisWith New Year’s resolutions in full swing, many people may have chosen to cut down on their tech use – or even give it up altogether. The growing popularity of such “digital …
Towards collective standpoints on the future of babymaking
Freya HutchingsFor the closing event of Reprodutopia , a true meeting of minds took place as we discussed the social implications surrounding the future of reproductive technologies. Multiple …
Next Senses
Ruben BaartNext Senses explores the unchartered territory of how we could experience the world with technology
Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert
Alessia AndreottiAn interview with Daisy Ginsberg, artist and synthetic biologist.
In Conversation with Marleen Hartjes: Introducing a digital door to the museum
Kelly van GemertDon’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …
Suzanne Lee wants to live in a world that uses only sustainable materials
Ruben BaartBiotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …
Cyborg mythologies #2: Jesus was a cyborg
MaithriThis is #2 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
Growing the Future of Meat
Christina AgapakisOutside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.
The Golden Quarter
Michael HanlonSome of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?
Getting rid of that bit of unspoiled green
Sanne vander BeekThere it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …
Why there is a new urgency for speculative design
Freya HutchingsPink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …
In Vitro Meat: Animal Liberation?
NextNature.netMany people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food
Alessia AndreottiFood and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.
In conversation with Studio Drift
Meike SchipperA flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …
Faustian Bargains and Pineapple Shampoo
Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …
ISEA 2010: Artists addressing NextNature
Ties van de WerffAt ISEA 2010 , the International Symposium on Electronic Arts, media artists and media researchers from all over the world present their work in Dortmund (Germany). This year, …
Why in the future, we will all wear one piece of garment
Ruben BaartIt's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …
How AI is reshaping electronic music
Linda ValentaThe idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …
POND is a symphony of lights and water
Nellie FriedrichHave you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
Do a Next Nature Workshop!
NextNature.netNNN organizes workshops using a physical Pyramid of Technology as conceptual tool.
Exploring body architecture with Lucy McRae
Meike SchipperAs evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …
‘Optimism is our duty’: in conversation with Koert van Mensvoort
Ruben BaartWe live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
Evolving In Vitro with Yuval Yancovitch
Kelly van GemertWith 7.9 billion people and counting, the Food and Agricultural Organisation of the United Nations predicts that by 2050, food supply needs to grow by 70% in order to accommodate …
The Institute of Digital Fashion explores what's next in the industry
Ruben BaartTrading animal skins for pixels, our digital selves call for a digital wardrobe. The Institute of Digital Fashion , led by CommuneEast founder Leanne Elliott Young and Digi-Gxl …
Jurassic World scientists still haven’t learned
Ruben BaartJust because you can doesn’t mean you should – real-world genetic engineers can learn from the cautionary tale. “ Jurassic World: Dominion ” is hyperbolic Hollywood entertainment …
Erkundungen im Nächste Natur (D)
Die Natur verändert sich mit uns (English version: Exploring Next Nature ) by Koert van Mensvoort , published in Entry Paradise, Neue Welten des Designs, Gerhard Seltman, Werner …
Self–Repairing Architecture
Rachel ArmstrongAll buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings
Alessia AndreottiFloris Kayak discusses online hoaxes and the future of technology.
Designer Anouk Wipprecht combines fashion with robotics
Alessia AndreottiWe met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.
Smart homes could help dementia patients live independently
Dorothy MonekossoYou might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …
The beginner's guide to biohacking
Peter JoostenWhat is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …
The sense of privacy
Marit BeerseHumans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.
Exploring Next Nature (2004)
Koert van MensvoortThe first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …
Anthropomorphobia
Koert van MensvoortAre you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
NANO Supermarket Jury Report 2012
NextNature.netAfter the successful introduction of the NANO Supermarket in 2010 it became even more clear that the contest and the presented results produced discussions and many challenges to …
A Stroll Through the Bubbles of Chemicals and Men
Etienne TurpinA stunning pre-history of the anthropocene
Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory
Alessia AndreottiWe recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.
From Homo Sapiens to Homo Optimus
Ioana TomiciWe are entering an age of technological singularity, in which artificial intelligence and biological enhancement are combined in order to construct the next stages of human evolution.
Interview: Huub Ehlhardt on the evolution of products
Kelly van Gemert"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …
On the prehistoric origins of modern sexuality
Ruben BaartLet’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …
Next Generation: Writing a design manifesto with Pleun Wilting
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Breaking Point?
John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …
Instageneration: Kids Named after App Filters
Margherita OlivoTechnology breaks as an inspiration for names. Among the most popular names of 2015 we can find Instagram filters.
Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body
Ruben BaartSpeculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.
Robo Wunderkind is a modular robot even a five-year-old can program
Kelly van GemertMeet the Robo Wunderkind, a new breed of smart toys that introduces children to the basics of coding and robotics in a playful way. Advanced technologies are increasingly embedded …
Blind woman sees with new implant and plays video game sent straight to her brain
Ruben BaartIt’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …
Next Generation: Launching the Eva Biodesign Lab with Carlos Silveira
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Nature Interview
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
Anthropo-scene #9: Sense, Sensors, Sensitivity
ChristianTechnology helps us understand the unfolding of the Anthropocene.
The Biosphere Code Manifesto
NextNature.netDuring the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.
The age of cyborgs has arrived
Vanessa Bates RamirezHow many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …
Interview Mark Wigley: "We are living in an ecology of antenna"
Ruben BaartWith the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …
The future infrastructure of the blockchain might be green and humane
Koen WeselThe connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …
Nadine Bongaerts: 'We’re attempting to make foie gras based on stem cells'
Ruben BaartBiosensors, cultivated meat and spider’s silk. For synthetic biologist and Next Nature ambassador Nadine Bongaerts, these are all advances towards a new world, where polluting …
What we can learn from The Social Dilemma
Vanessa Bates RamirezIs social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …
5 Dutch exhibitions you cannot miss this summer
Ruben BaartInterior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …
Cyborgnest: redefining human senses
Liam BekaertNature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …
Inverting the energy paradigm with Charles Eisenstein
Ruben BaartEnergy policy blah blah blah, life cycle analysis blah blah blah, energy return on energy invested, peak oil, carbon footprint, renewables, hydro, nuclear, blah blah blah blah …
Razorius Gilletus – On the Origin of a Next Species
Koert van MensvoortIs the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …
Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas
Alessia AndreottiMedia artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.
The Prefuture of Synthetic Biology
Alexandra Daisy GinsbergAlexandra Daisy Ginsberg discusses the promises and realities of synthetic biology.
The Idea for Lab-Grown Meat Was Born in a Prisoner-of-War Camp
Chase PurdyThe phone call was as unexpected as the American accent at the other end of the line. And when she hung up a few moments later, Ira van Eelen had to stop to catch her breath. More …
Pay with Your Face
Elle Zhan WeiFace-detecting systems in China now authorize payments, provide access to facilities, and track down criminals.
The path towards solar democracy with Marjan van Aubel
Meike SchipperSolar cells are often considered an eyesore, used for their sustainability yet not for their beauty. Installed on roofs or in solar parks, they take up precious space. Well that’s …
How future fashion could help us cope with isolation
Ruben BaartToday we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …
Track freshness and reduce food waste with Rui Xu
Ruben BaartImagine this: you wake up on a lazy Sunday morning, trudging your way to the fridge only to be welcomed with the smell of something rotting. Did the meat expire sooner than …
Screen mutations and reframing perspectives with Louisa Zahareas
Ruben BaartIn the digital era of a globalized world, our screens have become a second set of eyes. Communication has advanced leaps and bounds, to a point where we cannot imagine a world …
Billionaire space race: the ultimate symbol of capitalism's obsession with growth
Tim JacksonMars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …
Growth is not the problem, but the solution
Ruben BaartIf we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.
The Material Futures of Central Saint Martins
Zeynep KunduracilarMeet United Matters, a London collective exploring how we might live in the future by blurring the boundaries between craft, science and technology.
The fantastical living landscapes of AUSGANG Studio
Kelly van GemertAUSGANG Studio combines art, technology, and living materials to tell stories of our world's trajectories.
Technostalgia
Ties van de WerffIn Next Nature, not only old nature is being idealized. Because of the rapidness of new emerging technologies, we have a tendency to dwell on earlier prototypes. To recall …
Fly like a Bird? Get Human Birdwings
Koert van MensvoortDutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.
Seven Future Visions on In-Vitro Meat
Koert van MensvoortBefore we can decide if we will ever be willing to eat in-vitro, we need to explore the food culture it will bring us.
Moving From Password to Biometric Data
Alessia AndreottiUnlock our devices with our fingerprint, this technology for security represents a change in our digital life.
3D Holography: the Future of Medicine
Yunus Emre DuyarA new technology aims to provide doctors with a true hologram of organs.
Apple Watch Evolution
Alessia AndreottiIn 1992, decades before the era of wearable technology, Apple produced its first watch: no apps and vintage design.
Speculative Sensing at WDCD 2015
NextNature.netOn may 21st, Next Nature Network art director Hendrik-Jan Grievink will host a workshop around the idea of Speculative Sensing: exploring the potential of senses found in nature …
But will lab-grown meat be kosher?
Benjamin Aldes WurgaftRead Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.
How will the artificial womb affect society?
Natalja HeybroekWhere contraceptives such as the pill disconnect sex from reproduction, in vitro fertilisation disconnects contraception from sex, and the artificial womb would disconnect the …
Three scenarios for the future of farming
Kelly van GemertAgriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …
Welcome to the CRISPR baby world—here’s what you should know
Vanessa Bates RamirezLast week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …
The artificial womb: dream or nightmare?
Ruben BaartThe emerging technology of the artificial womb confronts us with a series of moral and societal questions. How to cope with that? Join us on 29 March at Eindhoven University of …
Smart cities could give the visually impaired a new outlook on urban life
Drishty SobnathTravelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …
Hello, superorganism
Koert van MensvoortWhen I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …
Can AI become addicted?
Thomas MoynihanIn 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …
Future cities: why we need to reimagine the look of urban landscapes
Ruben BaartIn imagining future urban landsapes, we need to answer questions about what can be sustained and what cannot, where cities can be located and where they cannot.
Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith
Liam BekaertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The Embassy of Health is designing a chronically healthy society
Eloise MaraisHow will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?
How to calculate your biological age
Kelly van GemertComputational Biologist Jing-Dong (Jackie) Han and her team uncovered a technology to interpret signs of biological aging directly from facial characteristics.
How to control electronic devices with your mind
Ghizlane OughzifControlling devices with your mind. Unreal? Think again. Brain-computer interfaces have been changing the game in healthcare, gaming, and accessibility lately.
How to design your future family
Ruben BaartImagine a place called Reprodutopia. How would such a place look like?
Browse the Catalog For The Post-Human
Veronica FanzioAugment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.
Seeking Symbiosis
Ruben BaartVisual artist Heleen Blanken explores the complex relationship between people, nature and technology.
Oil Price Threatens Biofuel Firms
Dr NaturalEconomy is ecology? Technology Review writes the price of oil has dipped to levels that could be far too low for many advanced-biofuel startups to succeed, especially those that …
Next Nature Introduction
Bruce SterlingThis project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image. The facts …
Back to the Tribe
Koert van MensvoortTraditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …
Little Green Cows
Rachel ArmstrongThe world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …
Nature through the Windshield
Brendan CormierVolume magazine interviews Next Nature founder Koert van Mensvoort.
A Tiny Trackpad That Fits on Your Nail
Yunus Emre DuyarResearchers from the Massachusetts Institute of Technology have developed a tiny wireless trackpad that could easily fit on your finger nail.
Archaeology of Media
Alessia AndreottiThe Archéologies des Medias exposition turns archaic technology that was once cutting-edge into art.
Converting Gestures into Concrete Action
Yunus Emre DuyarFrancesca Barchiesi's glove concept allows the user to translate hand gestures into images and information.
Growing Drones From Chemicals
Ruben BaartResearchers are experimenting with a new technology that would be able to grow drones from chemical compounds.
Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium
Ruben BaartDutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.
A Smart Top to Correct Body Posture
Ruben BaartFysioPal is a smart top made to support and enhance the upper-body and posture.
Welcome to Chanel Data Center
Mathilde NakkenTwo robots opened the show of Chanel during the Paris Fashion Week of 2017. Well robots, two models dressed up like humanoid robots entered the catwalk. Is Chanel going Next Nature?
Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial
Ruben BaartWe recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.
Interview: Lining Yao, Interaction Designer and Maker of Novel Materials
Alessia AndreottiWe recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.
The future of the ECO Coin
Koen WeselHow can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …
Smart Ring Turns Thumb Gestures into Words and Numbers
Belen MunozFrom the Georgia Institute of Technology arrives FingerSound, a smart ring that recognizes thumb gestures and converts them into words and numbers.
An introduction to biomimicry
Janine BenyusThe first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …
3 future farms that can feed the planet and heal it too
Karen Rial-LoveraIntensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …
The new Next Nature book is here!
Next Nature DevWe live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
Design your Self!
Next Nature DevWho are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …
In conversation with cyborg musician Kai Landre
Ruben BaartWhat does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …
Cyborg mythologies #3: in god we trust, all others bring data
MaithriThis is #3 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
What will your future supermarket look like?
Ruben BaartWhat will the supermarket of the future look like? And what kind of food will you be able to buy there? That is what the Embassy of Food is researching. The production and …
Next Generation: Exploring non-binary futures with Lena Kuzmich
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Redesigning Burberry with Jiyong Lee
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The Furby threat to national security
Veronica FanzioWe are now so used to communicating with some robotic device in our homes. But this skill cost Furbies a national ban in the US.
A Society of Simulations
Koert van MensvoortAn interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …
Human Nature Forecast
Koert van MensvoortInterview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.
Morphing Cutlery
Koert van MensvoortImagine a world where the shapes of all objects around you would be able to change on the fly. Envision a future where nanotechnology and morphing become ubiquitous and blend in …
Bacteria "R" Us
Rachel ArmstrongThere is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …
Time Between Emergence and Design
carolinenevejanPreviously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.
Goats Replace Lawnmowers in San Francisco
Allison GuyThey might not be as fast, but goats offer several advantages over diesel-powered lawnmowers. They're quieter, they emit fewer greenhouse gases, and they fertilize soil as they go …
Nano Supermarket 2nd Edition: Call for Products
NextNature.netWe call upon designers, technologists and artists to submit their speculative nanotech products for the next round of the NANO supermarket.
Nanotech Water Bottle Harvests Water from the Air
Allison GuyThe Namib desert gets less than a half an inch of rain per year, yet the stenocara beetle manages to survive in these punishing conditions. The beetle's secret lies in an array of …
Control Your Mobile Phone or Tablet Directly from Your Brain
Marije WillemsenSamsung is working on a brain interface that lets you go truly hands-free with your phone.
Why Meat Grown in Labs is the Next Logical Step for Food Production
Avy RoyLab grown meat is part of the trajectory that agricultural technology is already following.
Professions Of The Future
Francesca BarchiesiAs technology evolves, what today seems like science fiction may be the job market of tomorrow: 11 professions of the future.
Diseases Of The Future
Alessia AndreottiNowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …
Electronic Skin can Detect Magnetic Fields
Yunus Emre DuyarThere is a new artificial skin technology that could give humans magnetoception in the future.
Implanting Chips into Employees
Alessia AndreottiAn he hi-tech Swedish office block implanted a microchip under the employees’ hand skin.
Sharing Your Newborn's Heartbeat
Yunus Emre DuyarThese parents use the Apple Watch to share their newborn child's heartbeats with friends and family.
The Enlightenment Is Dead, Long Live the Entanglement
Danny HillisWe humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
Evolution Will Change the Way We Sleep
Margherita OlivoA group of researchers is working to optimize the way we sleep, increasing our relaxation, and therefore reducing the time devoted to our naps.
Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing
Ingmar NieuweboerInterview with Mike Thompson and Susana Cámara Leret.
Israeli Tech Turns Any Road Electric
Alessia AndreottiElectRoad developed a unique technology that powers the vehicle wirelessly from the road while driving.
A Temporary Tattoo That Heals
Monika KozubMoving tattoos from purely aesthetic crave to a healing method thanks to nanotechnology.
Cultured Meat Closer to Reality
Alejandro AlvarezMany companies are seeing the potential of this technology to solve food scarcity, reduce pollution and offer cruelty free meat. One of these firms is Tyson Foods, the meat giant.
Facial Recognition Replaces Passports
Ruben BaartBiometric technology replaces passports in Australian airports.
Digital Detox: Disconnect to Reconnect?
Nadine RoestenburgDo you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!
iPhones Are Happy to See Us
Jack CaulfieldWhat if you could unlock your phone by simply looking at the camera? According to Apple, this is precisely how the iPhone X will work. But how secure is it?
A Virtual Counselor for Mental Health
Siebren de VosA Facebook chatbot that offers interactive cognitive behavioral therapy. It’s called Woebot and it's your personal virtual counselor.
Should lab-grown meat be labelled as meat when it's available for sale?
Hope JohnsonAustralian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …
Brain-assisted driving: Mind-control your car
Charlotte KuijpersBefore fully autonomous cars take over our streets, we may experience a transition phase: Fasten your seatbelts, as Nissan introduced a so-called Brain to Vehicle (B2V) system to …
Enter the Future Food Formula
Ruben BaartImagine, it’s 2050 and you are feeling hungry. What will be on your plate? Where will your food come from, and how will it be produced? It may be juicy ants from the nearest …
Next Generation: Searching for Null Island with Deborah Mora
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The Coronation
Charles EisensteinFor years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
Max Liboiron: pollution is colonialism
Ruben BaartWe now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …
Can microbes communicate with alien species?
Ruben BaartAre we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …
That modernist dream of the house as butler is not going to happen
Helmke van GeelLooking at evolution, we see that there’s always a next nature. Nature changes along with us. How will that influence our way of life in the future?
Welcome to new Evoluon
Next Nature DevToday our human impact on Earth is humongous. Climate change, plastic oceans, mass urbanization and deforestation. Scientist recently calculated the technosphere now outweighs the …
Five things not to miss at Floriade
Veronica FanzioHere are 5 things you cannot miss at Floriade Expo 2022
Next Generation: Sensing the critical zone with Menno Brouwer
Kelly van GemertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The GeneSprout Initiative: cultivating new plant breeding techniques
Ruben BaartSome 10,000 years ago humans began to domesticate plants and animals. The birth of agriculture, one of the earliest technologies available.
Next Generation: Experiencing neo-robophilia with Hye Hyun Song
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
What's solar geoeneering and why is it controversial?
James W. HurrellA report from 2021 from the National Academies of Sciences, Engineering and Medicine tackles a controversial question : Is solar geoengineering – an approach designed to cool the …
Artist refuses photography prize after admitting his image was AI-generated
Vanessa Bates RamirezA German artist refused a photography prize after admitting his image was AI-generated.
This device helps you to control your lucid dreams
Méline MaquartWhat if we could control our dreams? In the near future, this might become a reality. Prophetic developed a new technology that enables lucid dream control.
Geodesign
Nellie FriedrichWe have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.
Designing for Next Nature (workshop report)
Koert van MensvoortThe extent to which new technologies are intervening with everyday life can hardly be underestimated. Virtual realities, nano- and biotechnology are increasingly providing new …
Scientists Extract Images Directly from Brain
Arnoud van den Heuvel(Extracted directly from Pink Tentacle , thanks!): Researchers from Japan’s ATR Computational Neuroscience Laboratories have developed new brain analysis technology that can …
The mobile evolution
Arnoud van den HeuvelIn our NextNature event BVPS (May 2008), Kevin Kelly spoke of technology as the 7th kingdom of life : a form of evolution whithout the nasty side–effect of dying (Every object …
Four Objections to Lab-Grown Meat
Allison GuyIn vitro meat has been billed as a way to end animal suffering , put a stop to global warming , and solve the world's insatiable demand for animal protein. There's no doubt that …
Nature is Dead, Long live Nature
Koert van MensvoortLike we did to old nature before, we must now cultivate our technological environment.
Tuur van Balen – Hacking Yoghurt
Koert van MensvoortDesigner Tuur van Balen argues biotechnoloyg is actually very accessible and creates an 'anti-depressant yoghurt' on stage.
Exploring the Offline World, if It Still Exists
Bram de VogelThe surprising results of a year offline in the "real" world.
How to Grow a Beer Bottle
Koert van MensvoortA so-called "natural" beer is marketed by portraying an utterly technological process.
Killing Cancer Cells, Arcade-Style
Alessia AndreottiA speculative nanotech pill that lets you virtually rove your body, zapping cancer cells as you go.
Out of Network
Santiago ZabalaArtist Filippo Minelli aims to point out the gap between the reality we still live in and the ephemeral world of technologies.
The Brain Is as Complex as All the World's Digital Data
Alessia AndreottiWith advances in genomics, imaging and other technology,scientists have to face the age of big data.
Electricity From Plants
Lotte BiesheuvelA new technology enables us to produce electricity from living plants at practically every site where plants can grow.
My Device is in the Sky
Koert van MensvoortTruly advanced technology will be light as sunshine and indistinguishable from nature.
The Ideal Phone Might Be The noPhone
Rolf CoppensYour next phone could be the noPhone: a technology-free alternative to any smart mobile device.
Google's Smart Interactive Clothing
Alessia AndreottiProject Jacquard makes it possible to weave touch and gesture interactivity into any textile.
Hearing Colors
Hessel HoogerhuisThanks to the antenna implanted in his skull, Neil Harbisson can hear images and paint sounds.
Living Underground with Fake Sunlight
Rolf CoppensCoelux skylight recreates natural sunlight using Nano Technology.
Tracking Employees' Body Functions to Improve Business Performance
Alessia AndreottiIn the quest for competitive advantage, companies adopt wearable biometric technologies to monitor employees and improve business results.
Smart Gloves Turn Gestures into Music
Yunus Emre DuyarEnglish artist Imogen Heap, with an army of artists, musicians, scientists and technologists, developed the Mi.Mu gloves.
Bio-Printer Creates Living Body Parts
Margherita OlivoBioprinter creates bespoke lab-grown body parts for transplant.
“Everything Is Already Invented”
Ingmar NieuweboerRobert Gordon says all the major inventions have been made, but that's only true for our limited knowledge of future possibilities.
Goodbye Password, Hello Selfie!
Margherita OlivoCompanies try a new, more secure payment system using selfies.
How Is Hi-Tech Changing Sports?
Margherita OlivoHitech is changing sports, but what are the consequences?
Towards a Post-Animal Bioeconomy
Ruben BaartAs emerging biotechnologies are blurring the lines between synthetic food and natural food, who will regulate cellular agriculture?
What You Should Know About Artificial Intelligence Changing Jobs
Megan Ray NicholsIt should come as no surprise that artificial intelligence naturally extends into the way we work. Let's look at how AI changes the way we relate to work.
Make the World Your Office
Megan Ray NicholsImagine being able to enter your office through a digital representation of reality. It sounds crazy, but it’s possible with augmented and virtual reality.
Read the Entire Artificial Womb Series
NextNature.netWe published a timeline series to explore medical, cultural and technological developments in relation to the ectogenesis concept.
Robotization Makes Work More Human
Koert van MensvoortImagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.
Ermi van Oers wants to bring living light to your living room
Jack CaulfieldThe Living Light harnesses plant energy to provide light. We spoke to its designer, Ermi van Oers, to find out more about the unique product.
A happy birth day to Louise Brown
Hendrik-Jan GrievinkDear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …
HUBOT: Meet the Digital Detox Dietitian
NextNature.netAs a digital detox dietitian, you know exactly how much digital technology your client needs and you give professional advice with a personal approach.
3D-printing food waste into tasty products
Meike SchipperGlobally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
Aleph Farms grew meat in space
Freya HutchingsHello meat lovers! In vitro meat innovator Aleph Farms has taken the saying 'one small step for man and one giant leap for mankind' to a whole new level. The startup has succeeded …
This brain-controlled exoskeleton allows a paralyzed man to walk again
Freya HutchingsA breakthrough technology that responds to signals from the brain has transformed the life of a paralyzed 28-year-old man called Thibault. Four years after the initial incident …
Artificial bones for the natural meat experience
Ruben BaartThe world is developing, climate change is happening and it's time for us to do something. Now. One strategy would be to simply stop eating meat — or at least reduce the amount of …
How emojis represent the past, present and future within Next Nature
Britta de VriesIt's that time of year again; the Unicode Emoji 13.0 has announced that 117 new emojis are to be implemented in the second half of 2020. It got us curious of what these new emojis …
Talking non-human nonsense with Nonhuman Nonsense
Ruben BaartNonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …
This book explains why cooking food was essential to human evolution
Ruben BaartA must-read to the Next Nature fan: Catching Fire: How Cooking Made Us Human (2009). Written by British primatologist Richard Wrangham, the author shares his hypothesis that …
Coffee without the beans
Vanessa Bates RamirezAs with many of the products we consume, there’s a cost beyond what we pay at the store. Producing coffee has an environmental cost, too.
Cyborg mythologies #1: plastic surgery & techno-futuristic foretellings
MaithriThis is #1 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
Mojo Visions augmented reality contact lenses kick off a race to AR on your eye
Ruben BaartThe digital world has been creeping closer to your face. Was a time when a laptop was about as personal as you got with a computer. Then came smartphones, and a few years later, …
Reproducing robots
Leanne VoshellWhen we think of robots, we typically do not think of small cellular organisms made with embryonic cells from frogs. However, this is exactly what the joint teams at University of …
Why we need to get better at predicting space weather
Koert van MensvoortThe Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.
Chloé Rutzerveld designs the food of tomorrow
Eleni MaragkouYou are in for a surprise when you look at food and concept designer Chloé Rutzerveld 's portfolio. It is hard to believe that somebody so young - she is just 25 - has already …
Personalise your gut health with Microbiota To Go
Ruben BaartIn the supermarket of the future, part of the Embassy of Food at Dutch Design Week, designer Merle Bergers will present her project Microbiota To Go.
Next Generation: (Un)learning Time By Light with Valentine Maurice
Kelly van GemertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Dancing at the intersection of natural and virtual worlds
Eleni MaragkouExploring the intersection of technology and art, a team of creatives presents a virtual performance that pushes the limits of human expression.
People would rather give up sex and vacations than their smartphones
Koert van MensvoortDid you know that some Dutch people are so addicted to their devices that they'd rather give up sex, vacations, or even a finger than their phone?
How WhatsApp voice memos help Senegal's farmers
Selin KirWithin the digital realms of our smartphones, WhatsApp groups cater to diverse intents: exchanging witty dad jokes, soliciting style counsel ahead of night-outs with friends, or …
Playing Pong with lab-grown brains
Kelly van GemertBiotechnology startup Cortical Labs successfully guided human brain cells in a petri dish through a simulated game of Pong.
Nurturing architecture
Ruben BaartThe way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.
The World is not a Desktop
Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …
Blood Cells 2.0
Marcel van HeistUnlike many people fear that computers will overtake humans, Ray Kurzweil states that robots will merge with humans, robots the size of cells which can do the job way more …
Fresh from the Pharm
Gordon TiemstraWill we in the future still buy several needs according food in shops, or will we grow M&M’s ourselves? There is a lot happening on in the field of food technology , think for …
Douglas Coupland: A radical pessimist's guide to the next 10 years
Hendrik-Jan GrievinkDouglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …
Go forth, Buy a Smartphone and Reproduce Thyself
Hendrik-Jan GrievinkIt took some years of evolution to turn sex (between different sexes) from a stricly functional activity attuned to reproduction, into the recreational activity it is primarily …
Monitoring your computer's activity like a frog pond
Koert van MensvoortMulti-touch designer and developer Richard Monson-Haefel considers sound as an important part of our user interfaces. As an application of " Calm Technology " which revolves …
Nanoparticles in Sunscreen Damage Microbes
Koert van MensvoortNanotechnology has been hailed for its benefits because of the potential ability to create drugs that could cure cancer and radiation poisoning, make miniature pollutant filters …
Next Nature Movie #1: Quest for Fire
Koert van MensvoortThe Quest for Fire (1981) shows the Next Nature of 80.000 BC. Set in a world without highways, supermarkets, airports, Internet, television, farming, money or written language, …
End of Life Care Machine
Marco van BeersDesigner, artist and engineer Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …
Jet Powered Barbecue
Koert van MensvoortAt first sight it seems plain wrong to roast your burgers on this utterly technological machine: barbecuing is supposed to be a nostalgic low-tech activity that brings us back to …
Let the Robotic Farmers feed the World
Koert van MensvoortThe future of farming is not to be found in further mass-industrialization nor in the return to traditional farming with man and horse power, but rather in swarms of smart, cheap robotic farmers that patiently seed, tend and harvest fields one plant at a time without the need for damaging pesticides.
Rachel Armstrong - Living Architecture
Koert van MensvoortVenice, Italy is sinking. To save it, Rachel Armstrong says we must develop living technology.
3D Print a New House in One Day
Jonathon Markowski3D printers using concrete can now create complete houses from the ground-up.
Care for a Meat Flower Amuse?
Koert van MensvoortVegetarian food products typically mimic existing meat products. The meat flower reverses this principle.
Le Bistro In Vitro @ Dutch Design Week
Koert van MensvoortThis whole week you can come and taste meat ice at Le Bistro In Vitro in the main hall of Eindhoven University of Technology.
What You Feel Is What You Get - Smartphone for the Blind
Shikha SacharA revolutionary new smartphone for the blind uses a completely tactile interface.
Yes, Naturally
Ine GeversThe introductory essay from the Yes, Naturally book - available in our store!
Bionic Plants
Alessia AndreottiScientists designed a way to improve the efficiency of plants light harvesting during the photosynthesis, using nanotechnology.
H / AlCuTaAu: a New Artificial Mineral
Lotte BiesheuvelA new artificial mineral made of technological artifacts, such as computers, tools and machinery.
Listening to Wi-Fi
NextNature.netModern technologies give deaf people the ability to hear again, not only regular sounds but also the invisible Wi-Fi signals.
NANO Supermarket Best Product 2014
Alessia AndreottiA jury of design and science experts awarded the best NANO Supermarket product a € 2.500 prize.
Need to Unplug? There is an App for that
Koert van MensvoortAt times it seems we serve our technology as much as it serves us. The OFFTIME App wants to save us from our own devices.
No Future for Traditional Meat
Alessia AndreottiAt Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook
Analogue vs Digital: Self-Driving Cars
NextNature.netThe image on the left is a car, as we know them. It has a lot of digital technology in it already, but not nearly as much as the other one.
Analogue vs Digital: Still Antisocial
NextNature.netSome modern thinkers argue that new technology is making us antisocial.
Ingestible Device to Monitor Vital Signs
Margherita OlivoBiomaterials researchers at MIT came up with a very tiny device able to monitor vital signs from deep inside the body.
Mini's Augmented Reality Driving Goggles
Yunus Emre DuyarThe popular car brand is working on augmented reality goggles that enhance the driving experience.
Organs Could Self-Heal with Nanoneedles
Yunus Emre DuyarAn international team of scientists used nano-sized needles in order to promote production of new blood cells.
Soil-Free Farming in the Desert
Yunus Emre DuyarA special absorbant film that require no soil may be able to grow plants more efficiently than soil farming.
Teasing the Internet of Things
Yunus Emre DuyarWhen there is such abundance of areas where IoT could be applied, several ridiculous, unnecessary products are inevitable.
Wasps Inspire Robotic Needle for Surgery
Daniel FragaThe Wood-Boring Wasp inspired scientists to create a new robotic needle which will be used in brain surgery.
Anonymity Becomes the New Privacy
Ioana TomiciArtists respond to biometric technology and data collecting software through subversive projects.
Bye Bye BlackBerry
Ruben BaartBlackBerry has just confirmed that it will no longer create its own phones, marking the end of an era for the once dominant leader of the smartphone market.
Human Cloning Now Possible in China
Daniel FragaIs human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.
Medical Practice Aided by Robots
Ioana TomiciRobots in health care could lead to a doctorless hospital.
Turning Contact Lenses into Screens
Margherita OlivoA polymer film coating can turn contact lenses into computer screens.
Fellow Day: Next Senses
Ingmar NieuweboerOn June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.
How Rare Is Virtual Gold?
Lewis JustPart one of a ten part series exploring the design of an invisible technology: money.
A System that Predicts Crime
Ingmar NieuweboerAn experiment tries to prevent crime by identifying aggressive behavior with new surveillance technology before actual violence is used.
The World's First Cyborg Olympics
Margherita OlivoThe first cyborg Olympics will take place in Zurich in October.
AI & VR Impact on Architects and Engineers
Megan Ray NicholsFuture workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.
Longest Lived Human Embryo in a Lab
Elle Zhan WeiScientists keeping a human embryo alive in lab for 13 days for the first time.
3D Printed Capsule Replaces Needle Injection
Julie ReindlA needle free oral delivery system might in the future dissolve the old way of vacancies injected by syringes.
Robotic Pillow Breathes to Help You Sleep
Charlotte KuijpersA smart, huggable bed partner, who also improves your sleep quality. Sounds great, right? Soon, you might be able to order one yourself: Somnox is a soft robotic pillow that gently breathes as you hold it.
Jobs for Facilitators - Robots at Work #3
Mathilde NakkenThis is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.
Smart Fabric Might Be the Key to the Future
Charlotte KuijpersResearchers designed a smart fabric able to encode data readable by a magnetometer, like the one in your phone, without electronics or batteries.
Stay Young with Millennial Blood
Ruben BaartA clinical startup sells millennial blood to reverse aging.
Bacteria Are the New Hard Drives
Daniel FragaDNA is the densest known storage medium in the universe - and Harvard University researchers have managed to use it to store GIFs inside bacteria.
Artificial Womb Workshop at Border Sessions
Elle Zhan WeiAt Border Sessions Festival in the Hague a workshop was hosted by Next Nature Network on the artificial womb.
Your Next Nature guide to Dutch Design Week 2018
Meike SchipperOver time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …
Gamers are the new athletes: Sports in video games from Pong to VR
Jack CaulfieldSports have always had an important place in human societies, providing entertainment, exercise, and a demonstration of the exceptional things the human body can achieve. But in a …
In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light
Kelly van GemertThere was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …
The artificial womb: are we ready?
Ruben Baart“Within a few years it will be possible for a premature baby to continue to mature in an artificial womb,” says gynecologist Guid Oei. It is therefore that the Artificial Womb: …
The Artificial Womb project receives funding to develop a prototype
Freya HutchingsHooray! The team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
Beyond biomimicry: a new urgency
William MyersDesigners face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …
Oded Ezer discusses the future of typography and the importance of dreaming
Freya HutchingsOded Ezer is a typographer from Israel who never fails to push boundaries, or rather, discard them altogether. Ezer is a rebellious force that swings between commercial and …
Next Nature went to China!
Next Nature DevWe are proud to invite you to our largest showcase (so far), currently on display at OCT Art & Design in Shenzhen, China. Spanning across three floors, with a total surface of …
Five ways AI could make your car as smart as a human passenger
Max EizaDriving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …
This startup is growing sushi-grade salmon from cells in a lab
Vanessa Bates RamirezAs the ills of factory farming become more pronounced, people are increasingly gravitating towards vegetarian or pescatarian diets. Besides producing a large percentage of our …
Next Generation: Cooking with viruses with Pei-Ying Lin
Britta de VriesThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Next Generation: Designing modular fashion with Mathilde Rougier
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Simulating textile ecosystems with Scarlett Yang
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Seeing in 3D
Leanne VoshellIf you are a regular reader of content from Next Nature, then you know that 3D printing can be used in all sorts of technological developments, such as organ printing , food waste …
A button that tells your boss you're unhappy
Ruben BaartWith gyms closed and millions cooped up and restless at home, it’s little wonder that “healthtech” is now being billed as the next big battleground over which the likes of …
A message from volcanic rocks
Laura van den BrinkAlthough it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …
This electronic skin enhances our virtual tactile perception
Kelly van GemertFrom mouse, to stylus, to finger: our virtual tactile perception has changed a lot over the years, just like our overall virtual experience. With new developments our virtual …
Next nature disasters: the Facebook outage of 2021
Veronica FanzioWhere were you on the 4th October 2021? During the day that will be remembered for the Facebook outage, not everyone was equally impacted.
Exploring assisted evolution with Prof. Dr. John van der Oost
Marit BeerseAssisted evolution raises complex questions. The practice involves human intervention to increase the rate of natural evolutionary processes. A technique that inevitably …
Emma van der Leest wins ECO Coin Award 2022
Next Nature DevEach year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honour them with our ECO Coin …
Scoring music hits with Grimes using her Elf. Tech
Selin KirThe music industry is witnessing drastic changes. With the emergence of artificial intelligence technology, no industry has been left untouched and there are broad discussions …
Meet Indonesia's virtual news anchors
Kelly van GemertVirtual news anchors seem to spread like wildfire across Asia. We've witnessed Xinhua present the news from China and applauded Lisa on becoming India’s first regional AI news …
Next Generation: Going viral with lab-grown meat and Leyu Li
Kelly van GemertTo explore the public opinion towards cultured meat, speculative food designer Leyu Li created fictional influencer “Meaty Auntie” and turned to TikTok.
I'm not a robot: AI better at proving to be human than humans
Kelly van GemertResearchers at the University of California discovered that bots now excel at solving CAPTCHAs faster and more accurately than humans.
Nature So-called
Michiel SchwarzNature is not what it used to be. Or at least that is what we may think, when we look at the way humans and their technologies have treated nature. When we speak of "nature", …
First A4 colour e-paper unfurled
Koert van MensvoortPhilips presented an A4-sized colour electronic paper . A paper-thin and bendable viewing panel. "This represents the next generation in display technology," Chung In-Jae, chief …
Evolution in the Bedroom
Arnoud van den HeuvelGood morning anywhere in the world! Waking up is a problem (at least for 50% of the population). That's why alarm clocks exist; machines and devices are invented to solve …
Making Objects Invisible: It's getting easier
Koert van MensvoortTheorists predict a new class of materials that could render objects invisible. The materials work because they interact with light in unusual ways. Researchers are beginning to …
Voyage of the Bacteria Bots
Dr NaturalThe 1966 science-fiction movie Fantastic Voyage famously imagined using a tiny ship to combat disease inside the body. With the advent of nanotechnology, researchers are inching …
Want privacy? Use pigeon messaging
Koert van MensvoortOur society seems to be driven by an obsession of gathering personal data. Yes, they say it is for your own good, so we willingly collaborate by filling in our most intimate …
BVPS Next Nature in LA - Pictures!
May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …
Food Design in the 21th Century
Koert van MensvoortOld nature provided us with a wide variety of food: fresh milk, crispy vegetables, nutritious meat. Yet this is not enough, we want more: We want a printed steak , square …
Think Hello
Arnoud van den HeuvelRemember Asimo ? Honda has now developped a new Brain-Machine Interface technology that allows humans to control the humanoid robot simply by thinking certain thoughts. The BMI …
Wifi Dowsing Rod
Koert van MensvoortToday's technology advances so rapidly that people are often unable to update their media schemas in time and as a result are left cluelessly in awe of it all. Mike Thompson's …
First man infected with computer virus
Arnoud van den HeuvelDoctor gets chip. Chip gets virus. Virus infects other devices... Dalek shoots doctor? Dr. Mark Gasson of Reading University implanted a RFID chip under his skin last year. It is …
Having Invented the Gods, Perhaps we can Turn into Them
Jason SilvaMy name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …
Intimacy Dress
Koert van MensvoortThe Intimacy dress takes our notion personal space to a next level: the closer someone approaches, the more transparent the dress becomes. As such, the garment becomes a sort of …
Nano Supermarket – Call for Products
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
Nano Supermarket on Dutch TV News
Koert van MensvoortThe Dutch evening News payed a visit to our Nano Supermarket to familiarize the television viewers with the intricate world of nanotechnology and its potential impact our economy …
Nano Supermarket Opens its Doors
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
Next Nature Movie #6: The Matrix
Koert van MensvoortIn the last few decades there have been numerous films that take the struggle between mankind and its increasingly intelligent and autonomous technology as a leitmotif. Ranging …
Our Heart as a Power Plant
Marco van BeersNanowire generators could one day lead to medical devices powered by the patient's own heart. A tiny, nearly invisible nanowire can convert the energy of pulsing, flexing muscles …
Special in Groene Amsterdammer
Koert van MensvoortThis week the oldest and classiest Dutch newsmagazine De Groene Amsterdammer features an 11-page special with lots of material from the forthcoming Next Nature book The special …
System Animals
Koert van MensvoortWhat animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …
NANO Product: The Necklace
Koert van MensvoortBreast cancer is a disease that comes with feelings of helplessness and loneliness. This nanotechnological necklace allows you to regain some control regarding your disease, in …
Nanotech Diatoms
Allison GuyNo, those aren't plastic trinkets or beads from a craft store. They're diatoms, a group of single-celled algae, and unlike almost all of our current technologies, they can rapidly …
Structuring biomimicry, improving building's resiliency
Wilfredo Mendez VazquezThe same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …
That Website Smells!
Jesper van den ToornDo you ever miss being able to smell the woods in an online travel journal? The odor of a new leather jacket in an online shop? Or perhaps you just couldn’t find the words in an …
The NBIC Convergence: When Machines and Matter ‘Have Sex’
Rachel ArmstrongThe Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …
From Eco-Apartheid to Earth Democracy
Vandana ShivaDo humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
In-Vitro Hamburger Sponsored by Google
Koert van MensvoortMore remarkable than the look and taste of the burger, which only stood out because it was presented in a petri dish and described by one of the panelist as 'hot', was the revelation that Serge Brin, co-founder of Google.com, financed the project.
Nanotech Shots Take Mice from Drunk to Sober in Minutes
Stephen PerryEver curse the fact that you have to wait hours to sober up after a night at the bar? Now, you can sober up almost instantly – that is, if you're a mouse. Researchers at MIT …
Binary Code Able to Act Like DNA
Alessia AndreottiThere is a similarity between strings of binary and strands of organic DNA: they both carry actionable information encoded into reconfigurable symbols. Using nature’s biodiversity …
Human Workers Get Increasingly Obsolete
Alessia AndreottiRobots are coming to replace humans at work, are they a real threat to the world’s unemployed?
Making Seawater Drinkable with Nanotech
Robin BergmanFiltering sea water to drinkable fresh water is no longer science fiction.
Making the Skin your New Touchscreen
Alessia AndreottiA tool that could turn the arm into a touch screen display.
Super Computer Chips
Robin BergmanIndium gallium arsenide couldbe the material of the new super computer chips of the future.
Caress of the Gaze
Koert van MensvoortDesigner Behnaz Farahi envisions an interactive 3D printed outfit that can detect and respond to the gaze of the other and respond accordingly with life-like behavior.
Dynamic Exoskeleton Chair
Svetlana MironcikaAn exoskeleton chair that allows the body to move freely.
Ear-Free Headphones
Alessia AndreottiUsing bone conduction, this device allows to hear the sound directly in the head, keeping the ears free.
Flights Delayed Due to iPad Crash
Yunus Emre DuyarDozens of American Airlines flights were grounded as pliots' iPads crashed.
Intelligent Bikini Tells You How to Tan
Alessia AndreottiThink you've had enough sun? Ask your bikini!
Local Deliveries: Robots or Drones?
Margherita OlivoStarship, a robot that will remodel our local deliveries system.
Next Nature Talk at IoTx in Dubai
NextNature.netGoing to the lustrous IoTx conference in Dubai this year? Don’t miss out the Next Nature lecture.
Ocumetrics Bionic Lenses can Triple Your Eyesight Capability
Daniel FragaDr. Garth Webb, an optometrist from British Columbia, has invented the Ocumetics Bionic Lens : lenses that after being implanted through an eight minute surgery, improve eyesight …
Prodigious Yogurt Can Reveal Cancer
Margherita OlivoAn extraordinary yogurt that could soon implement accurate, young disease diagnosis.
If a Robot Buys XTC on the Dark Web, Who is Responsible?
Alexandra BremersThe Random Darknet Shopper, with bitcoin to burn, has purchased counterfeit jeans, master keys, dodgy cigs and even a bag of ecstasy tablets. Who is legally liable?
See Through the Skin with Your Smartphone
Wei Lun WangIn the near future he ability to see through things won’t be a dream anymore with this infrared smartphone camera.
Cellphones Go Feral
Alejandro AlvarezAfter reports of Samsung phones causing serious damage, plane delays and even hospitalization, the company made a first recall. However, the new phones were still bursting into flames.
A Cryptocurrency Helping to Cure Cancer
Lewis JustPart two of a ten part series exploring the design of an invisible technology: money.
Future of Feelings: Emotion Reading Radio
Mathilde NakkenResearchers have the developed the EQ-Radio: a tool to read people emotions from a distance.
Designer Govert Flint applies motion to everyday life
Ingmar NieuweboerInterview with Govert Flint, designer, architect and self-taught artist.
Using Nanobots to Treat Depression
Alejandro AlvarezA team of scientists has developed a way to deliver drugs into our body using nanobots as vehicles and our toughts as controllers.
Re-introducing Extinct Species
Margherita OlivoExtinct European bisons are being reintroduced in parks. But what makes a national park?
Will We Share .thought Files?
Mathilde NakkenWith the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.
Storing Knowledge for Eternity
Margherita OlivoResearchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.
A Tablet for the Visually Impaired People
Margherita OlivoU.S. researchers are working on an affordable braille tablet for blind people.
Carpooling into the Future
Elle Zhan WeiAmerican company Ideo has taken the essence of on-demand economy at heart, presenting a vehicle with detail-designed services for the future of carpooling.
Color Lessons from the Cotinga Bird
Lydia HaldersBrighter inks, without pigment: nanostructured capsules could bring about paints and electronic displays that never fade.
Design Your Own Vegetables
Ruben BaartWith her project Future Food Formula, food designer Chloé Rutzerveld is looking for innovative methods to design vegetables.
Designer babies: the kids of the future?
Megan Ray NicholsWhat if you had the choice of sparing your child from diseases and disorders such as Alzheimer’s disease, heart disease or autism?
Gene Therapy Cures Chronic Disease
Elle Zhan WeiGene therapy can cure up to 200 different diseases and the list is growing.
Google Cars Can Now Sniff Out Pollution
Jack CaulfieldGoogle cars can now measure urban air quality and collect data to create interactive maps with the most detailed views of pollution patterns ever created.
Helix, the App Store for Your Genome
Charlotte KuijpersStartup Helix launched an online hub where you can digitally explore your genetic code by downloading different apps on your computer or smartphone.
Looking into the Artificial Eye
Elle Zhan WeiSensor specialists recently developed a sensor that mimics the mammalian eye.
New in: Next Nature Memory Game
NextNature.netWe are pleased to announce the launch of the Next Nature Memory Game. Now available in our web shop, it playfully explores the shifting borders between biology and technology.
Payment by Wedding Ring
Ruben BaartThe Tappy 'smart ring' is a wedding ring connected to your bank account.
Virtual Networking, the Future Social Media
Megan Ray NicholsVirtual reality is already becoming a part of the conversation surrounding social media. Will it become the next popular social network?
How AI and genomics will impact the future of making babies
Vanessa Bates RamirezAs if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
What an artificial womb may look like in the future
Hendrik-Jan GrievinkIn the future, artificial wombs could replace incubators as they mimic the natural environment of the female uterus. But what will these devices look like?
Aleph Farms wants to bring clean meat from the lab to the next farming industry
Kelly van GemertGrowing meat artificially, instead of within an animal, may soon be an available reality. Meet one of the pioneering developers of this product of the future: Aleph Farms. With …
How a museum encourages its visitors to examine their relationship with their environment
Linda ValentaLast month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …
Your next doctor might just be a robot
Jack CaulfieldConventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …
On the origin of the e-bike
Huub EhlhardtThe oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …
Next Nature Night: Future food is on the menu
Next Nature DevAlways thinking about food? What about food that doesn’t exist yet? On the 18th of September at De Studio, Next Nature Network will host a night of talks on the future of food and …
In conversation with Jalila Essaïdi
Freya HutchingsWhat do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …
Maurizio Montalti talks about the cycle of life
Meike SchipperAs modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …
Next Generation: Visualising the diversity of microbial species with Valerie Daude
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The origin of the LED lamp
Huub EhlhardtFor thousands of years people used oil lamps and candles to illuminate their homes during the hours of darkness. Neither produced much light and both were inconvenient in use as …
Taco futures: In vitro meat in Mexico City
Alejandro AlvarezOur In Vitro Meat Cookbook has inspired many people around the world. Just recently, we had the BBC over at our headquarters to see what makes us thick. This idea of in vitro meat …
Meatable: from stem cells to pork chops
Vanessa Bates RamirezThe food chain has always worked roughly like this: sunlight feeds plants. Plants feed insects. Insects and plants feed animals. Plants and animals feed people. Then …
Our Next Nature Future Lab plan received funding
Next Nature DevHooray! This just in: Next Nature Network is granted a significant contribution from the Dutch government intended to develop a Future Lab for design & technology in Eindhoven …
Next Generation: Shimmering nature with Elissa Brunato
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Embracing the Future with Patricia Piccinini
Freya HutchingsPatricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …
Next Generation: Combining AI with human creativity with Sofia Crespo
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
This exhibition explores love in the internet age
Ruben BaartData Dating is an exhibition that explores what it means to find romance in the internet age. Love it or hate it, technology has transformed the way we date. So, how are digital …
Towards a global society as a superorganism
Ruben BaartToday we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
How can Big History help us think about the future?
Noriko Wynn'Big History' is a multidisciplinary study that seeks to put the human story into the context of a 13.8 billion-year story from the Big Bang to now.
An artificial skin to breathe underwater
Leanne VoshellThe human world often sees itself as separate from the rest of the natural world. Because we have deemed ourselves, ironically, as higher functioning beings over all others on …
Next Nature plans for Evoluon honored with Region Deal
Next Nature DevGood day astronauts of spaceship Earth! Today it was announced that Next Nature's plans for the Evoluon have been awarded a financial contribution of €7.6 million from the Region …
Fish-inspired soft robot takes a deep dive
Dimitris TsakirisThe deepest regions of the oceans still remain one of the least explored areas on Earth, despite their considerable scientific interest and the richness of lifeforms inhabiting …
Join us at the DDW Talks: Next Biodiversity
Next Nature DevThe influence of humans on the earth can hardly be underestimated. Think of climate change, deforestation, and the decline of biodiversity. We are heading for a sixth mass …
Metaverse: 5 things you need to know
Steve BenfordWhat is the metaverse and to what extent should we believe that the vision being presented to us is really going to be central to our daily lives?
We could power households from the scraps in our food waste bins
Ananya MukherjeeImagine if you could power your kettle using the energy generated from the vegetable cuttings quietly breaking down in your kitchen’s compost bin. That reality might not be so far …
Don't miss this multi-sensory exhibition by Studio Drift
Leanne VoshellShimmering lights drifting as elm seeds in the wind, luminous strings of light shifting between man-made and natural structures, dandelion seeds melding with brass and light. …
This year's electronic waste weighs more than the Great Wall of China
Vanessa Bates RamirezIt’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics
FIBER Festival 2022: an exploration towards an alternative future
Marit BeerseFIBER Festival explores the future of a changing world through audiovisual art, daring conversations, and experimental electronic music.
Growing artificial muscles
Marit BeerseA team of researchers from Freiburg University has developed an artificial muscle that may result in improvements in medicine, prosthetics, and implants.
The Limits and Beyond: A report about the future
Marit BeerseIn 1972, the Club of Rome published The Limits to Growth, a report about the future of the world. They described the limits of the world’s resources and what it is capable of …
The Moon Gallery: the first museum in space
Ruben BaartThe Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …
Publish your graduation project
Next Nature Dev*Our open call will continue for another month due to popular demand* Calling all art students, academics and everything in between. Are you a recent graduate (or soon to be)? Do …
Are plants our new co-composers?
Lucas ZarzosoMusicians have stumbled upon an unconventional and intriguing creative partner: plants. Yes, that's right, plants. Through the use of advanced sensors and software, …
Why we need space janitors
Kelly van GemertReduce, reuse, recycle. We know the drill. But how do we cope with a junkyard in space?
Enter the symbiocene
Glenn AlbrechtWhat if we would use the idea of symbiosis as the basis for the next period of Earth’s history?
Next Nature is ancient
Ruben BaartUli Westphal's Seed Series is an ongoing attempt to document the seeds of all edible plants, one seed at a time.
Excitement Clothing
Koert van MensvoortThe body suit pictured above has LEDs that illuminate according to the wearer's state of excitement. Skin signals are measured and change light emission through biometric sensing …
Do you "MIND"?
Arnoud van den HeuvelNeuroSky (founded in 2004) innovator in "wearable" bio-sensor/signal processing systems and SEGA TOYS are developing mind-controlled computer games and next generation consumer …
Paradise by the Laptop Light
Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on 23 November 2007 16:30, as part of STRP Art …
Information Decoration: Our Environment as an Information Carrier
Koert van MensvoortPicture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …
Interview with a cyborg
Arnoud van den HeuvelErich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …
Magical Interaction
Koert van MensvoortMan's ability to control illumination is magical in itself but is seldom experienced as such because light switches are purely functional and generally don't stir up imagination. …
Nanosculpture
Arnoud van den HeuvelThis copy of Rodins "Le Penseur" / "The Thinker" (1880) shouldn't have that much on its mind... By using laser-technology, Korean researchers have crafted the microscopic version …
Philips Vibe Emotion Sensor
Arnoud van den HeuvelThe VIBE - emotional sensing necklace combines conductive ink and textile sensors. The necklace can read multiple biometric signals of the wearer and communicates them to other …
True Knowledge beats Google
Arnoud van den HeuvelWhat you are looking at, is the logo of perhaps the (in idea) biggest competitor on the search-engine market. It is beta-testing right now, but its demo video looks promising. Why …
X-finger
Arnoud van den Heuvelwired.com | video | Related posts: Robotic hand | Bionic arm Invented by Dan Didrick of Naples, Florida, the device has NO batteries, electronics, servos or actuators. Instead, …
Biomechanical Energy Harvesting
Arnoud van den HeuvelLet's face it: every time your cellphone battery runs empty you feel amputated and you quickly run back to your house to connect to a powering-adapter. Bionic Power Inc. is now …
Call for Proposals: Designing for Next Nature
Nowadays, children know more corporate logo's and brands than bird or tree species. The average Western person has more worries about the instability of financial markets and …
Gel Remote
Koert van MensvoortHuman-product relationships increasingly play out in a realm which was previously considered exclusive for human-human and human-animal relationships. Panasonic now redesigned one …
Human body farm
ElinWhy not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …
Interactive Nanotech Food
Koert van MensvoortNanotechnology isn't just protecting your food - it's in your food. Scientists are manufacturing nano-sized vitamins that are easier for our bodies to absorb. In the future they …
Let the Dutch bury the Carbon
Koert van MensvoortToo much carbon emissions warming up the planet? No problem: just bring the stuff back to where you got it from in the first place. Experts have been advising to bury carbon …
Peer-to-Peer Immigration
Koert van MensvoortAt the beginning of the computer era, many objects and experiences from everyday life were transferred to the digital environment in order to make technology understandable (think …
Voodoo Communication Device for Lovers
Koert van MensvoortVoodoo is an ancient religion, originating from Africa, who’s mystical practice is believed to bring reward to those who are willing to place their destiny in the hands of loving …
Water in my phone
Koert van MensvoortWater inside your phone used to be rather devastating, but with the NEC FOMA N702iS (only in Japan) , designed by Oki Sato, it is turned into a joy. Watch the faked fluid move on …
Do It Yourself Pet
sijmeImage: A. Sidorov Have you ever fantasized about creatures which carry the biggest smile? Or creatures which are so deeply covered with fur that you wish they were real? Good …
Ear on your arm? Why not?!
ewesFor over 40 years Australian artist Stelios Arcadious Stelarc has made art with medical instruments, prosthetics, robots, virtual reality systems and biotechnology to investigate …
Eyeborg
Arnoud van den HeuvelThe Eyeborg Project is the work of Rob Spence, a 36 year old filmmaker residing in Toronto, Canada and Kosta Grammatis – an unemployed engineer from San Francisco, California. …
Forefather Ox cloned to revive delicious Steak
Koert van MensvoortDelicious retro-future meat from Japan. Food technology in the overdrive. Japanese researchers successfully cloned what is believed to have been the forefather ox of Gifu …
How biotech will drive our evolution
Koert van MensvoortAre you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …
iReligion
Koert van MensvoortGraphic designer Roel Boonen takes the Apple cult to the extreme with this iReligion triptych. His piece is illustrative on how central corporations and digital technology have …
No Signal
Arnoud van den HeuvelAs technology evolves, people are more and more depending on it to function properly. But the nature of technology is that it needs networks, sources, software, batteries and …
The Next Hacking Frontier: Your Brain
Dr NaturalWiredScience writes: Hackers who commandeer your computer are bad enough. Now scientists worry that someday, they’ll try to take over your brain. In the past year, researchers …
There’s Plenty of Room at the Bottom
Hendrik-Jan GrievinkSo you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …
iBookshelf: Simulation before Extinction
Koert van MensvoortAs technology progresses we constantly have to adapt ourselves to an ever changing media landscape. Designers try to smooth the changes with a ' progressive nostalgic ' strategy: …
Nano Tattoo to Monitor Diabetes
Marco van BeersNow here is something for the NANO Supermarket : Massachusetts-based Draper Laboratories have developed a special injectable ink with nano–particles. This ink eventually could …
One day at the Dentist
Koert van MensvoortDo you also have that feeling sometimes that your dentist is undertaking all kinds of activities in your mouth that aren't really necessary? Yet, you usually just trust the …
A bacteria of a different color
Allison GuyIn 2009, undergraduates at the University of Cambridge worked with scientists and artists to engineer E. coli into E. chromi , a new type of bacteria that secretes a range of …
Amber Case: We are all Cyborgs Now
Koert van MensvoortTechnology is evolving us, says cyborg anthropologist Amber Case in her 8 minutes of TED . We become a screen-staring, button-clicking new version of homo sapiens, relying on …
Apes Like Cooked Food, and What that Means for Human Evolution
Allison GuyHumans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …
Catalytic Clothing
Koert van MensvoortCatalytic Clothing is a fashionably calm technology that aims to tackle air pollution by embedding a substance in the clothing that purifies air when you wear it. The purifying …
Flap to Freedom
It works like this. Position yourself with a friend in front of a battery hen and flap your arms as fast as you can when the music sets in. The harder you flap the faster your …
Humanthesizer
Vincent KlerkxThe human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …
![Visual of Manko & Life [#8]](https://nextnature.net/media/pages/magazine/story/2011/manko-life-8/f762250e48-1602632753/manco-8-868x486.jpg)
Manko & Life [#8]
Aston RevolaManko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …
Nano Product: Pharmaceutical Sushi
Hendrik-Jan GrievinkAre we creating the penicillin or the asbestos of the 21st century? Prior to the arrival of the Nano Supermarket , we share some speculative nanotech products with you. Here’s the …
Robot Guide Dog
Stefan Fincken#! Possibly the answer for blind people with cynophobia, the fear of dogs. This robot guide dog is stil a bit slow compared to the old nature version, but as technology advances …
Streetlight Trees
Marco van BeersWe all know the cellphone masts disguised as trees , created in an attempt to blend technology within the 'natural' landscape. Now Taiwanese scientists have created trees that …
Swallowable Parfum
Koert van MensvoortSwallowable Parfum is a digestible scented capsule that works through your own perspiration. Once absorbed, fragrance molecules are excreted through the skin’s surface. A unique …
A Clockwork Forest
Hendrik-Jan GrievinkHas nature become a fairytale or do we want it to be one? In their installation The Clockwork Forest , artist collective Greyworld seems to opt for the latter. The work of art …
A Winery in your Microwave
Hendrik-Jan GrievinkA delicious Montepulciano in only 6 seconds? This is now possible with the universal Nano wine. All you need is a microwave oven. In 5,64 seconds at 1000 watt you have a sublime …
Corn 2.0: Survival of the Cheapest
NextNature.netCongrats to Sean Serafini, the winner of our April Next Nature Spotter contest. While we received many images of fake nature , Sean's entry delves deeper into more diverse next …
Genetically Engineered "Arctic" Apple Will Never Turn Brown
Allison GuyCanada-based Okanagan Specialty Fruits is pitching a genetically engineered apple that does not turn brown when bruised or exposed to air. This new technology, available in both …
Illiterate Kids Learn to Hack Tablet Computers with No Outside Help
Allison GuyThe One Laptop Per Child program is experimenting with what at first seems to be the lazy way to philanthropy: dropping off tablet computers in remote Ethiopian villages and then …
Macbook Pro Fragrance
Arnoud van den HeuvelNothing beats the factory-scent of expensive, freshly unboxed technology! Artist group Greatest Hits produced the Apple Unboxing Scent for use at an exhibition in Melbourne, where …
Mobile Phone Avant La Lettre
Koert van MensvoortOur peculiar image of the week is exemplary of our human longing for technology that intimately integrates with our body & senses. We are all cyborgs .
Nano Product: Energy Belt
NextNature.netWith Energy Belt, stop treating your excess fat like a liability, and instead embrace its untapped potential. Artificial protocells in the belt mimic natural brown fat, taking …
Nano Product: Honest Egg
NextNature.netDo away with dishonest health claims for eggs and uncertain promises of organic, free-range hens. With eggshells that change color according to hormones, medicines, and nutrients, …
Nano Product: Lungless
NextNature.net350 million years after crawling from the sea, the Lungless suit will bring us back. Inspired by fish gills, the Lungless Aquatic Respiration Suit uses millions of cascading …
Nano Product: Nansense
NextNature.netFor years, people have relied on harsh drugs and irritating alarms to control when they sleep and when they wake. Now, the Nansense wristwatch offers an all-natural way to …
Nano Product: Nico
NextNature.netNico is cute, cuddly and serious about your child’s health. Many adults smoke around children with no thought for their developing lungs. Covered in nicotine-sensitive nano-cloth, …
Nanotech Bracelet Detects Allergies
NextNature.netDesigned by Luc de Smet, Awear is a speculative bracelet that can detect and record the sources of allergies for children in uncontrolled environments, such as schools and …
Nanotech Generates the Blackest Black
As the NANO Supermarket opens discussions on the ethics, purpose and usability of nanotechnology, Frederik De Wilde is researching its artistic possibilities. De Wilde is a guest …
The Ecological Human
Rachel ArmstrongThe nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …
To Generate Electricity, Just Tap on this Virus
Allison GuyIs your friend impatiently tapping on her phone, or is she just charging the battery? Researchers at the Berkeley Lab have produced the first virus-powered generator that runs off …
What do AR-Burgers taste like?
Arnoud van den HeuvelAugmented Reality is supposed to be just over the "Peak of Inflated Expectations" of Gartner's hype cycle . This video, however, is vaulting the technology directly onto the …
Bye Bye Barbed Wire: Cow-Mounted GPS Will Enable "Virtual Fencing"
Allison GuyA device that remotely controls cattle's movements promises to transform the American landscape.
Control Your Environment with Myo
Alice FumeyA new armband interprets your muscle contractions to act as a novel computer interface.
Demo Day at Next Nature Lab
Alessia AndreottiUnpolished creativity at the Next Nature lab from the Industrial Design Department at the Eindhoven University of Technology.
Design Looking Backwards
Stephen PerryShould digital technology imitate that which exists, or could it also surpass it?
Electricity Travels Through Spider Web
Alessia AndreottiIn future electric cables could be made ??of spider webs. 100% natural electric cables, sounds like an oxymoron, but it’s possible! Researcher at Na tional High Magnetic Field …
Bionic Eye: Limited Vision to the Blind
Marco van BeersA new implant lets blind people see letters, crosswalks and people.
Food Simulator to Fulfill the Desire to Eat
Alessia AndreottiTwo master's students have created a speculative device to simulate the sensations of eating.
Buckle up for Black Sky Thinking
Koert van MensvoortHow can we anticipate what happens after the technological singularity?
I’ll Take A Variety of Fried Gadgets, Please
Alessia AndreottiIs a deep-fried iPad as unhealthy as a McDonald's meal?
Interview: Arne Hendriks, Researcher and "Father" of The Incredible Shrinking Man
Alessia AndreottiHendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.
Maya YogHurt: Fermented Drink Made with Human Lactic Acid
Jiwon KimArtist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.
Nanosponges "Soak Up" Toxins and Antibiotic-Resistant Bacteria
Jordy RooijakkersNano-scale sponges show promise for defeating a variety of bacteria and toxins.
Robots Cooperate to Save Coral Reefs
Alessia AndreottiRobots use swarm intelligence to rebuild coral reefs.
Smart Sock Makes Your Feet Speak
Alessia AndreottiA new wearable device provides runners with info on posture, rhythm and stride length.
Swallow a Pill to Turn Your Body into a Living Password
Jonathon MarkowskiNeed a password that you'll never forget and can never be stolen? Try storing it in a pill in your gut.
Transfer a Loving Tap Via Bluetooth
Alessia AndreottiA bracelet able to transfer a touch between two people.
A Conversation with Kevin Kelly
Koert van MensvoortBuckle up for a 1:11:28 interview with technology philosopher and founding editor of Wired Magazine, Kevin Kelly.
BAT Flies High in the Sky to Make Energy
Francesca BarchiesiBuoyant Airborne Turbine is a giant high altitude wind turbine that brings low cost energy to remote areas and off-grid sites.
Flying Through Your Brain
Koert van MensvoortBuckle up for some tracking technologies beyond the beyond.Buckle up for some tracking technologies beyond the beyond.
Learning Circuits While Playing With Clay
Robin BergmanKids learn the basics of electric circuits while playing with clay.
Razorius Gilletus Flexball Subspecies
Koert van MensvoortThe latest subspecies in the Razorius line is the Razorius Gilletus Flexball. While Gillete proclaims they reinvented shaving, others argue Gillette's new razor is everything that's wrong with America.
Razorius Gilletus Gold Plastic
Koert van MensvoortLike the exorbitant feathers of the peacock, which only function is to aesthetically stand out amid its competitors, this new species of Razorius Gilletus only differs from its predecessor aesthetically.
The Moon will Become a WiFi Zone
Alessia AndreottiResearchers proved it is possible to provide the Moon with the wireless connectivity we have on Earth.
The Robotic 3D Printed Spider Dress
Alessia AndreottiThe Spider Dress is programmed to define and protect the personal space of the wearer.
What Is This Strange Device?
Alessia AndreottiKids try to figure out what the "prehistoric" Walkman is and how it works.
After In Vitro Burger, Chicken is the Next
Yunus Emre DuyarSoon, we might be getting a taste of the first lab-grown chicken meat.
Drugs Testing with Artificial Organs
Yunus Emre DuyarResearchers are working on artificial organs-on-chips will be used for drug development.
Ikea's Lab-Grown 3D Printed Meatballs
Margherita OlivoIkea’s research laboratory was inspired by our Magic Meatballs to re-design their famous meatballs.
GM Pigs for Animal-to-Human Organ Transplant
Alessia AndreottiScientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.
Harvard Creates Half-Man Cyborg Flesh
Yunus Emre DuyarBioengineers at Harvard University have created the first cyborg tissue.
Heart Tissue Grown with Spider Silk
Yunus Emre DuyarIt might be possible to grow a new heart in labs using spider silk.
Jazz-Playing Robot Challenges Human-Computer Interactions
Margherita OlivoA musical robot able to improvise a jazz solo in response to an actual person performing jazz.
Let Your Drone Mow Your Lawn
Yunus Emre DuyarIf you do not want to slave away under the sun, pushing a bulky mower around, drones can do it for you.
Meet the Band Aid of the Future
Margherita OlivoThis potentially revolutionary device includes LED lights and temperature sensors to provide medication directly to the wounded section of the skin.
Modern Times Emergency Kit
Alexandra BremersIn these modern times a traditional first aid kit won't do anymore. As the world around us innovates, our needs in case of an emergency change as well.
NANO Supermarket Opens in Latvia
NextNature.netThe tour of our lustrous NANO Supermarket is coming to Riga, Latvia.
Order Anything with Amazon's Button
Yunus Emre DuyarAmazon introduced a new gadget, named Dash Button, that will help you order groceries automatically.
Our Bodies, Our Fuel
Adriene LillyThis piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.
Robot’s Best Friend
Alessia AndreottiFrom chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!
Should We Fear Thinking Machines?
Maria RamosIt seems thinking machines could put the human race in danger. How realistic these fears are?
Australians Wake Up One Hour Early Due to System Error in Their Mobile Phones
Koert van MensvoortThe glitch meant many woke an hour earlier than usual, leaving not just phone customers but whole households unhappy about rising early.
You Can Be the Avatar by 2040
Yunus Emre DuyarAlthough it still is a theory, nanotechnology might enable us to control the elements, except fire.
Are These the Headphones of the Future?
Monika KozubNo matter which brand is going to rule the wireless headphones scene, it's time to get used to have a computer in our ear that we never need to take out. Until it may grow into it someday!
Artificial Senses for Navigation
Ruben BaartA team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.
The First Beauty Contest Judged by AI
Ruben BaartThe first beauty contest judged by complex algorithms has sparked controversy after biased results.
Disney-Themed Prosthetics for Children
Ruben BaartOpen Bionics is helping children in need for bionic hands. With Iron Man, Frozen, or Star Wars-themed prosthetics, their fantasies become reality.
Doctors Used VR to Save a Baby's Life
Margherita OlivoGoogle Cardboard was used by a cardiologist to train for a very risky heart surgery on a four months baby.
Drones in Agriculture
Megan Ray NicholsHere's a look at how drones can and will impact the agriculture and farming industry.
Facebook Provides a Suicide Prevention Tool
Ingmar NieuweboerFacebook provides a new tool for suicide prevention
The First Self-Driving City Coach
Ruben BaartMercedes-Benz just revealed the first self-driving city coach and took it to the streets of Amsterdam for a test drive.
Tangible Money in Digital Currency Era
Alejandro AlvarezThe Scrip, a new universal cash device is bringing back the old metallic sparkle of the money and mixing it with today’s technology in order to fill the deficiencies of our credit and debit cards.
Next Nature and Next Generations
Elise MarcusOur workshop with kids from Lanterna Magica, an unconventional primary school in Amsterdam.
Payment by Thumb
Alessia AndreottiAustralian biohacker Meow-Ludo Meow Meow implanted a chip in his thumb to make contactless payments.
Rethinking 3D Printing for the Future
Nadine RoestenburgAdditivism is a movement that calls for radical rethinking of new technologies, such as 3D printing, the plastification of the world and our human position within it.
A Robot to Help The Refugee Crisis
Margherita OlivoIn the last months we've been witnessing a refugee crisis of huge proportions. More than a million people crossed the sea to flee violence in Africa and the Middle-East. Together …
This Robot Takes Care of Your Children
Ruben BaartThis robot nanny is designed to take on adult responsibilities, raising concerns regarding the consequences of using robots to raise our children.
Talking Contact Lenses
Ruben BaartResearchers at University of Washington have introduced a new wireless communication method that allows small wearable devices to ‘talk’ to everyday devices.
Virtual Bedtime Stories
Ruben BaartSamsung just revealed the prototype version of Bedtime VR Stories, a technology that connects parents to their children in virtual reality, right before bedtime.
Virtual Reality Meditation
Ruben BaartSpiritual leader Deepak Chopra just unveiled a 20-minute therapy session inviting us to come back to the present moment through virtual reality.
Web Training Collar
Ruben BaartJasper van Loenen developed a wearable that sends a corrective electrostatic shock to its wearer when visiting an unprotected website.
Artificial Womb: the Timeline
NextNature.netNNN is currently doing a preliminary research into the idea of the artificial womb. This timeline will help you navigate through the investigation.
Artificial Womb Workshop at BioClub Tokyo
NextNature.netOn August 8, NNN gave a workshop at BioClub Tokyo to share some insights on the future of technologies concerning human reproduction, sexuality and relationships.
1932 - "Brave New World" Published
Hendrik-Jan GrievinkAldous Huxley published Brave New World in 1932, bringing the idea of the artificial uterus to the big audience.
Growing Mushrooms on Grass
Alec SchellinxThe Juncao Technology Project makes it possible to grow edible and medicinal fungi on chopped grass or herbal plants.
Next Nature Gift Guide 2017
NextNature.netThe gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.
Selfie Time with Your Dead Beloved One
Julie ReindlForever by your side. Elrois a South Korean firm developed an app that allows you to engage with your dead friends lovers or idols.
Your Smartphone Is Your New Eye Doctor
Ruben BaartThe EyeQue personal vision tracker is a smartphone app that allows you to test your eyes from the comfort of your couch.
Van Mensvoort Writes a Letter to Humanity
NextNature.netOn the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.
Chinese farmers are using AI to help rear the world’s biggest pig population
James VincentIt’s been called China’s “pork miracle.” For centuries, pig-rearing in the country was predominantly a backyard occupation. (The etymology of the Chinese character for “home” …
Slowing down to start up: Here's the first chapter of our crypto deep dive series
Koen WeselIt takes years to design a new banknote, having hundreds of people working on every little detail, all done under the watchful eye of governments and professionals. However today, …
Towards a design brief for the artificial womb
NextNature.netHumanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …
Edible packaging: Seaweed could replace plastic in disposable packaging
Jack CaulfieldWhat to do about the plastic planet ? The seas are steadily filling up with plastic , and it's vital to find ways to address the problem . One way to do this is to move away from …
Elzelinde van Doleweerd wins the ECO Coin Award 2018
The ECO Coin Award honours outstanding ecological heroes. In 2015, we handed out our first ECO Coin award to Yoyo Yogasamana for his digitalization of sustainable knowledge to …
'I volunteer myself to try this cultured meat at my own risk'
Koert van MensvoortThe Netherlands leads in cheese, clogs, and cultured meat. This sustainable and animal-friendly form of meat has largely been developed in our country. In 1997, Willem van Eelen …
A phone that says “no” to little kid fingers
Rachel MetzIt may soon be possible for your phone to automatically figure out whether it’s you or your five-year-old who’s swiping the screen—and, if it’s the latter, block apps you want to …
Next hospitals: How virtual reality is shaping the future of medicine
Jack CaulfieldAnd it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …
Smartphone app helps indigenous communities fight deforestation
jeannedjawadiFive people suspected of illegal gold mining in Peru are in custody after indigenous community members used a system called ForestLink to alert authorities to the activity. …
Here’s what manufacturing enhanced with virtual reality will look like
Megan Ray NicholsRobots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …
Should men be able to give birth to children?
Koert van MensvoortWithin a few years, it may be possible for premature babies to grow inside an artificial womb. And when that day arrives, should men be able to give birth to children? Should we …
A vegan meat revolution is coming to global fast food chains
Malte RodlA few years ago, convincing meat-free “meat” was nothing more than a distant dream for most consumers. Meat substitutes in supermarkets lacked variety and quality. Plant-based …
Watch the BBC report on world's first artificial womb
Ruben BaartNow that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
The Next Nature guide to Transmediale 2019
Ruben BaartBerlin is kicking off its cultural season with the not-to-miss 23th installment of Transmediale . This year the digital art/culture festival focuses on how feelings are made into …
How my chatbot fell in love with me
Tim DaalderopThe virus is forcing all of us to sit at home. While we are allowed to have social contact—albeit at an appropriate distance, intimate contact is hard to find. How to cope with …
Next Generation: Creating utopian and dystopian futures with Bas Jansen
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Matilde Boelhouwer wants to make urban environments flower again
Ruben BaartMatilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …
Cyborg artist Moon Ribas feels earthquakes
Freya HutchingsImagine waking in the night, and feeling the vibrations of an earthquake on the other side of the world pulsing through your body. This is a reality for Catalan-born artist Moon …
Next Generation: Speculating about the future with Deborah Rhyner
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
A countryside dweller's guide to the future
Ruben BaartThe current lockdown in much of Europe has city-dwellers flocking to the countryside to wait out the outbreak sweeping the continent. Seeking relief from coronavirus, urbanites …
Swiping is the new touching
Nadine RoestenburgFrom all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …
CO2 injected volcanic rock could save the atmosphere
Kelly van GemertThe rapid technological advancement of the human race has led to many consequences, especially regarding the integrity of the atmosphere that protects all life on Earth. Although …
A digital twin of the Earth could make the planet climate-neutral
MaithriWhile Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …
In conversation with cyborg choreographer Moon Ribas
Ruben BaartIf we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …
How a starfish inspires robotic design
MaithriIn a feat of biomimicry that seamlessly marries biology with physics, tests carried out at the University of Southern California’s Viterbi School of Engineering made fascinating …
To save forests, researchers are hooking trees up to Twitter (again)
Ruben BaartIn July 2018, a century-old red oak went live on Twitter. The account @awitnesstree , tweeting from the Harvard Forest in Petersham, Massachusetts, introduces itself in its bio: …
What Julia Watson is reading this summer
Ruben BaartIn an era of high-tech and climate extremes, we are drowning in information while starving for wisdom. Architect Julia Watson imagines a design movement building on indigenous …
The next generation xenobots are here
Simon CoghlanIn 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …
Bio, Art & Design (BAD) Award Winners
Next Nature DevThe three winners of the Bio, Art & Design (BAD) awards have been announced.
Building with biocement
Marit BeerseUsing the waste streams from the chemical industry and urine to make biocement.
The long history of the metaverse
Tom BoellstorffMany aspects of the current metaverse were already familiar 143 years ago.
Mapping the world's DNA
Marit BeerseThe Earth BioGenome Project is aiming to create a database of genomes of all organic life on earth within 10 years.
Meet a group of young plant scientists who share their belief in the potential of CRISPR
Marit BeerseIn the summer of 2018, the European Court of Justice (that’s Europe’s highest court) reviewed a case and concluded that gene-edited crops should be subject to the same regulations …
The information age is starting to transform fishing worldwide
Ioana TomiciPeople in the world’s developed nations live in a post-industrial era, working mainly in service or knowledge industries. Manufacturers increasingly rely on sensors, robots, …
Afrofuturism explained by Professor Julian C. Chambliss
Ruben BaartThe new sci-fi musical “ Neptune Frost ,” set in a Rwandan village constructed with computer parts, tells the story of an intersex hacker and a coltan miner who lead an anarchist …
Building Floriade 2022
Next Nature DevWe met at the Floriade grounds in Almere with Xander de Bruine, program manager Floriade Expo 2022, with project manager Jennifer Palumbo. Along with head curator William Myers we …
This billionaire wants to live forever
Eleni MaragkouFrom the mythical fountain of youth to the many anti-aging procedures available today: humans have dreamed of internal youth for a long time already. At lot of us perceive aging, …
Paco Rabanne's AI-designed perfume can connect with your phone while making you smell sexier
Selin KirPaco Rabanne already positioned himself as a cutting-edge designer by establishing his reputation as one of the trailblazers during the space age movement of the 1960s. With his …
This satellite generates and sends solar energy to Earth
Kelly van GemertThe next solar farms might be located in space, instead of on Earth. A prototype satellite by Caltech launched in January seems to be up and running, showing its capability to …
Gigantic lab-grown mammoth meatball feeds an entire family
Saskia WesselingResearchers used genetic information from an extinct mammoth to create a lab-grown meatball.
Soon you can have dinner in space in a low-carbon balloon (if you're rich)
Kelly van GemertGet ready to take your dining experience to literal new heights, soon we are able to enjoy high cuisine at the edge of space. French company Zephalto is introducing extravagant …
Carnerie is the grow your own meat device of the future
Kelly van GemertThis speculative kitchen device shows us a future where growing meat at home is not just a possibility but a reality.
MyPowerbank hacks bicycles so the homeless can juice up their phones
Kelly van GemertLuke Talbot has developed a solution to assist people experiencing homelessness in charging their phones for free by hacking rental bicycles.
Using bacteria to create self-fired and biologically glazed ceramics
Kelly van GemertEmbracing nature's ingenuity, designer Nicole Chrysikou harnesses the power of bacteria for her pottery practices.
We now have satellite traffic jams in space
Kelly van GemertIt seems that traffic jams aren't just a problem confined to Earth's highways and byways. How did this happen? And should we be concerned?
What food design can do
Kelly van GemertFood design gives us a taste of innovation. It visualizes, speculates, challenges and problem-solves.
Furniture futures
Nellie FriedrichWondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?
Next Gen: De-exctincting the mammoth with Wendi Yan
Kelly van GemertWhat if an ancient mammoth found herself resurrected by humans into our modern age?
Cameleon concept car
Rolf CoppensThe GloCar uses LED lights to change body panel colours, intensity and frequency. A driver can thus choose at will to either stand out or blend in. Alongside the cosmetic value …
GloFish
Rolf CoppensA tropical fish that fluoresces bright red is set to become the first genetically modified pet to go on sale in the US. Alan Blake and colleagues at Yorktown Technologies …
How to grow an Orangina bottle.
Koert van MensvoortConsider an Orangina bottle: shaped like an orange it is designed to look like one. But it does so in a very primitive way. Imagine the product is the packaging. Wouldn't it be …
Plant Sensors
Koert van MensvoortOne day you will step into the garden to look at the flowers - and the flowers will look back at you. Rich Fletcher, Nikolai Slavov, and Hiroshi Ishii from MIT Tangible Media …
Save our Next Nature! Buy the book
A critical and visual take on culturally emerged Nature. Full of statements from designers and thinkers from around the globe. Wild systems, Genetic Surprises, Calm Technology, …
CrackBerry addicts are suing their Employers
Dr NaturalNo self-respecting manager would be without a BlackBerry. But now these handheld gadgets, which provide workaholics with constant email updates, are being blamed for chronic …
Hug T-Shirt
Rolf CoppensIf you're longing for the touch of a loved one who is a few thousand miles away, what better way than to pick up the Hug Shirt for the both of you? This shirt is capable of …
Next Friday: Paradise by the Laptop Light
Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on Friday 23 November 2007 16:30 - 18:00, as …
The 21th Century Paradigm
The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …
Tickle Massage Robot
Koert van MensvoortTickle is a small robot that walks on the human body to generate a pleasant, tickling sensation.It has two motors and rubber feet for a good grip on the skin. When it encounters a …
Who wants to drive in a Fish?
Dr NaturalBehold the BoxFish, Mercedes' bionic concept car. This tropical fish is outstandingly streamlined. Its engineers were able to achieve a wind drag coefficient of just 0.06 in the …
Amsterdam Weekly on the Natural Revolution
The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …
Car tech makes reality look like a game
Rolf CoppensTech company Fuijtsu released a new way to look around you while driving a car. Following the old fashioned neck turning and mirroring this tech has cameras around the vehicle to …
Gameboy Bricks a million years from now
Arnoud van den HeuvelA million years from now that hand would probably look more evolved, but the idea is nice: What if we would mold objects of the now into stone or bricks to preserve them over time …
Google tracks flue spread via sick searchers
Koert van MensvoortThis Tuesday, search giant Google released an experimental tool that tracks the intensity and movement of the influenza virus across the United States by monitoring the number of …
Human genome sequencing soon child play?
Koert van MensvoortStarting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …
Remote pets
Arnoud van den HeuvelHumans have domesticated animals for thousands of years. The earliest known evidence of a domesticated dog is a jawbone found in a cave in Iraq and dated to about 12,000 years ago …
Smart Forests - EWAN
Arnoud van den HeuvelAt Massachusetts Institute of Technology , Christopher Love and colleagues are working to find out whether energy from trees can be used to prevent forest fires. A sensor system …
Social Networking down to the Genetic Level
Koert van MensvoortIf you've ever wanted to know just exactly how much DNA you share with your ridiculously tall brother or doppelganger best friend, you'll soon be able to find out. 23andMe , a …
Battery-Free Implantable Neural Sensor
Koert van MensvoortThe shrinking size of electronics allows for the implantation of increasingly sophisticated electronic devices in the human body, paving the way for new prosthetics and …
Bioluminescent Trees will Replace Streetlights?
Koert van MensvoortMost people know about light emitting organisms such as jellyfishes, fireflies and mushrooms . Some time ago, genetic engineers transferred genes responsible for the luciferin and …
BioStream
Arnoud van den HeuvelA renewable energy technology company in Australia designed this power generation system inspired by the shape of the tailfins of sharks, tuna and mackerel. The currents on the …
Brain Scan Replaces Job Interview in 5 Years?
Dr NaturalForget about palmistry! MRI scans for candidates in top jobs such as bank directors could soon become part of the job-application package, says Erasmus University researcher Prof …
Computational Wood
Koert van MensvoortDr. Herb Smokler teaches us how to husband and harvest Computational Wood. Omitting he jerky production value of the video, one has to appreciate the inventive idea of treating …
Exmovere Chariot: the wearable wheelchair
federicaExmovere Holdings , a biomedical engineering company, is focused on government and consumer applications for healthcare, security and mobility. This company developed Exmovere …
Growing a nano forrest
Koert van MensvoortJohn Hart, assistant professor of mechanical engineering at the University of Michigan, is inventing techniques for growing carefully structured forests of high-quality carbon …
Lab creates fake DNA evidence
Koert van MensvoortDNA evidence has been the most bulletproof evidence for forensic sciences in recent years. Not anymore. A laboratory at Nucleix, a life-sciences company, has demonstrated it is …
Nanocars
Arnoud van den HeuvelThis smart-looking image is a model of what James M. Tour at Rice University (Texas) and his research team like to call a 'nanocar'. The clustered molecules can roll around on a …
Placebo Buttons
Koert van MensvoortButtons are everywhere: throughout your day you press them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the computer screen. Although buttons did …
Scientists 'grow' pork
SelbyScientists at the Eindhoven University of Technology are creating artificial pork. Prof. Dr Mark Post and his colleagues of the department of Biomedical Engineering have extracted …
Second Sight - Augmented Contacts
Arnoud van den HeuvelGetting information as fast as possible and on the spot is the trend. So what could be more direct than having information fired directly into the eye? Today - together with his …
Cough in Your Cell Phone, not Your Sleeve
Koert van MensvoortCoughing into your cell phone could soon save you a trip to the doctor's office. Thanks to software currently being developed by Star Analytical Services , people may soon be able …
HappyLife
Koert van MensvoortAs our everyday living spaces are packed with electronics and become increasingly sentient, we might one day wake up in a house that knows more about your family's state than you …
Here Comes the iPhone Virus
Koert van MensvoortBy analyzing billions of phone calls, researchers at Scandinavian telecom company Telenor , mapped how social connections between people – measured partly by how often they called …
How does your Graph feel today?
Orestis TsinalisWith all the new health management gadgets available becoming more and more widespread and cheap (even in the form of free iPhone apps), your brain, your stomach, your heart, …
Invisibility Cloak Hides Objects Visible To The Naked Eye
Koert van MensvoortSome years ago scientists managed to build a rudimentary invisibility cloak, which was an impressive device but it had some important limitations, not least of which was that it …
LED Religion
Koert van MensvoortThe Catholic Church is not exactly renowned for its progressive attitude towards technological progress. Just think of the belligerent attitude the Church still has towards …
Miniature Sensor Network for the Office
Koert van Mensvoort"Have you seen my stapler? No, but just look it up on Google home office maps ." CSIRO Researchers have developed miniature sensors that track lab equipment, coffee mugs and …
Nano Care™ Blueberry Paste Wax
Koert van MensvoortSurely we are quite attuned to some unexpected flavors in these quarters, but this Nano Care™ Blueberry Paste Wax wins our syncretic mash-up award for combining technorethoric …
Next Nature Movie #4: Blade Runner
Koert van MensvoortLook around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …
Self-healing Surfaces
Arnoud van den HeuvelWhat if a scratch on your car door could heal itself, just like the human skin does? Engineers are working on a way to transfer the self-healing ability of the skin to surfaces …
Social Networking with Plants
Ties van de WerffUsing energy is not a social activity. Every electrical device we use has its own carbon “foorpint” which, in excess, can harm other living beings. How and to what extent you’ve …
Nano Product: Spider Silk Condoms
Hendrik-Jan GrievinkAre we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …
There is not enough Africa in Computers
Koert van MensvoortBrian Eno - artist, composer, inventor, thinker - spoke to Kevin Kelly about the meaning of Africa for music and technology. "Africa is everything that something like classical …
A Savannah Inside the Dumpster
Allison GuyFor most of us, obtaining food is easy. We go to the grocery store, where fruits are labeled and meats arranged by species. We go to a restaurant, sit, and wait for our food to …
Allergen Beagle – A Home Foodscanner
Koert van MensvoortNo shellfish, no peanuts, no soy, no milk, no eggs. An increasing number of people suffer from various food allergies, which force them to constantly scan food packages for …
Babel Fish
SelbyResearchers are working on a language and a device that will help humans and dolphins talk with each other. Denise Herzing , a researcher and founder of the Wild Dolphin Project …
Blinky – Does what we want it to do
Sebastiaan WolzakIn the short movie Blinky, on a boy and his robot, director Ruari Robinson reflects on our daily dealings with technology and its risks. Alex is a child growing up in a family …
Crickets Inspire New Sensitive Sensor
Stefan FinckenInspired by crickets, researchers of the MESA+ Institute for Nanotechnology of the University of Twente in the Netherlands have build a biomimetic sensor that can measure changes …
Earth 2.0 with Rachel Armstrong
Koert van MensvoortWhat are the differences between Earth 1.0 and Earth 2.0 technologies? Rachel Armstrong explains.
Egg Sausage
Koert van MensvoortOur food production is much more technological than we typically realize. My appologies for disturbing your trance; I realize that sometimes you'd rather linger in the illusion. …
It's a plane!
Arnoud van den HeuvelBy nature, man is not meant to fly. But while we're at it, we may as well turn it into an experience . Charles Champion, Airbus Executive Vice President Engineering, envisions a …
![Visual of Manko & Nothing [#5]](https://nextnature.net/media/pages/magazine/story/2011/manko-nothing-5/8f13acd5d1-1602632753/manco-4-868x486.jpg)
Manko & Nothing [#5]
Aston RevolaManko was completely cut off from everything around him, virtually dead, buried alive inside of his own body. He remembered Zero's advice not to panic, but to no effect. He had no …
![Visual of Manko & Soup [#6]](https://nextnature.net/media/pages/magazine/story/2011/manko-soup-6/b9aa51ad29-1602632753/manco-7-868x486.jpg)
Manko & Soup [#6]
Aston RevolaWhen Nada returned as promised with a small bowl of soup in her hands, Manko was sitting upright with a grumbling stomach. Even now that Manko could see normal again, Nada's hair …
Nano Supermarket in Amsterdam
From Friday 28 January - Wednesday 2 Februari the Nano Supermarket will be opened at the Leidseplein in Amsterdam. Additionally, on the 27th of January we will be opened at the …
People are better at growing Limbs than Lizards
Koert van MensvoortWhereas lizards have the extraordinary ability to regenerate lost limbs – meaning that if the lizard loses a limb through conflict with a predator, it will grow back – people have …
Raptor in a Wrapper
Allison GuyThe appliance company Bosch claims that its new technology keeps food so fresh that meat from the Ice Age (and presumably the Cretaceous as well) can be stored without incident …
Robo-teacher
Arnoud van den HeuvelSay hello to teacher Engkey ! The city of Daegu — South Korea, introduced 29 robot teachers in 19 elementary schools as part of a large scale project to robotize teaching. The …
Should we clone Neanderthals?
Zach ZorichIf Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
Sin free for just €1.59
Marco van BeersFor just £1.19 ($1.99, €1,59) you can download an app for your iPhone which offers tips and guidelines with the sacrament, "the perfect aid for every penitent" as the description …
The Monsters We Deserve
Allison GuyRecently, a video clip has been circulating the web that purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …
The Story of our Food
Maartje SomersEvery time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …
Theriomorphous Cyborg
Allison GuyThe Animal Architecture Awards have just announced the winners of their 2011 contest. Taking first place is Simone Ferracina's Theriomorphous Cyborg , a (speculative) augmented …
Traditional Thanksgiving Meat
Marco van BeersFood technology in the overdrive: Pork molded in the shape of a piglet.
Unboxing Artificial Intelligence
Arnoud van den HeuvelDid you know that phones were once used for calling up our (human) friends? Researching the beginning of it all, we came accross demo video's on the cloud called "internet" where …
Why Handwriting Must Die
Koert van MensvoortAssociate professor Anne Trubek argues that handwriting will soon be history , because writing words by hand is a technology that's just too slow for our times, and our minds. A …
Brain Implant Restores Memory to Cocaine-Addled Monkeys
Allison GuyA team of researchers from three universities have succeeded in creating the first device that boosts the brain power of primates. In the study, five rhesus macaques were trained …
Does Chocolate Milk Come From Brown Cows?
Gillis van de ZandeAlthough chocolate milk producing cows may sound silly, scientists are seriously analyzing the feasibility of the idea. Why not add genes of cocoa and sugar to a cow, in order to create a cow that produces sweet chocolate milk?
Eating In-Vitro: Meat-Fruit
Koert van MensvoortLa Pâte Meat Fruit aims to seduce and inspire diners with an entirely new eating experience that balances eating meat and fruit. In vitro technology is used to grow meat …
Enter the self-driving car
Rolf CoppensThis promo video for the Google autonomous car is pretty exciting. I'm sure in a decade driving our own car will seem so old-fashioned,thinking how we ever trusted the physical …
First tasting of Printed Meat
Koert van MensvoortBiological physicist Gabor Forgacs normally works on the “printing” of new organs for use in clinical trials, however, his technology could also be used to bioprint meat. In the …
Is the Human Body Redundant?
Rachel ArmstrongThe increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …
Man Flies Like a Bird
Koert van MensvoortSome months ago we wrote about the dream of mechanical-engineer Jarno Smeets to fly like bird . Over the last few months Jarno worked steadily to materialize his dream. Today …
Nano Product: Conception Control
NextNature.netUsing a condom impregnated with artificial nano-antigens, Conception Control only permits sperm with the right chromosome to pass through: X for girls, Y for boys. Conception …
Nano Product: Glo-Doo
NextNature.netDog feces are an unsightly blemish on city streets. With Glo-Doo, dog food laced with bioluminescent bacteria transforms each pile into an appealing way to light up the night. As …
Nano Product: Keratin Ink
NextNature.netUsing genetically modified bacteria, Keratin Ink turns your fingernail clippings into a highly personal ink for writing and drawing. The bacteria transform the keratin in your …
Nano Product: Menoé
NextNature.netAt the beginning of menopause, celebrate your reproductive past by giving “birth” to a unique peace of jewelry. By using Menoé’s nano-coated birth control pills over a lifetime, …
Rural Energy: From Kerosine to LED
Koert van MensvoortWhile for most of us, happy blog readers, access to electricity is taken for granted, things are quite different in developing regions of the world. In India for example, over 65% …
"Smart Highways" to Power Streetlights and Electric Cars
Allison GuyRoads are a ubiquitous, even defining aspect of our urban and suburban spaces. In the United States alone, parking lots and roads cover 16,000 square kilometers. So why must roads …
Spider-Man Gloves
Joost van der PuttenImagine how much easier the job of window cleaners would be if they could simply scale walls like Spider-Man instead of using elevators, ladders and other gear. Ever since the …
Using Nanoscale Wood Pulp to Replace Metal and Plastics
Allison GuyNanocrystalline cellulose (NCC) sounds almost too good to be true. The same microscopic particles that help trees to stand up straight are also lightweight, non-toxic, stronger …
Walter Benjamin on Film and the Senses
During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …
Watch Out Whales, Humans Want Your Krill
Allison GuyKrill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …
Why It's Time to Calm Down about "Invasive" GM GloFish
Allison GuyIs the neon green tetra GloFish soon to be the florescent, transgenic terror of America's waterways? The internet hype machine has repeated ad infinitum the Washington Post's …
Years
Koert van MensvoortArtist Bartholomäus Traubeck created a hyper-nostalgic record player that, rather than making music from vintage vinyl records, uses slices of woods to generate sound.
A Lifetime of Questions through Google
Hendrik-Jan GrievinkGoogle becomes the authority on existential questions about aging.
"Algae Opera" Nourishes Algae with a Singer's Breath
Silvia CelibertiAre you blessed with a Maria Callas kind of voice? If, like us, you don't go beyond croaking the occasional " I want to break free" in the shower, watch out. If the artists of …
Gathering Electricity from the Atmosphere
Stephen Perry"Atmospheric energy" has the power to revolutionize the production of electricity.
Cow Poower! Bacteria Turn Poo into Fuel
Silvia CelibertiFarmers in the US are producing fuel and high-quality fertilizer from their cows' manure.
EcoBot III: a Robot that Produces Energy Fueled by Organic Matter
Alessia AndreottiThere are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …
Electric Skin Could Allow Robots to Feel
Koert van MensvoortA new kind of piezotronic transistor mesh could make for robotic skin that’s as sensitive as your own is, covered in thousands of tiny mechanical hairs.
Grow Your Own - Call for Projects
Koert van MensvoortScience Gallery is calling synthetic biologists, bio-artists, bio-designers, amateur biotechnologists and bio-hackers to submit proposals for projects for their upcoming flagship exhibition GROW YOUR OWN.
Invisible Headphone Implants
Alessia AndreottiInvisible ear implants for listening to music, getting directions, and recording conversation.
Jason Silva and the Dawn of Nanotech
Alessia AndreottiBuckle up for a new series of videos from performance philosopher Jason Silva.
Kitchen of 2001 – Envisioned in 1967
Koert van MensvoortRetro futuristic vision from the sixties: "The menu is given to the automatic chef via typewriter or punched computer cards."
Moss Table Powers Its Own Lamp
Allison GuyWhen moss photosynthesize, they release nutritious fats, carbs and proteins into their roots to feed colonies of helpful, symbiotic bacteria. In the process of breaking down these …
NANO Supermarket 2014 Call for Products
NextNature.netSubmit your speculative product to the NANO Supermarket and win 2500 euro.
Oranges Are Going Extinct – Unless a Gene from Spinach Can Help
Allison GuyOnly genetic engineering can stop citrus from going commercially extinct. But is the public ready to accept GM orange juice?
Sony's Smart Wig: Top or Flop?
Alessia AndreottiSensors, a communication interface and an actuator for tactile feedback all hidden ina wig.
Space Farming for Astronauts
Alessia AndreottiSpace Farming: NASA plans to grow a vegetable garden 230 miles above the Earth.
The Artificial Touch-Sensitive Hand
Alessia AndreottiRestoring the sense of touch with an artificial hand, using a brain interface.
The Future of Solar Power? Snail Teeth!
Marco van BeersThe gumboot chiton snail produces the hardest biomineral known on earth - and it may hold the secret to better nanotechnology.
Use a Touchscreen Without Touching it
Alessia AndreottiUltraHaptics is a system for creating haptic feedback in mid-air, offering new kind of interactions with our touchscreens.
Wipe with the World's First Transparent Toilet Paper
Xinyi PanNew technology can make completely transparent paper.
Austrian TV Crew visits Next Nature Lab
NextNature.netAustrian TV show TM Wissen visited the Next Nature Network to report on the "verstörende visionen und unberechenbare technologien".
Bionic Hand with Real Sense of Touch
Mateja VidakovicLifeHand 2: a prosthetic hand that infers the ability to feel rudimentary shapes and forms by touch.
Cat-like Sensitive Whiskers for Robots
Alessia AndreottiElectronic whiskers put sensitive catlike sensors on robots.
In Vitro Celebrity Meat, for Real this Time?
Allison GuyA company is working on culturing celebrity stem cells for cannibal cuisine.
Nano-motors in Living Cells
Robin BergmanScientists succeeded in implanting non toxic nano-motors into living cells.
Plastic Pollution Solution
Lotte BiesheuvelIs there a possibility to clean up the oceans from plastic pollution?
Printing with Grass
Alessia AndreottiThis 3D Grass Printer can print a garden in any shape you can imagine
Recovering Phosphorus from Wastewater
Julia WeberResearchers found a technology that allows to recover valuable substances from wastewater.
Retro-Futuristic Smartwatch
Alessia AndreottiIn 1981 the idea of what we call smartwatch was nothing more than a funny joke.
Retro Robot Band
Alessia AndreottiThe '50s robot band, Le Trio Fantastique, is exemplary of human distant longing for technology that integrates with our body and senses, to the point of taking our place!
Styles for Anti-Face Detection
Koert van MensvoortThe desire to avoid face recognition algorithms could bring us a whole new set of make up styles,
The Bionic Kangaroo
Alessia AndreottiThe BionicKangaroo technologically reproducesthe unique way a kangaroo moves.
The Carnery - A Cultured Future with In Vitro Meat
NextNature.netIn vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.
The Evolution Of The Desk 1980 - 2014
Francesca BarchiesiObjects that normally used to surround us became more and more virtual, radically changing the aspect of our workplace.
The First 3D Printed Canal House
Francesca BarchiesiThe first 3D printed house is a recognisable and attractive Dutch Canal House, an exhibition and building site in the heart of Amsterdam.
The Power Amplification Robot
Alessia AndreottiPower Loader: the power amplification exoskeleton robot.
Three Points in Support of In Vitro Meat
Alessia AndreottiThe top three aspects why people should support cultured meat.
Weaving a Home
Alessia AndreottiA lightweight and mobile structural fabric based on ancient traditions of weaving fibers.
Analogue vs Digital: Handwriting
NextNature.netWill handwriting soon be history? Or will we always prefer a handwritten love letter from our beloved?
Bioprinting in the Kitchen of the Future
Alessia AndreottiCultivator is speculative design project on how bioprinting could find its way into the kitchen of the future.
Drone Maps Christ the Redeemer
Yunus Emre DuyarThe current technology has not been able to replicate Christ the Redeemer perfectly, until now.
Facebook's Internet Drone Unveiled
Yunus Emre DuyarFacebook introduced its solar-powered drone project aimed to provide internet access to rural areas.
GM Salmon Approved for Consumption
Margherita OlivoTime ago we wrote about the fact that US Food and Drug Administration was considering whether to approve the first genetically engineered salmon. We have a verdict: from now on …
A Wooden Floor that Follows the Curves of the Tree it's Made of
Koert van MensvoortA wooden floor that follows the curves of the tree it's made of, thanks to smart milling techniques.
Happy Next Nature!
Hendrik-Jan GrievinkTime measurement tools are perhaps among the most inventive technologies mankind has produced, as it enables us to articulate ‘natural’ time (in the form of lunar years, sun …
Hyperform: the Future of 3D Printing
Louise Huyghebaert"However, while 3D printers are becoming increasingly accessible and capable of rivalling the quality of professional equipment, they are still inherently limited by a small print …
IBM Predicts Artificial Intelligence Future
Koert van MensvoortWhile the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".
Interview: Bruce Sterling on the Convergence of Humans and Machines
NextNature.netWe had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.
Jewelry Harvests Energy from Veins
Yunus Emre DuyarNaomi Kizhner designed jewelry that can theoretically harvest energy from the body of the person wearing it.
Lab-Grown Shrimps Are Coming to Your Plate
Alessia AndreottiA startup called New Wave Foods is developing artificial shrimp meat in the laboratory.
Let Strangers Cheer You up on Twitter
Yunus Emre DuyarThere is now a new application that allows random people to cheer you up on Twitter.
Meet the Hospital of the Future
Margherita OlivoWith its 656 beds, this hospital offers unconventional and leading computerized assistance for all sorts of patients.
New Friends? Let Social Textiles Help You
Yunus Emre DuyarA group of students at the MIT Media Lab are working on an electronic textile that might help us interact with people more easily.
Shape your Second Skin Using your Mind
Timo LejeuneA 3D printed helmet able to translate brain activity into the movements of its shape-changing structure.
The Candle of the Future
Alessia AndreottiMy New Flame uses LED technology to faithfully recreate the experience of light from the ancient past
The Future of Artificial Reproduction
Yunus Emre DuyarAccording to researchers we could go a step further and use stem cells derived from your skin cells.
The World’s Largest Indoor Farm
Alessia AndreottiThe world’s largest indoor farm in Japan is 100 times more productive than traditional agriculture.
Bringing Augmented Reality to Fitness
Ruben BaartFitbit just released a new motivational feature that aims to trigger their users to go out and exercise more.
Branded Dreams - The Future of Advertising?
Koert van MensvoortWhat happens when our dreams become a commodity and advertisers gain the technology to enter our dreams?
Creating a Second Skin to Look Younger
Elise MarcusScientists managed to create what every woman has been dreaming of: a second skin to reduce wrinkles and tighten the skin.
Feelling Information with Our Fingertips
Alejandro Alvarezching 64GB SD cards to each of our fingers challenges how we store and share information in a world were our digital privacy is at risk.
A Film to Double the Shelf-Life of Food
Margherita OlivoThe eco-friendly food packaging material able to improve food safety, conservation and quality.
From Vegetable to Stroopwafel
Ruben BaartChloé Rutzerveld presents a modern version of the iconic stroopwafel, fully made of vegetables.
Hyperloop Set to Change Mass Transit
Megan Ray NicholsThe Hyperloop is a future transportation means that is safer, faster, and cheaper than current forms of mass transit.
The Lightest Solar Cell Ever Made
Margherita OlivoResearchers created solar cells as light as a soap bubble.
Meat-Eating Made Us Humans
Margherita OlivoEating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.
Meat Lovers Megasteak Delight
Koert van MensvoortGrown in a laboratory in Wageningen and it is vegetarian too.
Medieval VR Headset
Koert van MensvoortHow will the future perceive our so-called modern VR technologies?
Pigs Have a Heart for Us
Elise MarcusReplacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.
Preventing Data Leaks with Smell
Ruben BaartThe Smell of Data alerts Internet users in any case of data leakage and communicates digital hazards by means of smell.
Bionic Prosthetic Arm with Personal Drone
Ingmar NieuweboerWhy would you stick to an elbow, a wrist and five fingers if you could make anything? This guy got a game-inspired bionic arm.
Racist Robots and Bloodthirsty Crowds
Daniel FragaIt took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.
Self-Driving Trucks Hit the Highways
Margherita OlivoA driverless convoy of trucks drove through Europe and safely arrived in Rotterdam yesterday.
Solar Energy: the Hottest New Currency
Lewis JustEnergy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.
The Modular Body
NextNature.netThe Modular Body is an online science fiction story by Floris Kaayk about the creation of OSCAR, a living organism built from human cells.
VR as a Tool for Social Change
Monika KozubUnited Nations aims at turning a playful technology into a serious medium.
What Is the Selfie Elbow?
Ruben BaartThe advent of digital communications media is bringing along some health conditions.
Xian'er, When Religion Meets A.I.
Margherita OlivoA robot monk has been created in China, mixing spirituality with artificial intelligence.
1978 - World’s First ‘Test Tube Baby’ Born
Elle Zhan WeiIn 1978, the world's first test-tube baby was born, her name is Louise Brown.
2016 - Human Embryo Lives 13 Days in Lab
Elle Zhan WeiIn 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.
ECO Coin Award Interviews: Ritsert Mans
Jack CaulfieldWe asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.
ECO Coin Award Interviews: Sandra Rey
Jack CaulfieldWe asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.
Experience Death with VR
Julie ReindlVirtual reality experiment tries to help people frightened of death with outer-body experience.
HUBOT: Meet the Focused Assembly Worker
NextNature.netAs a focused assembly worker, you are a real go-getter thanks to your smart tools. Wearing smart factory goggles and using a transparent LED screen, these give you direct …
Govert Flint on Enrichers
Ruben BaartNNN fellow Govert Flint discusses Enrichers in Frame magazine.
Hoverboarding Over the Atlantic
Elle Zhan WeiIn 2017, a hoverboard can fly 164 feet above earth and able to hover over the Atlantic Ocean.
Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?
Ruben BaartWe talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.
NEW: Next Nature Academy
NextNature.netThe Next Nature Academy offers the philosophy, the tools and the methods that will shift the way you think about nature and technology.
One Minute on the Internet
Ruben BaartWith the rise of modernity, we have domesticated ourselves with new technology: discover how the world spends one minute on the Internet.
Opening HUBOT at DDW
NextNature.netThe robots have arrived! Yesterday we celebrated the launch of HUBOT , job agency for people and robots at MediaMarkt , as part of the Dutch Design Week in Eindhoven. Our virtual …
HUBOT: Meet the Organ Designer
NextNature.netAs an organ designer, you develop genetic algorithms from which organs are grown to perfectly fit the recipient’s body, but also to meet the personal wishes of the patient.
Put Your Phone on Theatre Mode in Cinemas
Ruben BaartA new feature rumored to be in the next iOS update called Theater Mode could dim smartphone usage in cinemas.
Robot Librarians Instruct Young Generations
Ruben BaartThe Dutch province Gelderland-South uses two educational robots to increase kids' knowledge on such a technology.
Rights for Robots: EU Calls for Regulation
Jack CaulfieldA new report recommends that we decide the legal status of robots sooner rather than later. It even suggests that they could be given personhood and rights.
Robotic Tarzan Controls Crops
Julie ReindlA robot inspired by a sloth was developed in order to control crops growing in our fields.
Twittering Trees Talk Climate Change
Camille CharluetHow do trees feel? A team of scientists have developed a network of twittering trees to monitor their feelings and raise awareness over climate change.
This 3D-Printed Structure Can Fold Itself
Charlotte KuijpersResearchers at the University of Technology in Delft have created flat structures able to fold themselves into three-dimensional constructions.
Envisioning the future of artificial biological reproduction in Mexico
Hendrik-Jan GrievinkThe debate on the future of artificial biological reproduction is moving to Mexico. C Minds, an impact innovation agency that believes in ‘a 4th Industrial Revolution that brings …
Drones Protect Indonesia from Volcanic Danger
Jack CaulfieldIn Bali, volcanic danger looms large. Scientists are trying to use drones to forestall the danger and make the invisible workings of the volcano visible.
I like my steak lab-grown, not-grass fed
Angus HerveyRight now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …
On the origin of the word processor
Huub EhlhardtWriting is recognised as one of mankind’s foremost inventions and the mechanization of writing is one of these developments that typify what is commonly regarded as the work of …
'Listen' to your genetic heritage: Curate a playlist based on your DNA
Ruben BaartGenealogy services have exploded over the past few years, and Spotify is capitalizing on the boom by providing curated playlist based on users’ DNA. Here's what you should know. …
This tiny tooth sensor tracks what you eat, and it could help you be healthier
Vanessa Bates RamirezThe South Beach diet. The Atkins diet. Eating paleo. Cutting out gluten. Going vegan. The list of fad diets and health crazes goes on, yet health statistics in the US and around …
Explore your relationship with AI
Ruben BaartWhat makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …
This exhibition investigates how humans will live tomorrow
Ruben BaartOccupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …
Lessons in bio design from Emma van der Leest
Meike SchipperAs a young bio designer at the start of your career, you'll have to overtake all kinds of obstacles. From the collection of living materials to working in a laboratory and …
Gène Bertrand on design for human needs
Meike SchipperNature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …
Emma is your colleague of the future
Freya HutchingsEmma is in poor health. She has painful varicose veins, stress-related eczema, puffy skin, a grey complexion, red eyes and a hunch-back. She is an imagined office worker of the …
Pack your bags: Next Nature is going to China
Next Nature DevTo our Chinese friends (and beyond)! From 2 November 2019 to 1 February 2020, we'll be crossing the globe for a large showcase at the OCT Art and Design Gallery in Shenzhen, …
3 ways Virtual Reality is revolutionizing teaching
John PickavanceYou’ve probably heard how Virtual Reality (VR) is going to change everything: the way we work, the way we live, the way we play. Still, for every truly transformative technology, …
Electric cars might not yet be green, but we should buy them anyway
Ranald BoydellTransforming the way we travel is an essential part of tackling the climate crisis. The transport sector contributes about 20% of global carbon emissions . In the UK the figure is …
Shahar Livne wins ECO Coin Award 2020
Next Nature DevEach year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honour them with our ECO Coin Award . We …
Her is an outlook on the possible future of dating a chatbot
Ruben BaartWith most of us stuck at home because of lockdown, for the singles around us intimacy may have turned into a distant dream. Could we find our salvation in technology? And what …
(Im)possible bodies: responsiblity and care in our cyborg future
Koert van MensvoortWhat does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …
In vitro meat (finally) hits the market
Nellie FriedrichHumanity has an insatiable hunger for meat. Since 2013 we have been researching, developing and campaigning for a humane and eco-friendly way to get our protein fix. Since day one …
Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman
Ruben BaartWhat if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …
The Ouroboros Steak is a steak made out of human cells
Nellie FriedrichYou are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …
Virtual makeup: maybe they're born with it, maybe it’s XR
Ruben BaartAs our reality exists increasingly within digital realms, our virtual world demands a virtual identity. Our work is hybrid, our social identity is online and our connection is …
14 Golden Rules of working with a robot
Next Nature DevThe 14 Golden Rules of HUBOT are rules of conduct which must be followed and which everyone needs to hold each other to account. Themes like respect, teamwork, creativity, and …
It's been fifty years since we took the first full photo of Earth from space
Robert PooleThe image of the whole Earth as seen from space has become a symbol of the environmental movement. Time for an update?
How bacteria can recover precious metals from EV batteries
Sebastien FarnaudThere are more than 1.4 billion cars in the world today, and that number could double by 2036 . If all those cars burn petrol or diesel, the climate consequences will be dire. …
To decarbonize flying, we need biofuels
David Simon LeeWhile aviation accounts for 2.4% of all emissions from fossil fuel use globally, two-thirds of the sector’s warming effect depends on something other than its CO₂ emissions. And …
Can we grow wood in a lab the same way we grow meat?
Ruben BaartIn old nature, wood is grown in the forest. In the next nature, wood might be grown in a lab. Akin to the process of growing in-vitro meat , researchers in Velásquez-García’s …
Cooling buildings with ultra-white paint
Andrew ParnellFrom icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …
This podcast aims to help design better food systems
Ruben BaartThe podcast Food by Design was created by Sarah Codraro and Sandeep Pahuja, and is hosted by Sandeep. According to the makers "Our food system is not 'broken'. It’s working …
Dune explores the geopolitics behind resource extraction
Oli MouldDune offers a useful allegorical narrative of the “scramble for Africa”, which saw European empires carve up the continent into colonized powers.
How to turn your 3D printer into a food printer
Saumil VadodariaWhile the pandemic has restricted us from doing many activities we like, household hobbies such as DIY , baking and crafts have become more popular. Now there’s a way to combine …
Join us at the Embassy of Food Conference
Next Nature DevPromising food design projects do not always find their way to producers, the market and ultimately to consumers. Why is that and what can we do to advance these ideas? Why is it …
Lab or nature: scientists are debating the origins of COVID-19
Ruben BaartWe need to talk about COVID-19. Again (or, still). One of the main questions about SARS-CoV-2, the virus that causes COVID-19, has for a while been about its origins. Most viruses …
Leonardo DiCaprio is investing in future meat startups
Leanne VoshellGlobally, humanity consumes almost 350 million tons of meat a year. In the next 10 years, this number is expected to increase by a significant percentage. Scientists believe that …
Knitting sweaters from human hair
Kelly van GemertThe textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …
How the ECO Coin could bridge the gap between sustainable farming and monetary returns
MaithriFor the last six months millions of Indian farmers have been marching through the national capital in an effort to repeal the laws that they believe would end guaranteed pricing …
Roman Krznaric contemplates on becoming a good ancestor
Ruben BaartRoman Krznaric's ultimate guide to radically change our perception of time and become good grand-grandparents
The Internet of Mycelium
Kelly van GemertA lot of the ground we live on is polluted. More than a third of our soils are moderately or heavily degraded; heavy metals such as lead are increasingly found in urban soils, …
The Next Nature book is now available in Chinese
Next Nature DevIn Next Nature: Why Technology Is Our Natural Future , Koert van Mensvoort takes us on an epic exploration through the wonderful world of culturally emerged nature. It offers a …
The Next Nature book is now available in Italian
Next Nature DevIn Next Nature: Why Technology Is Our Natural Future , Koert van Mensvoort takes us on an epic exploration through the wonderful world of culturally emerged nature. It offers a …
The Next Nature Magazine is here!
Next Nature DevIt’s our pleasure to announce the first issue of the Next Nature Magazine. Indeed, a good old fashioned magazine. Next Nature Magazine presents 176 pages of thought-provoking …
Colonizing Mars with plants, not humans
MaithriThe idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …
This machine makes human clouds
Kelly van GemertHumans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …
Working with microbes to clean up electronic waste
Sebastien FarnaudIf you were to stack up all the electronic waste produced annually around the world it would weigh as much as all the commercial aircrafts ever produced, or 5,000 Eiffel towers. …
When will the first baby be born in space?
Chris ImpeyWhen the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …
Visit the Embassy of Food conference during DDW22
Eloise MaraisWill there still be a supermarket as we know it today in 2050?
Making an AI supermarket with Nonhuman Nonsense
Ruben BaartWhat does the supermarket of the future look like? The Embassy of Food at Dutch Design week.
Next Generation: Mending mycelium with Emma Huffman
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Demonstrating non-human narratives with Lindsey Bundel
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Designing ecological webs with Miriam Lellek
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Reconnecting with wildlife through biodiverse meditations
Ruben BaartSleep and dream like a koala, relax under biodiversity and feel the meditative effect of artificial wildlife.
The Cyborg Foundation is fighting for cyborg rights
Marit BeerseCyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.
Next Generation: Changing the oceans chemistry with Santa Ramaherison
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Fantasising about fashion with ShirpShiro
Kelly van GemertFinding realistic solutions to the humanitarian and environmental issues in the textile and fashion industries.
From Megabytes to CO2
Marit BeerseThijs Biersteker has designed an art installation that shows the carbon dioxide emission of the internet.
The Solar Biennale brings new perspectives on the energy of the sun
Ruben BaartThe sun lies at the heart of our solar system, providing life-giving light, heat and energy to Earth. The sun always gives, without asking for anything in return. In the …
Using the intelligence of plants to battle climate change
Marit BeerseLiving Carbon enhances natural traits in plants as a solution for stabilizing the climate by increasing the efficiency of the photosynthesis process.
A shoebox of fractal flowers
Koert van MensvoortIt's not every day that someone walks into your office with a shoebox, and even more rare when that shoebox contains a potential future.
Hurray! There are now vaccines for honeybees
Kelly van GemertA significant milestone has been reached as the US Department of Agriculture has granted approval to a vaccine for insects for the very first time. An important breakthrough, …
NASA's 'Human Computers' helped land the first human on the moon
Kelly van GemertNowadays mechanical intelligence is often chosen over that of our own human capabilities. But there was a time where our computers were still not always a match against our own …
Hedgehog's robotic fungi farms
Selin KirBeyond being little umami bombs, mushrooms are: protein-packed and nutritious. But here's the pitfall: their cultivation can be pricy. Especially gourmet mushrooms such as …
Meat the future: the Netherlands might soon become a global hub for in vitro meat
Lucas ZarzosoRemember when we created a little petition back in 2018 in the hope to legalise the tasting of in vitro meat? About 4000 of you agreed with us and signed it. If you were one of …
This coffee is prepared without coffee beans
NextNature.netThe Netherlands is a real coffee country. With the amount of coffee Dutchies drink per year, they have been in the top 10 of most coffee drinkers for years. Drinking so much …
Tooth fairy alert: Japanese company tests drug that can regrow human teeth
Kelly van GemertToregem Biopharma designed an antibody drug that can possibly regenerate teeth using the body's own tissues.
How to design your (home)office
Govert FlintDesigner Govert Flint proposes a new office concept, entirely based on movement and play.
The Petunia Carnage
Kelly van GemertTo pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.
5 must see exhibitions in 2023
Selin Kir1. THE FUTURE IS PRESENT Design Museum Danmark How will contemporary design define the future? THE FUTURE IS PRESENT grasps the very essence of Danish artistry of material …
Enter Spa Sybarite: the luxury wellness center of our dreams and nightmares
Kelly van GemertIn conversation with film director Joshua Ashish Dawson about the future of wellness, climate anxiety and healthy cynicism India-born, Los Angeles-based film director Joshua …
Real Nature is not Green
Koert van MensvoortAt the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …
Out of Control
The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …
Cell Phone Minutes: the Next Currency
Koert van MensvoortIt might just be my old nature mind, but I still find it a daily miracle: being able to walk into the bakery around the corner and trade a piece of paper – called money – for a …
Paradise by the Laptop Light
Paradise by the Laptop Light is a next nature event with short films, speedlectures, special guests and one laptop. It will be held on 12 September 2008 16:30-17:30, as the …
Tail communicator
Sara'The LED Dog Tail Communicator' is an initiative of James Auger and Jimmy Loizeau, and it is part of the larger 'Augmented Animals' project. Its focus points to technological …
The Breathe Table - Visceral Interaction
Koert van MensvoortNow why is that girl so excitingly staring at a few blurry blobs on a flat screen? Is it because these blobs are connected to her breath... What? Yes that is right, you are …
A plate that regulates the speed of eating
Koert van MensvoortMany people tend to eat too fast. As a result they do not receive signals from the stomach that they are in fact full. The result can be overeating and obesity . To encounter …
Bioinstinct
Koert van MensvoortDesigner Laura Boffi envisions a future in which human instincts will leap behind on technological progress. For example, once the 'disease called mortality' is cured with …
From Genes, to Memes, to Temes
Koert van MensvoortSusan Blackmore studies memes: ideas that replicate themselves from brain to brain like a virus. She makes a bold new argument: Humanity has spawned a new kind of meme, the teme, …
How to print a building
Koert van MensvoortIn the nineties laser printers revolutionized graphic design. Currently 3d desktop printers are revolutionizing industrial design. Next we will be printing buildings and …
Melting polar bear reveals a metal skeleton
Koert van MensvoortUnsure how this melting polar bear ice sculpture created by artist Mark Coreth fits in Next Nature mythology. The art piece was presented last week in Copenhagen and is sponsored …
Tangible hologram projector
Koert van MensvoortUsing ultrasound technology, researchers at the University of Tokyo have developed a holographic projector that displays three-dimensional virtual objects you can feel with your …
Turning Brain Waves into Tweets
Koert van MensvoortAre you using Twitter and looking for faster ways to update your followers with your utterly mundane status on what you are thinking? Adam Wilson from the University of Wisconsin …
Genetically Modified Salmon moves to Kitchen Table
Koert van MensvoortThe US Food and Drug Administration is considering whether to approve the first genetically engineered animal that people would eat — salmon that can grow at twice the normal …
The Footsticker
Rolf CoppensThere are many advantages of bare feet sporting: better motion control, more feeling in your feet and direct floor contact, etc. In this way you are more grounded and more aware …
When Dreams become a Commodity
Koert van MensvoortAs neuroscience progresses, we gain access to previously inaccessible and unexplored areas of the human mind. Consequentially the intricate processes in our brain are cultivated …
Deus Ex: The EyeBorg Documentary
Marco van BeersBack in 2009 Rob Spence, a cyborg film maker, worked together with a team of ocularists, inventors, engineering specialists on a prosthetic eye which can capture and stream video. …
When Siri met Siri…
Hendrik-Jan GrievinkLike with pets and babies, we seem to like it when devices mimic our behaviour and social patterns. In the process of domesticating technology, we teach products to behave like …
Cellphone Masts Disguised as Trees are Outdated
Marco van BeersThere is a new version of the well-known cellphone masts disguised as trees. Instead of adding fake nature to these masts, ChamTech Operations wants to put a layer of invisible …
Converse Sneaker Tattoo
Koert van MensvoortToday, shoes have been naturalized to the extend that we hardly can imagine life without them. Yet, shoes didn't exist in old nature, hence there must have been a day when …
Transfer Your Window!
Jaap ArtsImagine you buy a special kind of window which you can place on your wall wherever you want, enabling you to get different views, not always looking at the same tree or house of your neighbors.
Clothes that Turn Heat into Electricity
Allison GuyWith rising energy costs and our growing arsenal of iPads, smart phones, and wearable monitors, we're always on the lookout for new ways to power our devices. Perpetua Power , an …
Design Indaba Interview
NextNature.netOur South African friends of Design Indaba made a nifty little video of the presentation we did at What Design Can Do this spring.
Anti-Drone Tent
Koert van MensvoortAnti Drone Tent is a small construction of emergency blankets that blocks infrared sensing, making it invisible to drones.
NANO Supermarket New Line of Products
NextNature.netDuring the 2014 Dutch Design Week, the NANO Supermarket debuts a new line of speculative nano products.
Cybernetic Bugs
Alessia AndreottiBeetles, dragonflies, butterflies and bugs made from recycled deconstructed computers, smartphones and consoles.
Fake Nature can Prevent Climate Change
Margherita OlivoScientists are working on an ingenious approach to carbon capture that will enhance the way plants isolate carbon dioxide from other emissions in order to contain it.
Hacking Human Cells to Use Solar Power
Yunus Emre DuyarA new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.
Abandoning Modern Life to Live as a Goat
Wei Lun WangConceptual designer Thomas Thwaites is currently investigating and experiencing to live life as a goat.
OUT NOW: Save the Humans! Book
NextNature.netThe SAVE THE HUMANS! book is now available on our web shop.
The Emergence of 4D Printing
João Paulo Miranda LammogliaAn inspiring TED talk by computational architect Skylar Tibbits about 4D printing, where the fourth dimension is time.
The Secret Service is Preparing for Drones
Yunus Emre DuyarThe U.S. Secret Service is conducting test drone flights over Washington, D.C.
Wearable Device For Tomato Lovers
Louise HuyghebaertThe Wearable Tomato Project consists in a robot that dispenses tomatoes.
3D-Printed Shell to Save Tortoise's Life
Margherita OlivoA severely injured tortoise was saved by a team of doctors thanks to a 3D printed shell.
Cars Are Ready to Recognize Us
Alejandro AlvarezWe already recognize faces in our cars, now it is time for our cars to recognize our faces.
The Death of the Traffic Light
Daniel FragaMIT researchers have developed a system of traffic control that will make traffic lights obsolete.
Foster’s Prototype for a Droneport
Margherita OlivoNorman Foster's project for a Droneport that will give a valid, affordable alternative to reach and bring help to remote areas.
Lunar Insurrection Vol.2: Harvest Moon
Daniel FragaLunar Insurrection is a group of architects that explores the creative possibilities of the moon as a potential territory for human activity and inhabitation. In Vol.2 , their …
The Non-Disposable Disposable Razor
Koert van MensvoortWe recently stumbled upon a rare mutation: the non-disposable disposable razor.
The Robots of Tomorrow: Biodegradable
Margherita OlivoWhat happens to robots that are no longer needed? In the future robots will be biodegradable.
1999 - Ectogenesis Enters The Matrix
Elle Zhan WeiThe movie The Matrix brought ectogenesis to the public eye.
The Birth of a Digital Nation in Estonia
Daniel FragaDue to its digital citizenship program, something interesting is happening in Estonia. In July there were more new applications for e-citizenship than newborn babies. Are we …
Floating Green Power
Megan Ray NicholsOffshore renewable energy resources, such as floating solar arrays, have begun to pop up around the world.
The Ephemeral Future of Internet Data
Nadine RoestenburgWhat the Internet would look like if all data were ephemeral?
From Industry 1.0 to Industry 4.0
Megan Ray NicholsWarehouse management practices and processes evolved with the time, but they’ll need to maintain their adaptability to accommodate Industry 4.0.
The Internet of Bees
Jack CaulfieldWhat can we learn from listening to the buzz of bees' conversation? With the help of a new monitoring system, a Canadian researcher is hoping to find out.
Will Kites Provide Wind Energy in the Future?
Megan Ray NicholsIf you’ve watched clouds roll by, you know wind moves more steadily in the upper atmosphere. Turbines just can’t reach high-altitude wind energy. Kites can!
Personhood Status for Robots
Julie ReindlAn "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.
Jobs for Caretakers - Robots at Work #1
Mathilde NakkenThis is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.
MIT's new voiceless interface can read the words in your head
Vanessa Bates RamirezThe way we interact with the technology in our lives is getting progressively more seamless. If typing terms or addresses into your phone wasn’t easy enough, now you can just tell …
Adding a new dimension to marine restoration: 3D printing coral reefs
David KlingesThe local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …
Here's all you need to know about the future of the ECO Coin (and how it came about)
NextNature.netToday is Earth Day! This means that we think about the relationship between man, nature and technology, as technology is becoming a nature of its own. Acknowledged in 192 …
Interview: Jeremy Bailenson on his latest book "Experience on Demand"
Katherine Oktober MatthewsVirtual reality has come a long way. Like most technological leaps, it’s had a huge push from the entertainment industry, but current applications span a wide range of social and …
Scientists accidentally create mutant enzyme that eats plastic bottles
Damian CarringtonScientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …
Next Nature Gift Guide 2018
The season of giving has come and to make sure you can find the perfect gift for your loved ones we have brought together a collection of Next Nature inspired goodies. Whether you …
The Story of Money: Bits
NextNature.netThe story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. The final episode: bits.
Next Nature is hiring an army of bots
Next Nature DevAs we showed with HUBOT , we can use new technologies and robotics to make our work more enjoyable, interesting and humane. Aside from our speculative jobs, a lot of robotic …
Join us for the closing event of Reprodutopia!
Next Nature DevShould men be able to give birth to children? Should we externalize pregnancy with artificial wombs? And are these feminist dreams or frankenstein nightmares? Welcome to …
5 must-see exhibitions before the end of the year
Ruben BaartA large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …
The GOGBOT Conference 2019 is your guide to biotech futures
Ruben BaartLook around you and try to find the most natural thing in the room you are in now. It is you. But for how long? Welcome to the wonderful world of bio design ; a world full of …
Microbiocene: the microbiological archeology of the future
Linda ValentaIn configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …
Recap of the Next Nature book launch
Next Nature DevThe new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …
The church of AI
Linda ValentaWould you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …
Who should win the ECO Coin Award 2019?
Next Nature DevEach year we celebrate ecological heroes as part of our ECO Coin Award and this year is no different. Have you seen an inspiring person who is making the world a more …
Build an organisation that lasts by creating a superorganism
Tamsin Woolley-BarkerFor the past 25 years, I’ve studied everything from baboon cooperation in Ethiopia and orca whale innovation in the Bering Sea, to the Argentine ant invasion in my kitchen, and my …
How public camera recordings domesticate us
Janina SteinmetzFacial recognition is increasingly being used in many countries around the world. In some cases the take up has been dramatic . As a result, people are being observed by cameras …
Meet the BAD Awards winners of 2023
Kelly van GemertThe annual Bio Art & Design (BAD) Award encourages new artists and designers to explore the world of bio art and design. Let's have a look at the three winning projects of this year.
N is for Nature
NextNature.netThere are people who think what makes a good wine comes from nature - factors like rain and soil and temperature. Then there are those who think it's a matter of second nature - …
Post History
Jos de Mul (Erasmus University Rotterdam), published in Next Nature Paperback, 2005 For someone whose main instrument is a computer, the world becomes a gigantic database. We see …
Bio inspired Architecture
Koert van MensvoortThis cell-shaped building for the institute for Nanobiomedical Technology & Membrane Biology in Chengdu, China, is an unusual croos-disciplinary collaboration between MIT …
Biotypography
Rolf CoppensIsraelian typographer Oded Ezer looks at the world from his point of view, through letters and numbers. So why not turn the world into typography. A short interview taken from …
Brain-computer interface for Second Life
Dr NaturalWhile recent developments in brain-computer interface (BCI) technology have given humans the power to mentally control computers, nobody has used the technology in conjunction …
Brainbow Mice
Arnoud van den HeuvelIn the 1960s, scientists found that a particular jellyfish makes a protein that glows, known as green fluorescent protein. In the 1990s, using genetic engineering, researchers …
Cockroach Controlled Mobile Robot
Hendrik-Jan GrievinkBy putting this cockroach in control over a mobile robot, our perception of the animal is changed. Technology empowers the little creature you would normally squash under your …
Deep in the Forest : Owls, Logs and Noise
SaraStarting as noise makers, the owlproject work on different products which are deeply rooted in nature. And electronics.With their logs the owlproject travel around the world, …
Liquid armor
Arnoud van den HeuvelThe US Army Research Lab in collaboration with the University of Delaware developped a special liquid called s hear thickening fluid . It is actually a mixture of hard …
Review Paradise by the Laptop light
Rolf CoppensA review by Djbroadcast on the Paradise by the Laptop Light event last week. Sorry it is all so Dutch. Wat betekent het begrip natuur voor ons vandaag de dag? We zien 'de groene …
Switch Critters - Can you make them switch?
Koert van MensvoortEarlier we discussed the Magical Interaction project, in which Joris van Gelder rethought the boring activity of switching on/off a light by transforming it into a magical …
The Desktop Factory - Do It Yourself
Dr NaturalNowadays, most people can't make anything at home because it's too expensive. Roboticist Hod Lipson wants you to stop shopping and use his portable 3-D printer to make your own …
A Mobile Phone Embedded in Asphalt
Koert van MensvoortIf future anthropologists would ever dig up this cellphone, they might identify it as some sort of mysterious pseudo-religious device carried around fervently by early 21th …
Catch and eat fishing by phone
Dr NaturalFor mobile gamers in western Japan, a hearty seafood dinner awaits just a few key clicks away, thanks to a unique new cellphone fishing game that rewards successful players with …
Dogpause
Arnoud van den HeuvelAccording to the inventors of the dogpause bowl , slow eating dogs are happier than fast eating dogs. Having a dog in the first place is supposed to improve the quality of life, …
Future playground
Rolf CoppensShot taken before the robot in question short-circuited and started to kill all humans in sight.
Luxalive - The emotionally aware lamp
Koert van MensvoortSo you thought that animated Pixar Lamp from the movies was just a fantasy? Not anymore. Luxalive is a prototype of an reading lamp that moves according to the character of its …
A robot that controls your remote controls
Dr NaturalConfused with the pile of remote controls in your house? Now here is an idea: get a robot to control them. Researchers at Toshiba have developed a talking robot, named ApriPoko, …
The Evolution of the Richer
Diogo CorreiaAre we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …
'Atlantis' Turns out to be Interfacial Artefact
Koert van MensvoortSince the days of Plato, the lost city of Atlantis has captivated the imagination of many. The city, if you don’t already know, was said to be a naval power located roughly 600 …
Boomeranged Metaphors
Koert van MensvoortAt the start of the digital era, metaphors from everyday life were used – in what was then the new computer environment – in order to make otherwise incomprehensible technology …
China limits use of 'virtual' currencies
Dr NaturalBy DAVID BARBOZA SHANGHAI — China made public on Tuesday regulations aimed at cracking down on the use of virtual currencies amid worries that a huge underground economy was …
Designing for NextNature @ TU Eindhoven
Koert van MensvoortStarting February 2009 the Industrial Design department of the Eindhoven University of Technology takes Next Nature as one of its educational themes. The Industrial Design …
Ecology – A New Opium for the Masses
Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …
Energy-aware Internet-routing
Arnoud van den HeuvelData-hungry companies like Google, Microsoft and Amazon could reduce their energy consumption with 40% by rerouting data to locations where electricity prices are lowest on a …
Freshness Label
Koert van MensvoortJapanese design agency To-Genkyo proposes a dynamic freshness label for meat products. The hourglass-shaped label contains special ink that changes color based on the amount of …
GPS influence on street signage?
Koert van MensvoortIn the future, every street will be a Nokia street? Perhaps not, however we may expect some changes in street signage due to the arrival of mobile & gps technology. Once …
Green Vibes
Arnoud van den HeuvelThe big lobby to endeavor for a climate neutral lifestyle must have reached its peak. It is common knowledge that recycling electronic and battery operated utensils is better for …
Implantable Silicon-Silk Electronics
Koert van MensvoortScientists of the University of Pennsylvania are creating electronics that almost completely dissolve inside the body, through the use of thin, flexible silicon electronics on …
Millions of gadgets unused in Britain
Koert van MensvoortGadgets! You love them when you buy them, but what happens next? Over half of Brits have abandoned gadgets because they don't know how to use them properly. Seventy-one per cent …
Reprogramming Skin Cells into Stem Cells
Arnoud van den HeuvelA major breakthrough in the world of genetics: Researchers have successfully reprogrammed skin cells into stem cells. Using a technique called iPS cell reprogramming (developed in …
Virtual Money Is a Pleonasm
Koert van MensvoortHave you heard the buzz on virtual money in online games? Some years ago the first virtual millionaire was announced, yet there have also been reports on people being practically …
Design Fiction – Medical Bill of the Future
Koert van MensvoortAccording to this fictitious future medical bill almost every part of the human body will be repairable in 2028. Gut bacteria replacement, Bone tissue growth for skull repair, …
Digital Trashcan in a Physical Office
Koert van MensvoortThe Swedish design group Front brings the principle of the digital computerdesktop trashcan back to the physical world. When your trashcan basket is full it bulges outward. When …
Engineered Bacteria heal Cracks in Walls
Koert van MensvoortResearchers have designed bacteria that can produce a special glue to knit together cracks in concrete structures. Technews Daily reports the genetically modified microbes have …
European Parliament goes Next Nature
Koert van MensvoortAlright the title "Making Perfect Life" ' may sound a bit 20th-century-modernistic-techno-optimistic-naive, but for the rest we are confident this conference is going to be pretty …
Google Earth Alphabet
Hendrik-Jan GrievinkLanguage is communication technology. As Marshall McLuhan said, the spoken word was ‘the first technology by which man was able to let go of his environment in order to grasp it …
Hamster Powered Mobile Phonecharger
Michael KluverWe would call this a sustainable technology if only the average pet's carbon footprint wouldn't be comparable to that of an SUV .
![Visual of MANKO & Plagiarism [#1]](https://nextnature.net/media/pages/magazine/story/2010/manko-plagiarism-1/b50dcc7ae7-1602632753/manco-530-868x486.jpg)
MANKO & Plagiarism [#1]
Aston RevolaIn this first review of the works of Manko, we'll discuss the complex sorts of plagiarism in Augmented Reality art that are typical for our contemporary art scene. This introduces …
![Visual of Manko & The Invitation [#3]](https://nextnature.net/media/pages/magazine/story/2010/manko-the-invitation-3/a58a0af2b6-1602632753/manco-2-530-868x486.jpg)
Manko & The Invitation [#3]
Aston RevolaLast month we discussed how the vacuum played a big role in Manko's life since he lost his right leg. Soon he developed this idea further, beyond the mere notion of extensions …
![Visual of Manko & Zero [#4]](https://nextnature.net/media/pages/magazine/story/2010/manko-zero-4/c2cefab16a-1602632753/manco-51-868x486.jpg)
Manko & Zero [#4]
Aston RevolaThe way down was slow and somehow greasy. Total darkness surrounded them. Gill turned on the car radio and the LED's lit up their faces in a green pulsating glow. 'Jovi Rocks!', …
Mud Tub
Koert van MensvoortMud tub is an experimental tangible interface that allows people to control a computer while playing in the mud. By sloshing, squishing, pulling, punching, etc, in a tub of mud …
Nano Product: The Food Printer
Hendrik-Jan GrievinkAre we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …
Next Nature Movie #10 – Idiocracy
Koert van MensvoortAs we are nearing the end of the year, and anticipate you might have some time to watch a film, we discus our top 10 Next Nature movies. Idiocracy (2006) is not a great film, …
Outer-Space as Local-Space
Florian Conradi and Michelle ChristensenIn 1977, NASA launched Voyager 1 and Voyager 2, two unmanned interplanetary space probes that were sent out to explore the outer space. Aboard each was a record which intended to …
Palmtree Drilling Platform
Koert van MensvoortIn our ‘ under the beach lies the pavement ’ series. Already in 1973, Steven M. Johnson drew cartoons of oil drilling platforms disguised to look like palm trees, in an attempt by …
Robo-fly
Arnoud van den HeuvelWaiter, there's a robot in my soup! Weighing only 60 milligrams, with a wingspan of three centimeters, robo-fly's tiny movements are modeled on those of a real fly. While much …
Space Monkey
Arnoud van den HeuvelDuring the 1960s, monkeys were sent into outer space as part of the US space exploration program. But they didn’t all return, until now. Via scaryideas.com | Related: WWF
Squamata headset dances with the Music
Koert van MensvoortInspired by body language of animals (in particular squamates and porcupines), designer Jop Japenga created a headphone with an adaptive skin that responds to the music played on …
Traces of Everyday Embedded in Textile
Koert van MensvoortThe ‘Decay’ project explores how traces of time and use can be embedded in textile. By wearing a carbon fibre suit over a white blouse, textile designer Marie Ilse Bourlanges …
Traffic Jam Celebration
Hendrik-Jan GrievinkOn this day (Saturday May 29th 2010), the Dutch nation takes pride in celebrating their first real traffic jam. During the pentecost weekend in 1955, a mass exodus of a tribe of …
Brainscan App
Arnoud van den HeuvelBy hooking up a commercially available EEG headset to a Nokia N900 smartphone, Jakob Eg Larsen and colleagues at the Technical University of Denmark in Kongens Lyngby have created …
Cheiracanthium drives a Mazda
Allison GuyIn March, Mazda recalled 65,000 cars, not because of any structural faults in the vehicle, but because the engineers had inadvertently created the perfect habitat for a tiny …
First Lab-Grown Organ Transplanted
Koert van MensvoortAnother step in the fusion of the made & the born: Surgeons in Sweden have successfully transplanted a fully synthetic, tissue-engineered organ – a trachea– into a man with …
Kitten Ears – Blushing 2.0
Koert van MensvoortAlways wanted a pair of kitten ears to express your feelings to the world? Well, you probably never thought of that – as you have to be a Japanese genius to come up with such an …
Living Life Support
Allison GuyDesigner Revital Cohen imagines a future where life-support machines are replaced with life-support animals. In this scenario, a transgenic lamb is allowed to frolic in the fields …
![Visual of Manko & The Earth [#12]](https://nextnature.net/media/pages/magazine/story/2011/manko-the-earth-12/b1f1cf8f03-1602632753/manko12-868x486.jpg)
Manko & The Earth [#12]
Aston RevolaZero: 'Where to begin? We've had many discussions in our Lab about the future of the children. The plan was simple: to raise the kids to the physical age to be 'frozen' in. Then, …
Nano Supermarket visits Pamplona, Spain
From 9 - 14 March 2011 the Nano Supermarket opens its doors in Pampona, Spain. The NANO Supermarket presents speculative nanotech products that may hit the shelves within the next …
Nintendo Portables Are Breeding Grounds For Sexy Fun
Vincent KlerkxSexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …
Remote Kissing Device
Arnoud van den HeuvelNobuhiru Takahashi, student at the Kajimoto Laboratory of the University of Electro-Communications in Chofu City, Tokyo, invented this Internet French kissing device. When a …
Rule #3: Keep it ASS: Abstract, Simple and Subtle
NextNature.netFor past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. Making good use of anthropomorphism isn’t easy. As you’ve probably …
Typing Out Evolution
Allison GuyFrom the exhibit "What Machines Dream Of" in Berlin comes Life Writer , a work by Christa Sommerer and Laurent Mignonneau. As the participant types, letters are projected on a …
'Alp' Turns Containers into Refrigerators
NextNature.netTransporting and displaying cold food is an incredibly wasteful and inefficient process. Current display refrigerators, like those that display meats or cheeses in supermarkets, …
Amazon Tribe lacks concept of Time
Koert van MensvoortA study, in Language and Cognition has shown that time does not exist as a separate concept for the Brazilian Amondawa – an Amazon tribe first contacted by the outside world in …
Braille 2.0
Jeroen van PeltText for blind people using the Braille alphabet has been around for some time. But instead of making separate books for the visually impaired, why not change the way we all read? …
Featured Page #03: Tomorrow’s Fossils
NextNature.netDuring the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week the thirs one in this series: Tomorrow’s Fossils. Ode to the car …
First "Farm"aceuticals Grown in Carrots
Allison GuyThe United States Food and Drug Administration recently approved Elelyso, the first drug to be grown in genetically modified plant cells. Produced in carrot cells, this drug helps …
Huggable Vending Machine
Koert van MensvoortFinally a vending machine that doesn't want you money, it wants hugs. Embrace it to get a free can of coke. Might give you rushes of anthropomorphobia too though. Via The Pop-Up …
Ice Cream Cones Made from Ice Cream, and Other Wikicells
Allison GuyPlastic is a part of the earth's ecosystem , but it's a part that no one wants. At Harvard, scientists are looking to replace single-use plastic bottles, plates, and cups with …
Lucy McRay - Swallowable Parfum
Koert van MensvoortKnow garlic? Now imagine we could make something that functions alike, but smells a lot better. That's what Swallowable parfum is about.
New Museum Preserves "Extinct" Noises
Allison GuyGrowing up, I had a cockatiel that could mimic the bleeping cacophony of a dial-up connection with dead accuracy. I never stopped to think that my bird (still alive) preserves a …
Raise Crops on the Moon with Plant-Growing Jelly
NextNature.netIn dry areas like the desert, on mountain tops or on the moon it’s impossible to grow anything. Or is it? A rain in the desert sparks extreme plant growth from the moment the …
Replacing Synapses with a Single Switch
Allison GuyNeural synapses in the human brain are extraordinarily complex structures. Responsible for relaying information between neurons, chemical synapses govern the release of over 100 …
Rule #4: Complex Products Tend to Be Anthropomorphized
NextNature.netFor past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. Think about a spoon. Now think about a spoon with a face. What do you …
Thirsty? With a Cyborg Bladder, You'll Never Need to Drink
Allison GuySome desert animals, like the kangaroo rat, get through their lives without needing to drink even a drop of water. Now, a Japanese design company aims to make humans just as …
Turning Wind Farms into Seaweed Farms
Allison GuyClosed to commercial shipping and fishing, offshore wind farms aren't put to much use besides generating clean energy. Ecofys , a Dutch sustainable consulting company, hopes to …
“Soccket” Ball Generates Free Electricity
Alessia AndreottiIt looks like a normal soccer ball, but Soccket has a secret: a hole for a charging cable. Designed by two Harvard students, the ball has a pendulum-like mechanism inside that …
Pick Pig - Name Pig - Love Pig - Eat Pig
Stephen PerryIn a time of all-horse hamburgers and E. coli outbreaks, food provenance has become a huge issue. Consumers are becoming increasingly aware of the lack of traceability within the …
Deliver us from Digital Bluntness
Stephen PerryPeoples attitudes online are wholly different from their behaviours in real life
Did Booze Make Us Modern?
Allison GuyA psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?
Hire a Hyperreal Girlfriend to Look Better on Facebook
Insoo HwangBaudrillard intersects with social media in the world of fake online girlfriends.
How to Avoid a Global Wine Shortage
Jonathon MarkowskiA global wine shortage is looming. Never fear: Next Nature has a solution.
Implantable Microchip Controls Appetite
Adriaan de RegtBy attaching to the vagus nerve, a chip can contribute to "natural" weight-loss.
Implanted into Bacteria, Synthetic DNA Functions as a Diagnostic Computer
Jiwon KimIn the movie Fantastic Voyage, a submarine and its crew were shrunk and injected into the body of a sick man in an attempt to save his life. Despite the fictional nature of this …
Ingestible Microchips Monitor Medication
Stephen PerryDigestible Microchips are now approved by the US Food and Drug Administration.
Internet Archeologists Reconstruct Vanishing Digital Artifacts
Jonathon MarkowskiData doesn't live forever – and a new breed of archeologists are trying to recover it.
Q&A with CEO of In Vitro Meat Company "Modern Meadow"
Stephen PerryExcerpts from the Rebbit AMA with Andras Forgacs, founder of a company that manufactures in vitro meat.
"Responsive Typography" Tracks Your Location to Automatically Resize Text
Hendrik-Jan GrievinkA new website changes the text's font size depending on your distance from the computer.
Sniffer - Meet the Google Nose
Koert van MensvoortThe Sniffer – aka Google Nose – visualizes odors using a smell sensor, which is as good as a dog’s nose, and a glass in front of your eyes.
"Soylent" Liquid Meals Will Save the World
Alice FumeyCan a meal replacer save us money, time, and maybe even save the world?
The First Recorded Attack on a Cyborg
Stefan FinckenLooking back on the first recorded attack on a human cyborg.
The Insect with Natural Mechanical Gears
Alessia AndreottiThe first – and only – mechanical gears found in nature.
The Technium
Koert van MensvoortBuckle up for another cinematic espresso shot from our favorite performance philosopher Jason Silva.
The Twitter Tooth Implant Becomes a Reality (Again)
Allison GuyAn implant equipped with an accelerometer can tell when you're chewing, chatting, smoking or sipping.
Treating Mental Illness with Video Games
Ken ChenNeurofeedback shows promises in treating a range of mental ailments.
Wi-Fi Visualization: Surrounded by Waves
Alessia AndreottiAn artist visualizes WiFi waves across landmarks in Washington, DC.
World's First In Vitro Hamburger Arrives
Allison GuyBreak out the ketchup: Mark Post has grown the world's first entirely artificial burger from cultured beef cells.
A Jewel That Stops You From Checking Your Phone
Rolf CoppensFor every smartphone user to recognize, is that merely the lighting of your screen, a vibration or ring distracts you from almost every activity. Even when you are spending time …
Artificial Cells Built From Silicon
Alessia AndreottiScientists designed artificial cells built from silicon, able to copy basic functions of life.
Belief System Meets Operating System
Hendrik-Jan GrievinkThe façade of an Indian temple constructed from a large-scale print of a Facebook Wall.
E.T. Video Games are Real Modern Fossils
Alessia AndreottiAn unsuccessful piece of video gaming history became an archeological record.
Living in the Forest in the 21st Century
Alessia AndreottiPortraits of people who live alone in the forest.
New Plant Paradigms
Alessia AndreottiIn this approaching era, what might be biologically possible for plants?
Smart Contact Lens Can Monitor Glucose
Alessia AndreottiSmart contact lens project to monitor glucose.
Smart Tags Change Color as Food Spoils
Alessia AndreottiSmart Tags stick to containers of food and change color when something has expired.
Transportations Of The Future
Francesca BarchiesiA selection of nine enthralling and striking concepts of future way of transportation.
Wearable Antenna for Health Monitoring
Julia WeberWearable multifunctional antenna made of silver nano wires to monitor recovering people.
3D Printed Eyes with WiFi Connection
Alessia AndreottiItalian research studio is working on EYE: a 3D bioprinted sight augmentation.
3D Printed Fish Remove Toxins and Deliver Drugs
Alessia AndreottiResearchers from UC San Diego announced that they have developed 3D print tiny microrobots in the shape of fish able to detect and remove toxin from liquid.
Analogue vs Digital: Innovative Nostalgia
NextNature.netBrowsing through your virtual bookshelf gives you the feeling of having an easily accessible collection of books, just like your good old analog one.
Controlling Smart Devices with the Skin
Len KromkampiSkin is a flexible, stretchable and visually customizable on-body touch sensor for mobile computing.
In This Church We Only Take Credit Cards
Alessia AndreottiIn the Sanctuary of Caravaggio, Italy, devotees can make offerings just by credit cards.
Using Drones to Fight Deforestation
Margherita OlivoBritish company BioCarbon Engineering developed a new ingenious way to exploit drones: reforestation.
"The End": a Virtual Opera Singer, Millions of Fans and the Meaning of Death
Alexandra BremersSixteen-year-old Japanese singer Hatsune Miku grew in short time to a worldwide popstar. With her colourful appearance she counts millions of followers on social media, she …
The Ice Cream That Doesn't Melt
Margherita OlivoResearchers discovered a protein that can be used to produce the first ice cream that melts more slowly that the normal products on the market today.
Should Intelligent Sex Robots be Banned?
Daniel FragaThe Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.
Medical Microbots Used to Perform Biopsy
Hessel HoogerhuisWith recent successful experiments, we may see doctors switching from the single forceps to hordes of so-called microgrippers.
Modafinil Boosts Your Brain
Erik van der VeenA pill that makes you smarter without causing harmful side-effects? Modafinil might be this “smart-drug”.
Algorithm Tells You How to Dress
Alessia AndreottiWhat should I wear today? The answer to one of life’s big questions could came from an algorithm created to solve all your fashion problems.
NNN Movement & the First ECO Coin
Alessia AndreottiWe officially launched the Next Nature Movement in The Netherlands. To seal the beginning of the Next Nature Movement, director Koert van Mensvoort donated the first symbolic ECO coin.
Permanent Eye-Color Change
Alessia AndreottiA new laser surgery can permanently turn eyes from brown to blue.
Bacteria and Drones: New Ways to Collect Samples
Erik van der VeenWhile a hipster-drink bacteria are hunting space organisms, robots are catching whale snot in the open ocean.
Transfigurations: Let's Design People
Daniel FragaPlastic artist Agi Haines explores hypothetical scenarios for surgically implanted body enhancements in babies.
Turning Poop Back Into Food
Alessia AndreottiNasa funded a program to turn astronauts’ poop into food.
Wireless Controlled Mouse, the Animal!
Alessia AndreottiA remote-controlled LED chip can make a mouse walk in circles.
72h Offline Challenge for Teenagers
Monika KozubAround 100 Polish teenagers aged between 12 and 18 agreed to withstand 72 hours totally offline: no phone, no computer, no TV. What were the results?
Microsoft Is Betting on Mixed Reality
Ruben BaartThe Microsoft HoloLens is a holographic computer that enables you to interact with high-definition holograms through augmented reality.
The Advent of Connected Toys
Margherita OlivoIt is the era of smart toys, but they certainly raise difficult questions for parents.
Artificial Northern Lights
Monika KozubSwiss artist Dan Acher created a replica of the Northern Lights by way of high-powered lasers.
Breaking Language Barriers
Margherita OlivoWe have witnessed significant progresses in the field of real-time translation, and this new wearable translator, called ili, sums up perfectly this essence.
Brexit: the Cultural Climate Warms Up
Daniel FragaOn the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.
A.I. Can Guess Exact Locations of Images
Margherita OlivoGoogle's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.
Coming Soon: Video Face Hacking for All
Alejandro Alvarezteam of computer scientists at the universities of Germany and California has created what they call photoshoping videos in real time.
The Coywolf: 65% Wolf, 25% Coyote, 10% Dog
Margherita OlivoThe coywolf: an animal that has the DNA of the wolves, coyotes and dogs.
Difficulty in Voting for Trump or Hillary?Elect an Artificial Intelligence for President
Koert van MensvoortWould you vote for an artificial intelligence to govern our society?
The Digital Life Project
Alejandro AlvarezResearchers are creating accurate 3D models of living organisms to preserve the heritage of life on Earth.
People, Use Your Drone to Map El Niño!
Margherita OlivoHow to monitor the effects of El Niño ? The Nature Conservancy wants to take advantage of the massive image production that can be collected using smartphones and drones. From …
Egypt's First Solar-Powered Village
Ruben BaartThis village is powered by building-integrated solar panels and provides shelter for 350 people, putting sunlight to better use.
Empowered by Robots Event Report
Mathilde NakkenA report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.
When FB Replaced Editors with Algorithm
Ruben BaartFacebook had just fired their curatorial team for the ‘Trending’ news section over an algorithm, resulting in false stories attacking a news anchor, a writer, and Mac Donald’s.
The First Baby with Three Genetic Parents
Mathilde NakkenThis year, on April 6th, a baby was born with three genetic parents: two mothers and one father.
The First Drone Superhighway
Ruben BaartUrban planners proposed a utopian superhighway for the up-and-coming organic smart city Bao’an.
The Bioengineered Elixir of Life
Mathilde NakkenScientists say they can reverse aging by reprogramming the genome.
How We Domesticated Food
Margherita OlivoWe tend to believe that the fruit and the vegetables we eat today are "natural" and the same as they always were. It turns out that in the past this familiar food didn't look like this at all.
Designer Dave Hakkens is putting plastic waste to better use
Ruben BaartWe recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.
The Largest Solar Power Plant in the World
Margherita OlivoA floating photovoltaic system will lie on the waters of a Japanese dam, representing the largest solar establishment in the world.
Let's Talk About Virtue Signalling
Daniel FragaWith virtue signalling, the joys of moral superiority are just one click away!
Meet the Vaccinator Drone
NextNature.netThe Vaccinator Drone will provide you with the medicine you need.
Meet the WiFi Drone
NextNature.netThis is the WiFi drone, a useful companion that perfectly blend into our environment while providing us with information and connectivity.
An Edible Drone for Humanitarian Aid
Ruben BaartNigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.
Rating the Reputation Economy
Lewis JustOur online reputation is becoming a valuable currency that is hard to earn and easy to lose.
ReGen, the Autarchic Off-Grid Village
Margherita OlivoUtopian off-grid ReGen Village produces all of its own food and energy is being implemented in Almere.
A Step Further in the Race Against AI
Alejandro AlvarezToday, we all have superpowers. It may not seem like it because we are attached to our physical devices to use our powers, but with a Neural Lace that may soon change.
The Supermarket with No Employees
Alessia AndreottiThis automated store in Sweden doesn’t have any human employees, only a smartphone app.
VR Surgery and Live Stream Operations
Mathilde NakkenThere is a new breakthrough coming from the operating room: an app, called MDLinking, that connects 8.5 million doctors world wide.
Bringing The Web into Real Life
Margherita OlivoWeb 0.0 is sa project by street-artist Biancoshock where web apps are contextualized in real life.
PC Problems? Better Call a Witch!
Margherita OlivoMeet the witch who casts viruses out of computers with magic.
The World's First Invisible Train
Margherita OlivoJapanese architect Kazuyo Sejima is designing the world's first invisible train.
1896 - Baby Incubators in Coney Island
Elle Zhan WeiIn 1896 Dr Couney incubated premature babies. He saved at least 6.500 premature infants from death by putting them on display in Coney Island.
1996 - First Artificial Womb Experimented
Elle Zhan WeiIn 1996, Yoshinori Kuwabara at Juntendo University in Tokyo incubated a premature goat fetus by using extrauterine fetal incubation.
2017 - Artificial Womb Incubates Fetal Lamb
Elle Zhan WeiA lamb born at the equivalent of 23 weeks in a human gestational period was kept alive in an artificial womb and developed just as if it was in a normal womb.
AI Defeats Human at Go
Ruben BaartGo world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.
Add-on Body Parts: Bionic Thumb
Charlotte KuijpersRoyal College of Art graduate Dani Clode reframed prosthetics as extensions of the body, rather than replacements for missing parts.
Priests Bless Server Rooms
Ruben BaartSanctifying servers with knowledge and power from digital demons.
The New Way to Boost Creativity
Julie ReindlDanish company develops device to stimulate creativity.
Brainwaves as Password
Elle Zhan WeiResearchers have found a way to use our brainwave as a verification of our identity.
Cyborg Dragonfly for Special Service
Ruben BaartA Biomedical solutions company is developing a system for insects to wear, allowing engineers to steer it remotely.
App Activates Cells That Manage Diabetes
Julie ReindlScientists develop engineered cells to be implanted in patients with diabetes to regulate blood sugar levels, controlled with a smartphone app.
The Digital Mythology of... Super Mario
Daniel FragaMythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.
Female Menstrual Cycle on a Computer Chip
Julie ReindlThe complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.
Cyborg Cabin Crew
Ruben BaartAir New Zealand is equipping its flight attendants with AR headsets to explore in-flight optimization, giving its passengers a glimpse of what the future air travel service might look like.
HUBOT: Meet the Remote Savior
NextNature.netWhen giving first aid, all kinds of emotions are in play. Thus it is important for the victim of an accident to receive emotional assistance and to be mentally supported during an …
The Human Smart Home Assistant
Charlotte KuijpersArtist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.
How a Hummingbird Creates Green Energy
Michelle GuenneA start-up company build a wind turbine inspired by the hummingbird.
New AI Model Can Mimic Any Human Voice
Elle Zhan WeiLyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.
The New Male Birth Control
Ruben BaartA new contraceptive has appeared on the horizon, bringing the prospect of an alternative form of male birth control one step closer.
The Next Nature Guide to Games in 2017
Jack CaulfieldIn the next nature, many people spend as much time in the digital world of gaming as they do in the real world. We have covered video games before, but this year we thought it …
NNN Is Hiring: Managing Director
NextNature.netNNN is looking for a Managing Director to join our office in Amsterdam.
Otra Nation: Make Walls Great Again
Elle Zhan WeiThis group of 14 designers, engineers, builders and architects make a proposal of a wall for Trump's ambitious project.
Smartflower Solar Device
Elle Zhan WeiPOP is an all-in-one solar energy system that hold visible benefits for humans.
FarmVille Turns into Real-Life Agriculture
Julie ReindlA Japanese Start up brings Farmville back into real life by letting players grow physical food.
Robo-Bee Pollinated a Japanese Lily
Nadine RoestenburgA video of a robotic bee pollinating a flower (looking more like Loopin' Louie spinning off the board game and hitting a flower) recently caught our attention. What at first sight …
GM Self-Destroying Moths
Julie ReindlOpen-air tests of self-destructing moths mark a new frontier for GMOs.
Sleep and Dream Controller
Lydia HaldersDevelopers at Dutch-based company Arenar have designed a device that not only claims to improve the quality of sleep, but also induces lucid dreams.
Smell of Data Documentary on Nextnature.net
Ruben BaartThe Smell of Data documentary will make its online debut on nextnature.net.
Chat with Plants in the Botanical Garden
Camille CharluetExploring methods to better connect people to the natural world, Waag Society, in collaboration with the Dutch Botanical Gardens Association, have developed an app that allows visitors to talk with plants.
The Posthuman Farm
Ruben BaartWu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.
A Voice Mask to Protect Your Privacy
Ruben BaartIntroducing world's first voice mask designed to protect your privacy.
AR City: Paving the Way for Augmented Reality Navigation
Belen MunozAugmented reality applications are a promising alternative to GPS. At least that is what Blippar’s AR City app claims to be.
This artwork lets trees tell the story of climate change
Linda ValentaIn our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …
This Chinese baby is born four years after their parent's death
Alec SchellinxIn March 2013, five days before Liu Xi and her husband Shen Jie were scheduled for the transplantation of one fertilized embryo into her womb, the young couple died in a car …
Custom-grown bones, and other wild advances in regenerative medicine
Vanessa Bates RamirezThe human body has always been an incredible machine, from the grand feats of strength and athleticism it can accomplish down to the fine details of each vein, nerve, and cell. …
E-Skin Makes You Control Objects Without Touching Them
Charlotte KuijpersScientists developed an e-skin that lets the wearer manipulate virtual objects without touching them, by using magnetic fields.
Flock of Drones fly over Amsterdam
NextNature.netTonight a flock of drones can be seen in the skies of Amsterdam.
HUBOT: Meet the Shiva Therapist
NextNature.netMeet the Shiva Therapist fro HUBOT. She massages with her own hands, but for the heavy work, she has four additional robotic arms at her disposal.
Next Nature baby care
Charlotte KuijpersBabies' needs aren't complex. And yet, they are. Over the years, parents have found some tricks to ease their babies as well as themselves. Taking a baby for a drive to make them …
Open Call for ECO Coin Award 2018 Submissions
NextNature.netNominate an inspiring project, platform, person or community who is tackling food waste for the ECO Coin Award 2018
The return of Rayfish Footwear?
NextNature.netRayfish Footwear was a fictional company that offered personalized sneakers crafted from genetically modified stingray leather. This online science fiction story allowed customers …
Researchers are developing a device that can edit brain activity
Tristan GreeneNeuroscientists at the University of California Berkely are building a device that’ll hack our brains so we can ‘edit’ what we feel and remember. It looks like we’ve drawn “ Total …
Making Seawater into Clean Fuel
Jack CaulfieldScientists have been hard at work searching for renewable energy sources. Now, a new breakthrough: the ability to produce hydrogen fuel from seawater.
How animal filters unmask the estranged relation to our wild self
Meike SchipperWould you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …
4 visions about the future of public transportation
Marcus EnochThe way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …
How to biofabricate leather
Laura MuthLeather is one of the oldest and most versatile materials in the world. It’s a supple, tough, relatively strong and durable material and it’s relatively impermeable, yet …
Discussing bio-based material experiences with Elvin Karana
Meike SchipperThe world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …
Discover the art of the living at Centre Pompidou
Ruben BaartGo forward to nature at the La Fabrique du Vivant (the Factory of Life), the newly opened exhibition at the Centre Pompidou in Paris. Exhibiting the recent works of fifty …
NATURE is an exhibition where biology and design meet
Ruben BaartCube Design Museum in Kerkrade and Cooper Hewitt in New York present the comprehensive exhibition NATURE - in which internationally renowned designers, artists and inventors …
This exhibition looks at how robots are changing the world we live in
Ruben BaartDelve into the science and fiction of robots at V&A Dundee’s latest exhibition: Hello, Robot . Contemplate the existence of robots and how they have both shaped, and been …
Work with us!
Next Nature DevWe are a network of makers, thinkers, educators and supporters. With members in 44 countries, we are the international network for anyone interested in the debate on our future – …
Living robots made from frog stem cells may revolutionize medicine
Freya HutchingsAt just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …
Marjan van Aubel wins ECO Coin Award
Next Nature DevEach year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honor them with our ECO Coin Award . We …
Showcase your work on Next Nature!
Next Nature DevAre you a recent graduate or young maker who feels your work deserves a spotlight? Does your project seek to understand how technology becomes so omnipresent, complex, intimate …
Have you thought about your social media death?
Freya HutchingsRecently, Twitter announced it would be clearing all inactive accounts in an effort to free up dormant usernames and prevent the risk of old accounts being hacked. The new policy …
Synthetic skin is bringing the sense of touch to VR
Britta de VriesCurrent social distancing measures are all about keeping a physical distance from each other in order to flatten the curve. But this does not mean we have to keep a distance from …
This app allows you to talk to quarantined people around the world
Ruben BaartLoneliness is one of the silent serial killers during the pandemic. Therefore Next Nature provides you the tip to pick up your phone. Artists Danielle Baskin and Max Hawkin …
COVID-19 is a virus, corona is a meme
Ruben BaartAs the viral pandemic continues to spread, so too does the world’s collective uncertainty. As a result, people are turning to media for some levity. And can you blame them. …
Enter the memesphere
Laura van den BrinkWhy memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.
Wild wild space
Veronica FanzioWhen Earth goes south, cowboys go all the way up. The Space Rush of 2020s has something to do with settler colonialism.
Building the farm of tomorrow
Kelly van GemertSeven examples of how design will help us built the farm of tomorrow.
Interruptions
Rolf CoppensEvery ecology needs balance. So that's also true for the ecology of the office. The office is a ecology that is highly regulated: temperature, light, humidity, distance to other …
20k human chip
Arnoud van den HeuvelAAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
Ambient bathtub
Koert van MensvoortI am sorry I couldn't be there— I had an important meeting with my bathtub that could not be rescheduled. This bathtub with an internal multicolour LED light fitting, creating a …
A plant that glows when thirsty
Dr NaturalSINGAPORE (Reuters) Some people like to talk to their plants. Now, students at Singapore Polytechnic say they have created a plant that can communicate with people - by glowing …
Artvertising: pixel ads become physical
Koert van MensvoortIn the early days of digitalization many metaphors from the physical world were translated to the digital world; think desktop folders, trashcan and shopping cart. Now we have …
Better than the real thing
Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …
Bird radio
Arnoud van den HeuvelInstruction for the Birds: Land on perch->trigger sound file->observe human response-->behave accordingly. Instructions for People: Listen, you'll be able to understand. The sound …
Bit.fall Aquadisplay
Rolf CoppensA screen of water displays images by controlling drops of water falling down. Density creates light/dark shades that create the image— Project site
Blur Building
Dr NaturalThe pavilion is made of filtered lake water shot as a fine mist through 13,000 fog nozzles creating an artificial cloud that measures 300 feet wide by 200 feet deep by 65 feet …
Child Care Robot
Koert van MensvoortNEC corporation is developping a "Childcare Robot PaPeRo" capable to play with and watch over children. The Childcare Robot is capable of recognizing and verbally communicating …
Crowd counter
Arnoud van den HeuvelCrowd counter is a piece of software able to track moving features within a video clip. It works on the assumption that points that move together are most likely part of the same …
Datafountain: Money translated to water
Koert van Mensvoort"In the morning paper, I can read the weather report as well as the stock quotes. But when I look out of my window I only get a weather update and no stock exchange info. Could …
Dataplant: Money translated to plants
Koert van MensvoortRemember the datafountain ? Of course there are many other applications of information decoration: datawallpaper, datasounds, datafurniture and dataclimate. The picture above …
Dreamkeeper
Koert van MensvoortSkin conductivity sensors are used to deduce the emotional state of the sleeper. This information is brought to 3-D studio where a script is used to transform this into physical …
e-Paper
Arnoud van den HeuvelWill our mobile devices look like this in two years time? This is an example-application of the featherweight QVGA (320x240 pixels) active-matrix display: Phillips e-paper . (It …
Eat this!
Rolf CoppensSushi made up of flavoured sheets printed out on an inkjet printer. Using ink-jet printers and lasers in the kitchen may seem like a futuristic vision but at Moto restaurant in …
Entry 2006 closing weekend
This weekend is the last change to visit the Entry 2006 exhibition in the coalwashe building, Zollverein. Over 300 exhibits from more than 20 countries are on display. Next nature …
Eternal Sunset
Koert van MensvoortEternal Sunset endeavours to ensure you can enjoy the sunset live from any location, at any time. As the sunset moves westward, Eternal Sunset continuously tunes into different …
Excuse me, is Your Tooth Ringing?
Koert van MensvoortThe 'tooth phone' consists of a tiny vibrator and a radio wave receiver implanted into a tooth during routine dental surgery. Sound, which comes into the tooth as a digital radio …
Eye 2.0
Rolf CoppensNow with Google smart look. Don't worry, it is science fiction (still). Created by Sean Hamilton Alexander.
Featherless Chicken
Koert van MensvoortBehold the featherless chicken, created by Scientists at the genetics faculty at the Rehovot Agronomy Institute near Tel Aviv, Israel. The idea behind the development of this …
Handsets gets taken to the grave
Koert van MensvoortMore people than ever are asking to be buried or cremated with their mobile phones when they die. The trend, which began in South Africa, has now spread to a number of countries, …
3D rendered bunnies prefer calm diesels
Koert van MensvoortKenichi Nagahiro, Honda's chief engine designer, hated diesel engines. When asked to design Honda's first diesel he flatly refused - unless he was allowed to start completely from …
Hotspot Bloom
Dr NaturalHotspot Bloom is a wearable flower that glows and changes color to indicate the signal strength of a nearby wireless network (802.11b/g). With its mobile interface, Hotspot Bloom …
Infant Pillow - Simulates a Mother's Hand
velinaIf you've ever wished for a "hand" to leave behind so that your baby would feel as if you've never left the room, your prayers have been answered with the Zaky Infant …
Info Toaster
Rolf CoppensToasted bread as an information display device (originally developed in 2001 but somehow still intruiging): a toaster that parses meteorological information from the web and then …
Inner life of a cell
Rolf CoppensYou know.. cells have feelings too... and friends.. Check the video here
Lifestyle pets
Rolf CoppensALLERCA has produced the world's first scientifically-proven hypoallergenic cats. These cats allow some of the millions of people with feline allergies to finally enjoy the love …
Metalosis Maligna
Koert van MensvoortMetalosis Maligna is a documentary by Floris Kaayk about a disease which affects patients with medical implants. Sourcing from such implants a wild metal growth ultimately …
Radio controlled human
Arnoud van den HeuvelThink of this sonic vibe-technology inside any MP3 player ;)
More leg = more money
Rolf CoppensThe Stock market skirt Nancy Paterson made a blue taffeta & black velvet party dress that represents the real-time stock market situation by lowering or raising its hemline. …
WiFi-enabled Ambient Rabbit
There may even come a moment that our connection with an industrially manufactured coke bottle may be richer and more mythical that our relation with a genetically analysed and …
Art versus Nature
Amsterdam Weekly featured an article about the Natural Habitat exhibition (pdf) , currently on display at Montevideo/Timebased Arts. In the exhibition artists play with the …
Need for Speed
Rolf CoppensA transformation of the big flashing arrows from the computer game Need for Speed Underground 2, NFSU 2 to physical space. Although computer games generally try to imitate the …
Next n8 Nature
Rolf CoppensDuring the upcoming Amsterdam Museumnight, the Institute for Timebased Arts (Montevideo) will be hosting a show called Natural Habitat, in which artists play with the borders …
Pig Wings Project
Dr NaturalThe development of new biological technologies make us wonder if pigs could fly one day. The Pig Wings project presents the first use of living pig tissue to construct and grow …
Plantimals
Koert van MensvoortFinally! Some creative uses of cloning discovered. Photoshop technology makes flora and fauna join hands. www.worth1000.com
Power Aware Cord
Dr NaturalThe Power Aware Cord transports electrical power while simultaneously visualizing energy usage. Electrical transfer is represented through glowing pulses, flow, and intensity of …
RFID Chips: Is your cat infected with a Computer Virus?
Koert van MensvoortA group of computer researchers from Amsterdam have demonstrated that it is possible to insert a software virus into radio frequency identification tags, part of a microchip-based …
RFID ladybag
Rolf Coppensa purse that visually keeps track of valuable items such as keys, wallets, personal identification cards, & cellular phones through various sensors embedded in the bag. if …
Sababa
Rolf CoppensThe Sababa is the first real time lava visualiser kit of global city flows. It takes the lava lamp one step further by reconstructing it according to the language of the current …
Sequoiaview - harddisk visualisation
Koert van MensvoortDid you ever wonder where all that hard drive space went too? Sequoiaview generates organic-like views of the files and folders on your hard drives using cushion treemaps. …
Shapeshifting memory plastic
Dr NaturalScientists have invented a plastic memory material that can change into three different shapes based on heat. Researchers demonstrated a plastic tube with three "programmed" …
Sixties last
Koert van MensvoortThe flower depicted in the image is a good example of Hypernature. While fake nature is always a flatter surrogate of old nature, hypernature is a simulation of an old nature that …
Sky-catcher
Arnoud van den HeuvelLuna Maurer has launched her long-expected website on december 18th 2006: From July 2005 a camera on the roof of De Balie (famous building in Amsterdam) is 'catching the sky' in a …
The Animal Sweater
KarlThe pattern on the Animal Sweater suggests a new way to experience commercial imagery. The Animal sweater, designed by Karl Grandin, was first shown at The Biggest Visual Power …
The infoBreath
KarlA flower arcing from a frosted pane of glass. Rigged with a breath sensor and connected to an internet packet sniffer, the flower is cued in to the wireless network flowing in the …
Tree-climbing robot
Arnoud van den HeuvelI wonder what task this little fellow 's creators had in mind for him. Rescuing cats? Pruning branches? Picking coconuts? Found here. I'm glad there's a robot for every surface …
Tree traffic light
Koert van MensvoortFunded and produced by the Public Art Commissions Agency. On roundabout just beyond the Canary Wharf estate there are three trees, two are London planes; the third is a traffic …
Cellphone Treemasts
Koert van MensvoortMobile phone operators go to extraordinary lengths to conceal the masts that form their networks. They are being disguised as chimneys, clocks, drainpipes, telegraph poles, and …
Walls with Ears
ricardoportilhoA traditional textile heritage is celebrated with flocked wallpaper that comes to life as it reacts to ambient noise levels. The louder the space the brighter the wallpaper glows. …
Typing With Water
KarlA technique developed by the German Claus Winterfor an installation artist makes whatever word you type into a computer visible by a "water-curtain". The video shows the World …
Weather forecasting umbrella
Rolf CoppensAn umbrella that provides information about the likelihood of rain so that users can make a simple, informed decision about whether to take the umbrella with them as they leave …
When there's smoke, there's nature
Rolf CoppensWhen I was a kid, I thought that people that could make smoke circles were really cool. Now I think machines that can do that are even cooler!Â? Made by Takeshi Ishiguro
Wifi SM: Feel the global pain
Dr NaturalYou have the impression that the disasters of the world do not touch you anymore? You feel vaguely sorry for other people's misfortunes but you don't feel the inner urge which …
Wildgruen
Dr NaturalMandy Meißner's "Wildgruen", a plant that can move and communicate. In her view, plants need to be freed from their isolation, both in the way that they can only lean towards the …
Wind Shaped Pavillion
Koert van MensvoortThe Wind Shaped Pavilion is a design proposal for a large fabric structure that can be used as a public or private pavilion. As a lightweight fabric structure, the wind slowly and …
Would You Like a Bouquet of Nanoflowers?
Koert van MensvoortThese crystalline 'nanoflowers' were developed by Cambridge University PhD student Ghim Wei Ho. The nanostructures of silicon carbide are grown from droplets of gallium on a …
A hunt for hightech
Rolf CoppensIn "A Hunt for High Tech", Bart Hess seeks to harness both nature and technology and create armoured skin and fur for a new human archetype incorporating animalistic and …
Contour door
Arnoud van den HeuvelSilly inventions like these make me wonder why man continuously seeks interaction with the things surrounding him. Should buildings or offices be allowed to talk? "This door was …
Augmented Animals
Dr NaturalAnimals do not shape their living environment as radically as humans, but why don't we give them some help. James Auger envisions animals, birds, reptiles and even fish becoming …
Augmented Fish Reality
Koert van MensvoortAugmented Fish Reality is an interactive installation of five rolling robotic fish-bowl sculptures. These sculptures allow Siamese Fighting fish (Betta Splendons) to use …
Ball of Being
Koert van MensvoortBall of Being is an online dance film featuring atoms, planets, footballs, globes, foam and molecules. It is uncertain whether we are entering a microscopic nanoworld, virtual …
Big Ass Browser
Arnoud van den HeuvelFirst we had the internet. We stored all our texts and images in databases. Then came search engines to locate the data. Now is the time to interconnect it all; to share knowledge …
Botanic Artists
Arnoud van den HeuvelWhere other trees grow their branches towards the light, willows seem to want to touch the surface. Tim Knowles creates drawings independent of his own hand and when he attaches …
Brain biometric key
Arnoud van den HeuvelUsing electrodes positioned around a person's scalp, scientists from the Centre for Research and Technology Hellas in Greece are developping a method for electronic identification …
Bright blind
Rolf CoppensMade of electroluminescent (EL) sheets, Makoto Hirahara's Bright Blind simulates a window where none exists. In all other respects, the artificial blind functions in exactly the …
Car Navigation - Just Follow the Red Cable
Koert van MensvoortJust follow the yellow brick road ... thin red cable and you know where to go! Instead of looking at a small 6 inch screen, or listening to less than exact turn by turn …
Chewing = Browsing
Rolf CoppensJapanese researchers have developed head gear that lets people control devices such as an iPod using their teeth. Now that is not really new, except when you take in mind that …
Compubeaver
Rolf CoppensCompubeaver by Kasey McMahon "I am interested in the way we interact with nature. As we become increasingly reliant on technology, we become disconnected from our natural …
Super Mario Cloud
MarcoCory Arcangel hacked and modified a piece of hardware'the cartridge on which the game "Super Mario" is stored, or rather, was stored to produce "Super Mario Cloud" This is …
Die Hard - Vilcus plug dactyloadapter
Koert van MensvoortMany people get a kick out of a direct contact with AC power supply. To that end, people normally use U-shaped fragments of bare wire, paper clips or even usual metal forks. All …
Dishmaker
Arnoud van den HeuvelThis "printer" is all about creating, storing and recycling householdproducts on demand. link | video
Ferrari Tomato
Koert van MensvoortDo you happen to know the Dutch Tomatoes? They look like Ferrari's and taste like shit. They are redder, rounder, larger, and maybe even healthier than the ones from our gardens. …
Edible RFID tags
Dr NaturalInventors keep coming up with new ways to exploit RFID (Radio Frequency Identification) tags. Now Kodak wants to use them to probe a person's digestive system. RFID tags are tiny …
Email Flight Sim
Rolf CoppensThis must be the best worst software concept I've seen this year.. An email mailbox represented as a 3D, virtual LAX airport. in this world's coolest email program, based on the …
Evolution in the Bathroom
Koert van MensvoortI have been conducting some attempts to backtrack the evolution of Gillette shaving razors appearing in my bathroom. Whereas older shavers were simple sticks with a blade on top, …
Fake for Real: Digital Trashcan
Koert van MensvoortAt the beginning of the digital era, several metaphors from the physical world were transferred to the digital environment in order to make, otherwise incomprehensible, technology …
Fake for Real: Phone Trees
Koert van MensvoortFor a long time in the history of painting, the landscape functioned merely as a backdrop for people, buildings or symbols. But in the 17th century, artists started making …
Fake for Real: QWERTY, the Right Order
Koert van MensvoortDid you ever wonder why the letters on the keyboard are in the order they are? The reason for QWERTY goes way back. This order was chosen to reduce the probability that mechanical …
Fake for Real: Romantic Sunsets
Koert van MensvoortSunsets are loved by people all around the globe. Could this universal aesthetic preference be linked to a deeply rooted understanding of the sunset's importance? Life on earth …
Fire fighting beetle - OLE
Arnoud van den HeuvelJust like centipedes OLE can roll up into a ball when danger threatens and retract its six legs. Its heat-resistant shell is made of a ceramic-fibre compound which can withstand …
Flesh Nike
Koert van MensvoortA Nike shoe stapled together with human flesh, created by Adam Brandejs .
Food for Thought
Arnoud van den HeuvelFood is no food. Food is scent. Food is temporary experience. Food is message. Welcome to this magical gastronomy tour. You will enjoy the tasty (video)links below: Works by Chef …
Forest clock
Rolf CoppensTiWalkMe is a clock (still in conceptual stage) designed to track 1,000 years using a forest seeded along a ribbon of land to tell time. Annual tree plantings set the pace, …
Friending, Ancient or Otherwise
By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …
Furry Display
Koert van MensvoortI applaud any new display technique that isn't emitting light. A recent patent application by Philips for a new type of screen based on "furry" pixels , or physical pixels made …
Grass Wheel
Koert van MensvoortIf you've gotta run the wheel, you might as well do it in bare feet. Many of us are so busy being good little hamsters that we never have face time with green space. A group of …
Hamster Shredder
Arnoud van den HeuvelTom Ballhatchet introduces mice and hamsters into the officegarden. tomballhatchet.com
Human LCD
Koert van MensvoortNew media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .
Humans to Blame for Global Warming
Koert van MensvoortGlobal warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …
iBiogenetics
Arnoud van den HeuvelIn 1998 at the introduction of the iMac , Apple declared that the "i" stood for "internet". Apple later adopted the "i" prefix across its consumer hardware and software lines. …
IVY - hard disk cover evolves with your data
Koert van MensvoortIVY is an external hard disk which shows the content of the hard disk on its skin. When no data is stored on IVY, its skin will remain blank. When you purchase IVY, it appears to …
Kite ship
Rolf CoppensThe world's first commercial merchant ship using a high-tech kite system will sail across oceans - and help fight climate change. "MV Beluga Skysails" cargo ship has been fitted …
MemorySticks / USB-tree
Arnoud van den HeuvelNow here's a nice piece of dead old nature I would like to stick in my computer! Notice the beautiful micro-organism-patterns. Designed by Oooms.nl Related posts: Sunflower …
p2p spiders
Rolf CoppensIt looks like spiders are learning from the web and use peer-to-peer technology to build their web: "Entomologists are debating the origin and rarity of a sprawling spider web …
Today: Paradise by the Laptop Light
Eat the fruit. Kiss the Snake. Today 16:30-18:00: Paradise by the Laptop Light at STRP Festival .
Philips Wake Up Light - Sunrise Alarm Clock
Koert van MensvoortPhilips hits the shops with a product that aims to naturalize alarm clocks. The annoying buzzing machines were once invented to cultivate our day/night rhythms, formerly connected …
Printing virtuality
Arnoud van den HeuvelPhone, internet, television, photography, even books or music: today it is hard for the mind to escape from virtual worlds. A day without communication or interaction could make …
RedesignMe
Koert van MensvoortWe are all born in a world that has been designed already. Cars, dishwashers, dildo's, remote controls, ATM machines. Although these products are supposed to make life better, …
Robot farmer Mr Woo
Arnoud van den HeuvelComedian Paul Merton went to China for Five.tv (early 2007) and near Beijing he reads the following headline: This farmer grows robots...
Sao Paulo vs Billboards
Rolf CoppensThe mayor of Sao Paulo decided that he was tired of the wildgrowth of billboards in the city. So he decided to take them all down (not personally). This creates a very pre (or …
Skyscreen - largest urban LED screen in Asia
Koert van MensvoortAlright, we can agree most of old nature has been altered by human activity. We're not just talking rain forest, icecaps and genetically modified fruit and kittens . Now you might …
Slogan of the Week
Koert van MensvoortThe media are disappearing, Nature takes over. Our slogan of the week.
Slogan: The Future is Analog
Koert van MensvoortI first saw this statement on the Artvertising building . Let this be our slogan of the week.
Stoneage noodles
Arnoud van den Heuvel15.000 Years ago we lived in caves, wore animal-fur and ate mammut- noodles !? Oh well, though our knowledge has grown a bit, the human nature hasn't changed that much: every …
Study finds humans still evolving and quickly
Dr NaturalBy Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …
Surfing with nothing but brainwaves
Koert van MensvoortI couldn't believe the news? Scientist are working on a system that allows you to surf the web with nothing but brainwaves . I thought surfing was a rich physical experience of …
TeleBombing
Koert van MensvoortThe MQ-9 Reaper is loaded, but there's no one on board. Its pilot, as it bombs targets in Iraq and Afghanistan, will sit at a video console 7,000 miles away in Nevada. Although …
The objectuals
Rolf CoppensThe Objectuals is a series of work by artist Hyung Koo Lee , it features an interesting mix of visual distortion apparatus for the human body. Lee says that he experienced …
The Tissue Engineered Meat of Tomorrow
Koert van MensvoortThe meat in the supermarket is abstract, square and habitually made from wickedly manufactured animals. A friend once told me he only eats meat if he "can not recognize the animal …
The Top 10 New Organisms of 2007
Dr NaturalGenetic engineering isn't just for scientists in ivory towers or corporate R&D labs anymore. Researchers are still creating new mice and crops every week, but the tools and …
Typosperma
Rolf CoppensAnother project by Oded Ezer, Typosperma is the second experimental typo project in his 'Biotypography' series. As a paraphrase on the biotechnology definition, 'Biotypography' is …
Urban Camouflage II
Koert van MensvoortAaron Larney made these urban camouflage printed hoodies, just in case you need to blend into your dorm's notice-board. See also: Urban Camouflage I .
Vanity ring
Rolf CoppensFor all you self-Googlers out there. And yes.. that means you too! Back in the old days (pre-next-nature) you used to wear gold rings and lots of bling you show off your wealth …
Vin Memoriam
DesignmusketeersThe Vin Memoriam concept introduces a new ritual in the mourning process after losing a loved one. When a person has passed away, a small amount of blood can be processed into a …
Waterworld - Old nature meets next nature
Dr NaturalAtkin's Architecture Group recently won the first prize award for an international design competition with this hyperreal entry. Set in a spectacular water filled quarry in …
What does 200 Calories look like?
Koert van MensvoortEveryone knows some foods have more calories than others. For many people eating turned into an information science, having to continuously read the amount of calories of the …
A view beyond
Rolf CoppensImagine the impossible… a secret transatlantic tunnel running between New York and London, that has lain undisturbed for a hundred years. And imagine an extraordinary optical …
Agro-Veillance
Arnoud van den HeuvelThis summer researchers from technology firm QinetiQ and from Aberystwyth University flew an autonomous unmanned aerial vehicle (UAV) over fields in England and Wales to map the …
All Is Full Of Love
Arnoud van den HeuvelWhile time seems to flow in this one direction, some people just know how to walk straight through that fourth dimension; catch it in a videoclip and throw the message into …
Feelings Translated to Plants
Koert van MensvoortAmbient Biomedia is an investigative project about using living beings, in particular plants, to display human lifestyle problems information. The working principle of our systems …
Ambient Umbrella
Koert van MensvoortThe Ambient Umbrella shows when rain or snow is in the forecast by illuminating its handle. Light patterns intuitively indicate rain, drizzle, snow, or thunderstorms. Local …
As real as it gets
Arnoud van den HeuvelArt Directors Andreas Junus and Irawandhani Kamarga; copywriter Darrick Subrata and photographer Anton Ismael (Indonesia) went through some trouble , visualizing Photoshop's …
Asus introduces scented laptops
ConnieIntegrating nature in our technology. There are four different laptops: Floral Blossom (pink), which has a tropical, flowery scent; Musky Black (black), which incorporates a waft …
Avatarian Graveyard
Koert van MensvoortAvatarian Graveyard supplies a service for virtual addicts – people who excessively or compulsively spend time in virtual environments – to help them reintegrate into everyday …
Back to Nature?
Koert van MensvoortNow this is how you do it. First you take the meat of a hundred animals; chickens (19%), turkeys (17%). Secondly, you blend them in a large tank with water, mais, wheat, oil, fat, …
Banksy Pet Store
NielsFamous street artist Banksy left his grafitti spraycans at home and sets to opening a pet store. The difference with this pet store is that instead of looking at pets, you look at …
BicycleBot
Arnoud van den HeuvelMurata Boy, is a robot capable of riding bicycles unassisted. Balancing, pedaling and directing the bicyclee, turning the bike to avoid obstacles, etc. And this is his nephew, …
Blendie - the voice controlled blender
GuusBlendie is an voice controlled blender with a mind of its own. Materials are a 1950’s Osterizer blender altered with custom made hardware and software for sound analysis and motor …
Boxing the Desert
Arnoud van den HeuvelWith his Waterboxx , Pieter Hoff (The Netherlands) won the Bèta Dragons Award 2008. It is an instrument that supports plants and trees in order to survive in difficult …
Build a better being
Koert van MensvoortWill Wright's hugely successful games SimCity and The Sims let players shape the structure of urban areas and the lives of virtual humans; his upcoming game, Spore , lets them …
Ceci n'est pas une Potato Chip
Koert van MensvoortProctor and Gamble, the maker of Pringles , has successfully argued in a British court that their product is ‘not a potato chip’. Pringles are also officially now, not potato …
Cell phone cooking
Koert van MensvoortPopping corn with your handheld? Pity this recently discovered cellphone feature is a hoax , created by a company to promote bluetooth headsets (thanks Teun ).
Clear Blue Sky
Koert van MensvoortWho likes clouds anyway? Especially for the people still living in the suburbs of Venray (small town in the Netherlands), artist Helmut Smits made this billboard depicting a clear …
Cloudmaker
Koert van MensvoortAlways dreamed of creating your own clouds? You can now create them... from text. Wordle is a toy for generating 'word clouds' from any text, url or rss stream you provide. The …
Composting Bottle
Koert van MensvoortDon't you just love that vanishing bioplastic bottle! It is our peculiar object of the week.
Consuming Illusions
Koert van MensvoortSo you thought the 'consumption of illusions' was a typical digital world activity of second life residents and gaming addicts? Never underestimate virtuality in everyday life. …
Crash–Test Pizzas?
Arnoud van den HeuvelSchwan Consumer Brands, a leading frozen pizzas brand, has launched a challenging brand: UGLY. The design embraces the rising trend for natural, honest food and the notion that …
Dashboard Tree
Koert van MensvoortWhat is that growing on my car dashboard? Is that a tree? Indeed, Ford and Honda's next-generation dashboard instrument clusters feature trees (a vine in Ford's case) that grow …
Designing for Next Nature: selected proposals
Some months ago we sent out a call for proposals asking for visions, statements & ideas on we how we can design, build and live in next nature. We received an overwhelming …
Driving on Algue
Koert van MensvoortGreen bubbles? Yes, they seem to be everywhere nowadays. But for a change we aren't talking about those greenish marketing bubbles of the flourishing sustainability cult. …
Playing with Dry Water
Arnoud van den HeuvelThe Waterboard is an interactive installation by Mike Burton giving the user a chance to play with water without getting wet. By drawing lines on the whiteboard, the water will …
Fake-Space Race
Koert van MensvoortSome weeks ago we pondered over the oddity of a space race in cyberspace . Rockets and jet-packs –so cool in the previous century– don't make sense in a virtual environment. The …
Find Brain, replace with GPS
Rolf CoppensSo far, over-dependence on GPS devices has resulted in more inconvenience than actual danger, but earlier a U.K. woman sent her £96k Mercedes flying into a river, trusting the …
Fun begins in 2029
Rolf CoppensFamous technologist and futurist Ray Kurzweil states: it's going down by 2029, so be prepared to get digital on entirely new levels. According to Kurzweil, machines will have both …
Genetic Map of Europe
Koert van MensvoortEuropean biologists have constructed a genetic map of Europe showing the relations between its various populations. The right part of the map shows the location in Europe where …
Google DNA search
Rolf CoppensLast year Google invested four million in 23andme , a commercial research center that maps out your DNA for 1000 bucks. Now Google also invested in Navigenics , a company that …
Hemp–Mote
Arnoud van den HeuvelThis weeks peculiar image gives gaming that "natural" touch: the Hemp–Mote by dhrek.com Made from 3 kinds of 100% natural hemp string on the outside, while remaining 100% …
High Performance Hip
Arnoud van den HeuvelA commercial by an orthopaedic reconstruction company introducing the next generation of joint replacements: " Highly advanced hips and knees. Engineered to meet the needs of your …
Homo Desktopus
Koert van MensvoortA future physical anthropologist who knows nothing about the human race and would dig up a contemporary desktop computer, might conclude homo desktopus must have been the user of …
Honeycomb vase
Koert van MensvoortThis Honeycomb vase was made from a vase-shaped hive that 40.000 bees colonized for one week, building a hexagonal comb to encompass the existing form. Created by Studio Libertiny …
Hurricane Control Causes a Storm of Lawsuits
Koert van MensvoortControlling hurricanes could save lots of lives and dollars. According to a study published in by climate physicist Daniel Rosenfeld , adding dust to Hurricane Katrina's base …
Organic Coca-Cola
Koert van MensvoortWhoever you are, whatever you do, wherever you may be. You can’t beat the real thing. It really refreshes and brings real satisfaction in every glass. It was not until America’s …
Image Consumption Continues...
Arnoud van den Heuvel"Do you know what it really reminds me of? ... Tasty Wheat . Did you ever eat Tasty Wheat ?" – from The Matrix. This is a project by pundo3000.com , in which 100 products were …
iWater
Dr NaturalSomehow I feel there is some deeper meaning in this cheesy video. No? See also: Water in my Phone .
Banana Juice Box
oustamanThis Japanese Juice box is camouflaged from modern box designs and tries to convince consumers with its appealing 'natural' look. A schoolbook example of biomimicmarketing ; …
Join the Neolithic Revolution
Koert van MensvoortWhy hunt? Why gather? Join the Neolithic revolution! Somewhere around 9500 BC proto-farmers began to select and cultivate food plants with desired characteristics. While in their …
Just right for the garden: Mini-Cow
Koert van MensvoortRising supermarket prices are persuading hundreds of families to turn their back gardens into mini-ranches stocked with miniature cattle. For between £200 and £2,000, people can …
Let the plants do the dirty work.
Koert van MensvoortMathieu Lehanneur created a plant-powered indoor filtration system, that pulls in filthy air to be processed through a plant's leaves, roots, and humidity, reintroducing purified …
Light weeds
SaraLightweeds is a project by Simon Heijdens and currently exhibited at the MoMA - part of the Design and the Elastic Mind exhibition . The organisms - plants, weeds, trees - exist …
Michelangelo's David After his Stay in the US
Mieke GerritzenI got this in my email from my uncle who lives in Australia. "After a short stay in America, David returns to Italy" . You know what's coming before you even open the picture. …
Million dollar burger
Rolf CoppensPETA –People for the Ethical Treatment of Animals– has posed a challenge to the world's scientific community: The first person to come up with a method to produce commercially …
Recycled Books
Arnoud van den HeuvelA lot of dead books were used to make this piece of tree trunk. By Jacqueline Rush Lee | Related: Modernistic Tree | Modernistic Chair
Multicultural Gourmet Pack
Ehsan BahaMulticultural Gourmet Pack is a new meat package that contains a variety of butchered meat products based on different religions and believes. The pack contains a total of 4 …
Power Ivy
Rolf CoppensCochran’s sustainable design group, SMIT (Sustainably Minded Interactive Technology) came up with a project called GROW. It's an Ivy-like covering of a building that generates …
Reconstructing Faces
Arnoud van den HeuvelThe video below is featuring a computer-generated replica of actress Emily O’Brien’s face at high-definition resolution. The Image Metrics process takes a captured video and …
Robomonk
Rolf CoppensAn industrial robot has been given an unusual production task; writing out the full Martin Luther bible "by hand" in a calligraphic style. The robot arm appears to be a fairly …
Roboswift, Eyes in Disguise
Arnoud van den HeuvelWith its 50 cm wing span and 80 grams of weight, this high tech bird is ready to infiltrate swift surveillance squads next summer. Aerospace engineering students at TU Delft , …
Robot asimo conducts concert
Dr NaturalAt a recent Yo-Yo Ma concert at the Detroit Opera House, Honda's ASIMO robot took the stage and conducted. Blame Honda when the robots take over. Thanks Paul .
Robotic Red Snapper
Koert van MensvoortJust because you're feeling paranoid, doesn't mean the fish aren't actually spying on you. Engineers at the University of Kitakyushu created an underwater survey robot that looks …
Saturn (Directors Cut)
Arnoud van den HeuvelThe struggle between the born and the made is being fought out in a wardrobe on Saturn. By: 1stavemachine.com | Related: Sixties Last
Search Engine
Arnoud van den Heuvel"Google has stationed approximately a million computers worldwide to be able to process the 40 billion searches per month. One search request uses as much energy as a low-energy …
Second Skin Trailer
Arnoud van den HeuvelSecond Skin takes an intimate look at computer gamers whose lives have been transformed by the emerging genre of Massively Multiplayer Online games (MMOs). World of Warcraft, …
Small Talks
Arnoud van den HeuvelAn installment in the series of: " Things I have learned in my life so far ". sagmeister.com These dividing pages for Austrian magazine .copy spell out:"Starting / a / charity / …
Solar Trees
Arnoud van den HeuvelWelsh designer Ross Lovegrove ('Captain Organic') placed several glowing Solar Trees in the streets of Vienna (October 2007). These solar powered streetlights could save cities …
Speaking at the Wall
Koert van MensvoortI used to hear voices in my head, but now they seem to be coming from the walls – am I back in to the womb? No wait.. it's a wall that reacts to the spectators voice (quicktime) . …
Surrogate Sushi Unmasked with DNA Test
Koert van MensvoortThese two teenagers, Kate Stoeckle and Louisa Strauss, just found out many New York sushi restaurants and seafood markets are playing a game of bait and switch with their sushi. …
The Blogging Houseplant
BramMeet midori-san , the first blogging houseplant! Through sensors connected to the leaves of this Sweetheart Hoya reads bioelectric currents through the plant, this gives …
The peoples gardens
Rolf CoppensVolkstuintjes (or peoples gardens) might be a typical Dutch / European tradition, offering gardening space in urban environments in which people don't have their own gardens. It's …
The Presidential Harvest
Arnoud van den Heuvel" Eat the View " is a campaign to plant healthy, edible landscapes in high-impact, high visibility places, whether it's the "First Lawn" or the lawn in front of your child's …
The Telepresence Frame
Rolf CoppensThe Telepresence Frame is a domestic object which utilises the fact that one's bodily functions are digitised in order to create a new form of telepresence. Allowing loved ones to …
Third Life
Diogo CorreiaLong after Second Life servers have been shutdown, Augmented Reality is a common place . Thanks to our bioengineered eyes, or our electronic contact lenses , and years of data …
Type trousers
Rolf CoppensBeauty and the Geek jeans by Erik de Nijs. The trousers offer a full Querty keyboard layout as well as a mouse, speakers and a little joystick. As he calls it: "Beauty is skin …
Soft Drinks for Suckers
Arnoud van den HeuvelTru Blood is a synthetic nutrient for vampires that completely eliminates the need to seek sustenance from any living creature. Packaged as a consumer good at your local …
Vegetarian Nike
Koert van MensvoortNo animals were hurt or injured in the production of these vegetarian Nikes. Created by Paul van Barneveld . Thanks Floris . See also Flesh Nike .
Virtual Transgender Suit
Koert van MensvoortA study by psychologists at Nottingham Trent University has found that 54 percent of all males and 68 percent of all females "gender swap" – or create online personas of their …
Wallpaper Blooms When the Heat is On
Koert van MensvoortNow this is a spot on example of information decoration : a heat–sensitive wallpaper of which the printed flowers will be blooming when the radiator is on. Created by Shiyuan .
Wear Your Social Network
Hendrik-Jan GrievinkGet Wickd (props for the name boys – totally wicked!) is a tech-fashion brand that sells basic clothes with barcodes that can link your mobile phone to any page on the web, from a …
When Facebook gets Physical
Koert van MensvoortWhat would it be like if the communication on a social networking site like Facebook was actually played out in everyday life? Hilarious sketch by Idiots of Ants (thanks Martijn ).
Work in progress
Rolf Coppens"I think we are all "work in progress", this necklace is featuring a cool progress bar to indicate that." Nice work Irina!
Your grand-grand-parents new media
Koert van Mensvoort19th century people needed some explanation to understand the difference between the regular candlelight and the electrically simulated candlelight. Note the disclaimer at the …
A day in the Dutch dunes
Koert van MensvoortRecently, I had a nice day in the Dutch dunes with the people of Blocter.com , who show the people behind blogs. We closely investigated the Scottish highland cattle that acts as …
After the reboot, meet the Homo Evolutis
Koert van MensvoortAt this year's TED conference , held in Long Beach California, Biotechnologist Juan Enriquez argued that even as mega-banks topple, the big reboot is yet to come. It will come …
Agenda Wallpaper
Koert van MensvoortUsing thermochromatic ink, which changes color when the temperature exceeds a specific degree, designer Josien Pieters created a prototype of a dynamic wallpaper that …
Apple Salad
Dr NaturalTasty realization of the classic Apple rainbow logo, made entirely out of fresh fruit. The clever creation was made by Richard Thomas from sliced kiwis, bananas, oranges, …
Ars Electronica Festival goes Next Nature
This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …
Artificial 'Trees' to Stop Climate Change
Koert van MensvoortThe fabrication of forests with artificial trees is one of the best strategies to stop climate change, according to scientists of the Institution of Mechanical Engineers . The …
Augmented Phone Browsing
Arnoud van den HeuvelThis video shows the first beta version of TwittARound – an augmented reality Twitter viewer on the iPhone 3Gs. It shows live tweets around your location on the horizon. Because …
Autimacy
Koert van MensvoortAutimacy [aw-tih-muh-see] - noun, plural - cies. The term was coined by Simona Kicurovska .
Back to Where it Came From
Koert van MensvoortFish sticks are among the most wondrous modernistic inventions of the previous century. They are easy to eat, efficient in their packaging & transport and the greatest of all: …
Biodiversity in the Supermarket
Koert van MensvoortSome say global biodiversity is decreasing. I am not entirely sure.
Biomimicmarketed Strawberry Juice
Koert van MensvoortPeculiar object of the week. See also Banana Juice box , Modernistic Watermelon , Cubic Fruit , How to grow an Orangina Bottle .
Bionic Pinguins
Tijn KooijmansFesto Bionic Learning Lab demonstrates their new technologies inspired by nature. Another step towards artificial pets replacing extincted animals, or just an exposé of scientific …
Brainwave Binoculars
Arnoud van den HeuvelThe eye passes on more information to the brain than the brain will process. In that sense, the brain functions as a filter. But on the battlefield the risk of neglecting …
Bugs that Turn Whole Plants into Sugar
Koert van MensvoortRemember the bacteria that eat waste and shit petrol ? How about some microbes that eat plant waste and turn it in to sugar? Now you might say you have no need for sugar as you …
Colalife
Rolf CoppensCoca-Cola© succeeds in what most NGO's try to achieve: getting the goods to the poor in the 3rd world Africa. For most people there, a Coke is easier to get and cheaper than a …
Controlling Human Odour
Florian Conradi and Michelle ChristensenThe ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …
Counterfeit Crab
Hendrik-Jan GrievinkEngraved Hairy Crab: fake or real? ??? (Dazha crab), or more widely known as Shanghai Hairy Crab, is in season right now. This typical Shanghai delicacy is particularly sought …
Crash course on synthetic genomics
Koert van MensvoortNext Monday when your colleagues ask you what you have been doing for the weekend, you might answer you something default like you went out with friends, danced, biked to the …
Crowdsourced drink
Koert van MensvoortRemember the days when the flavor of a fruity drink was simply connected to an apple, orange, strawberry, kiwi, or perhaps – if you felt really exotic – an acai berry? Nowadays we …
Cyborg Insects
Koert van MensvoortScientists at the University of California created a neural implant for a beetle that gives them wireless control over the insect. Electrical signals delivered via the electrodes …
Dandella Shows You the Way
Koert van MensvoortHow to navigate the urban jungle? Adopting the metaphorical image of a dandelion in flight, Dandella is a GPS device that shows you the way. Inspired by how young sunflowers …
Digital Overruns Nature: Pixel Attack
Florian Conradi and Michelle ChristensenApparently, camouflaging oneself with digital patterns rather than nature-imitated patterns functions as a better camouflage within "old-nature" situations. So the digital …
DrinkPeeDrinkPeeDrinkPee
Arnoud van den HeuvelDrinkpeedrinkpeedrinkpee is a project by Britta Riley and Rebecca Bray about the role our bodies play in larger ecosystems. It's an installation about the Urine to Fertilzer DIY …
Egg improvements
Koert van MensvoortSince it is Sunday, let's have a genetically photoshopped egg with a handy integrated eggholder. Not sure if these should be mass produced (if possible): Too painful for the …
Energy Saving Chandelier
Koert van MensvoortI deem you have to be over sixty to have an object with so many historical layers of media in your house. Let's analyze. We are looking at a chandelier in which the candle …
Epidermits – The Tissue Engineered Toy
Koert van MensvoortThe world of tissue engineering is usually associated with medical applications . But how about some tissue engineered toys? The Epidermits toy is the Karten Design firm 's …
Feeding the world: oh not organic
Koert van MensvoortDaring talk by agriculture expert Louise Fresco , who has the guts to break the organic trance of the fashionably-natural-farmers-market people at TED . During her talk she is …
Field of Waves
Koert van MensvoortParks are not nature. Parks are culture: man-made simulations of nature, carefully constructed to provide walkers, runners and mountain bikers with a recreational, yet confined – …
Four environmental 'heresies'
Koert van MensvoortTED talk by Steward Brand – the man who helped usher in the environmental movement in the 1960s and '70s – has been rethinking his positions on cities, nuclear power, genetic …
French Hyperbodies
Koert van Mensvoort"Paris, printemps 2019: Oh Darling, you look gorgeous." Nowadays we are so used to Hollywood hyperbodies – a simulation of a body that never existed – it is good to see a …
Fruit4Day
Koert van MensvoortFruit does wonders for your health. No doubt about it. It is recommended to consume two pieces of fruit each day. One.. Sorry, I've lost count? How convenient to have the two …
Games Become Jobs: Gold Farming in China
Koert van MensvoortChinese workers slaying monsters to earn gold for western consumers. It sounds surreal, but it is a far from virtual reality for the so-called 'gold farmers', who are working in …
Growth Assembly
Arnoud van den HeuvelThough the example product seems a little far-fetched; growth assembly could be quite revolutionary. Worldwide shipping of manufactured things is very inefficient. Why not ship …
Hamburger sneaker
Koert van MensvoortWe are unsure whether it is just an accidental evolutionary recombination, or that the hamburger sneaker was bound to happen – somehow, it feels natural. Our peculiar object of …
Get it out of Your Head
Arnoud van den HeuvelTalking about image consumption ... Via scaryideas.com | Related: Some Kids Don't Like Chicken | Banksy Pet Store | Featherless Chicken | Confetti Chicken | FFR Image Consumption
How to Grow your Own Toaster
Koert van MensvoortNow here is an experiment any one can do at home: Look around in your house and try to find a consumer product of which you know where it was made and by whom. Got any? Indeed, …
Hyper Fruit
Koert van MensvoortImaginary advertizement for genetically engineered hybrid hyperfruits featuring an 'limwi', 'kiwange' and a 'strawblackberry'. Imagine a taste of things to come. Makes you want to …
I'm loving it
Koert van MensvoortSometimes you just need to settle with the surrogate. Peculiar image of the week. See also (in the baby series): Infant pillow , We are all born in a world . Thanks Hendrik-Jan .
Kiwi Juice Packaging
Koert van MensvoortWhat you see is what you get – at least that is what you hope – with this biomimicked kiwinut juice packaging designed by Naoto Fukasawa. See also: Image consumption , Image …
Laptop Pillow
Koert van MensvoortWith who or what do we have contact the most in our daily life routines? Our family, our bed pillow, doorknobs maybe? The answer is probably: Display. And now there is even a …
Lucky Fruits
Tijn KooijmansA Chinese farmer, Gao Xianzhang, has invented baby-shaped buddha pears and he is planning to export his idea. The produce became a success in his local province since people seem …
Mapping the human desire to be touched
Dr NaturalFleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …
Genomics & the mapping of a wine grape
Koert van MensvoortWhat is genomics? How will it affect our lives? Serial entrepreneur Barry Schuler explains the genomics revolution. We are now not just reading genomes, we are writing them. …
Meat Pork
Koert van MensvoortThis meat pig was reconstructed by Ton Meijdam . See also: Get vegetarian teeth and eat less meat , Million Dollar Burger , Back to where it came from ,
Modern Fossils
Arnoud van den HeuvelRemember the Gameboy Bricks by Gijs Gieskes? The same vibe must have been picked up by Christopher Locke (Chicago, US) as he opened his Modern Fossils Shop with many more peculiar …
Modernistic Meat
Koert van MensvoortThis slightly uncanny piece of modernistic meat is actually not made from meat, but from wax, oil, paint polystyrene, stage blood & latex, by artist John Isaacs , who titled …
Nano snowman
Rolf CoppensThis snowman is 10 µm across, 1/5th the width of a human hair. The snowman was made from two tin beads used to calibrate electron microscope astigmatism. The eyes and smile were …
Not so Happy Meals
Arnoud van den HeuvelThis week a Brazilian prosecutor asked a judge to nationally ban toys sold with meals in fast-food outlets like McDonald's and Burger King, because it can lead children to develop …
OOMouse versus Magic Mouse
Arnoud van den HeuvelRecently were introduced, the OOMouse ... ...and the Magic Mouse . Both tools are developed to browse the ones and zeros more easily. It almost seems unfair to compare them, so I …
Orthorexia Nervosa: the "healthy" eating disorder
Koert van MensvoortFollowing anorexia nervosa (under eating) and bulimia nervosa (overeating and compensating), orthorexia nervosa (obsessively healthy eating) is the latest eating disorder in the …
Pelvis Rocking Chair
Arnoud van den HeuvelIt is nature, but not like we know it when chairs biomimic the pelvis. This anatomic Ruby rockingchair was designed by Pouyan Mokhtarani , Tehran (Iran). Via b oingboing.net | …
Plant Plays First-Person Shooter
Koert van MensvoortAfter the plant that glows when thirsty , the plant that calls when thirsty , the dataplant , plantvertizing , the emphatic plant and the blogging houseplant , there is now a …
Project Natal: You are the Cursor
Arnoud van den HeuvelToday browsing and gaming is dominated by the shortcomings of machines, for machines simply do not know who is on the other end. Man needs to interact; therefore man needs to …
Robot hand meets Sushi
Arnoud van den HeuvelWe are anxiously waiting for the robot that makes the sushi, but at Squse , they have created the hand that can carefully place the delicacies in a box without crushing them. …
Sunlight-shaped Furniture
Arnoud van den HeuvelAustrian designers Katharina Mischer and Thomas Traxler have created a solar powered machine that makes arrays of furnishings that vary based on how much sunlight it receives over …
The Eye of a Cyber Sapien
BartAn earlier post on this blog already displayed the possible future of sight using augmented contact lenses. Researchers at MIT take this second sight to a next level by …
The Nanosong
Arnoud van den HeuvelThe American Chemical Society is holding a contest seeking short videos that answer the question: "What is nano ?" UC Berkeley graduate student Patrick Bennett and his colleagues …
The Printed Pot
Koert van MensvoortThese printed pots were inspired by Southwest Native American pottery and were printed using powdered slip and binder in a three-dimensional printer. Mixing ancient traditions …
The Robot Versus the Sign
Arnoud van den HeuvelQuote Eric Horvitz : "After finishing my doctoral work, I returned to Stanford Medical School to finish up the MD part of my MD/PhD. During one of my last clinical rotations, I …
The Trillion Node Network
Rolf Coppens"I think there is a world market for maybe five computers" , a remark made by Thomas J. Watson of IBM in 1943. But what if the number of computing devices connected to each other …
Everyday...
Koert van Mensvoort... a new McDonalds opens somewhere in the world. Via RebelArt , via Ekosystem . Related: post-apocalyptic religious artefact , hamburger sneaker , Image consumption .
Triceracopter
Koert van MensvoortThe Triceracopter is half Triceratops, half helicopter. If dinosaurs and technology evolved at the same time, this is what the helicopter might have look like? Built as a …
Urban Camouflage
Koert van MensvoortLaurent La Gamba makes photographic installations dealing with camouflage. His work juggles with the idea of natural procrypsis in the urban space and deals with the relations …
USB Finger
JurrianNo this isn't photoshopped. After a motor accident Finish hacker Jerry Jalava decided not to use a normal prosthesis and felt that a prosthesis usb memory stick would enhance his …
WakeUp light tested on Roosters
Koert van Mensvoort://nextnature.net I tend to think of the Philips Wake Up Light as a product of missed opportunity: Good concept, implementation too cheap and illustrative. Especially the crappy …
Water Shows When the Heat is On
Koert van MensvoortDesigner Carlijn Compen upgraded her watertap with some LED's that shift color along with the heat of the water. A simple yet effective example of information decoration that will …
![Visual of Wetware [definition]](https://nextnature.net/media/pages/magazine/story/2009/wetware-definition/03c3434b26-1602632752/wetware-868x486.jpg)
Wetware [definition]
Arnoud van den HeuvelThough its exact definition has shifted over time, the term "wetware" and its fundamental reference to "the physical mind" has been around from the mid-1950s. In its original, …
Where newspaper racks go to die
Koert van MensvoortThese photos of disused newspaper racks in a San Francisco storage yard – taken March 13, 2009 by AP/Noah Berger – are pretty much all you need to know about the state of the …
Where the Green Grass Grows
Arnoud van den HeuvelIt grows freshly in your windowsill; a lawn to linger. By hyock.com | Related: Grass Wheel | Office Grass | Caravan Garden | Parking
Who designed the banana?
Koert van MensvoortLooking at a banana from a design perspective, one immediately notices the fruit is highly ergonomic and sophisticated: Bananas fit perfectly in the human hand, they come with a …
You Are What You Eat, part II
Arnoud van den HeuvelMark Menjivar created a series of portraits of people across the United States, by taking pictures of their refrigerators content. Quote: "For three years I traveled around the …
3D Bioprinter promises tissue on demand
Koert van MensvoortBehold "the world's first production model 3D bio-printer." A machine capable of arranging human cells and artificial scaffolds into complex three-dimensional structures, which …
Acoustic Botany
Michael KluverWith his speculative ‘acoustic garden’ David Benqué tries to explore our cultural and aesthetic relationship to nature. He states that the current debate around Genetic …
Brand Environmentalism: The Augmented Reality Sneaker
Hendrik-Jan GrievinkOnce, we wore footwear to protect our feet from the hostile influences of our natural environment. But with the replacement of our natural environment by a world of design, the …
Augmented Reality Maps
Michael KluverSince a few years the internet in combination with mobile phone technology brought us something that we refer to as augmented reality : A digital projection that is placed over …
BioPong II
Ties van de WerffThis time no technological enhanced roosters, dogs, cats or wood lice, but sheep! The famous viral Extreme Shepherding by The Baaa-Studs.
BMW's Flexible Skin Concept GINA
Michael KluverThis extraordinary concept model that came out of the batcave of BMW shows how textile might be the future of car design. By replacing metal bodywork with a strong but flexible …
Breathe, Believe, Surf the Web
TimoA while ago a plan was proposed within the European Union to add a “Three Strikes, Out” law regarding to copyright infringement. After three accuses of copyright infringement by …
Car Skin
Koert van MensvoortOur peculiar image of the week was created by artist Olaf Mooij . Seen at Discovery Festivals Cabinet of Curiosities .
Clothes from a Can
Hendrik-Jan GrievinkFrequent readers of this website might be familiar with our claim that Next Nature emerges from a fusion between the Born and the Made. But now we can add another: the fusion of …
Clouding the brain
Ties van de WerffMan is a flexible species. We tend to adapt quite rapidly to new environments. But how fast can these adaptations turn to new evolutionary traits? For instance: to what extent is …
Death: An in your Face type of Business
Marco van BeersEveryone wants to be remembered after his or her death. Some choose to be buried, others to be cremated. The company Cremation Solutions has a new service which ensures you will …
Digital Gastronomy
Koert van MensvoortThe food printer seems to be one of those lustrous concepts that continues to pop-up in the fantasy of techno-connoisseurs. Some years ago James King already proposed a printed …
Engineering Mosquitoes into Flying Vaccinators
Koert van MensvoortScientists have developed a mosquito that spreads vaccine instead of disease. The researchers, led by molecular geneticist Shigeto Yoshida of Jichi Medical University in Tochigi …
Friendly Vending Machine
Koert van MensvoortDesigner Guus Baggermans was quite annoyed by the clumsy impoliteness of current vending machines, that typically require you to enter some abstract number to select your drink or …
From Main Street to the Mansion: Disney, Playboy and the Next Nature of Sex and Death
Peter LunenfeldNature demanded that we make a choice between immortality and sex, but the Next Nature of the 21st century may not. For help, we can look back to the 20th Century, which had many …
Geminoid Female
Arnoud van den HeuvelProfessor Hiroshi Ishiguro ( Intelligent Robotics Laboratory at Osaska University) has done it again! This time in coöperation with robot-maker Kokoro Co. Ltd . Objective: to …
Goodbye, Nature vs Nurture
Talking about nature and nurture as separate, clear-cut forces is far adrift from the complexities of developmental science, says Evelyn Fox Keller in NewScientist . ONE of the …
Hay Baling Fun
Dr NaturalIt is a widespread belief that, contrary to people living in urban areas, farmers have a strong connection with 'nature'. One seriously starts to doubt that after watching this …
In Pursuit of Artificial Flavoring
Koert van MensvoortFollowing in the footsteps of a Marco Polo-esque spice trade, next nature explorers Jon Cohrs and Ryan Van Luit travel by canoe past massive cargo ships and factories in search of …
Infobesity
Arnoud van den HeuvelCould this 2.0-bird be suffering from Infobesity ? Then it must be the result of excessive infocalorie consumption. Following people and news-sources on microblogservices like …
Keep it cool with the Bio-Robot Fridge
Koert van MensvoortThe Bio Robot fridge is a speculative product that uses a non sticky, odourless gel to envelope stored food as individual pods. The idea is that the gel cools by absorbing heat …
Kosher Coke
Arnoud van den HeuvelLast week I opened a bag of potato crisps that read: "We know the origins of all our ingredients" . As some crisps had already disappeared down my throat, this made me suddenly …
Let the Bacteria do the Cleaning
Koert van MensvoortDusting furniture and floors should be history in forty years time, as special bacteria in a yet to develop cleaning product will be eating the dirt. The speculative cleaning …
Meet the Cellphone that drinks Coke
Koert van MensvoortChinese designer Daizi Zheng created a conceptual mobile phone for Nokia that could be powered by cola. The idea is the phone could run on a battery that uses enzymes to generate …
Memory Helmet
Arnoud van den HeuvelProtection is the fundamental purpose of the helmet. This helmet, a conceptual design project by Seungjoo Lee , enables the storage and protection of memories. Plug in your USB to …
Mercedes-Benz Was Here
Hendrik-Jan GrievinkIn the older days, people had to cross natural barriers like mountains for survival purposes. Grains from one side of the mountain was traded with cloth from the other side, for …
Mind Expanding Lead
Florian Conradi and Michelle ChristensenThese pencils release allegedly mind-expanding aromas, letting you 'smell your way to smartness while you write'. According to the creators , the fragrance is encapsulated using …
Nano-Silver Foam Condom For Women
Koert van MensvoortAs we are calling for debate-provoking nanotech products that might hit the shelves of the Supermarket in the next ten years , some products much crazier than the ones we could …
Nano Supermarket – Opening Pictures
Koert van MensvoortLast Saturday, our Nano Supermarket opened its doors in a pleasurably crowded atmosphere. Below are some snapshots of the opening event. If you happen to be in the neighborhood, …
NANO Supermarket – Introducing the Jury
Ten days left to submit your speculative product idea for the Nano Supermarket . The jury that will select the finest submissions – to be exhibited in the Nano Supermarket this …
Natural-Born Junkies
Orestis TsinalisHippopotamus: a 2,5cm-long tablet-shaped nonliving chewable animal, member of a multi-species flock known as the Animal Parade, which tastes like fruit and is found in little pill …
Next Nature Movie #2: Being There
Koert van MensvoortThe main character in ‘Being There’ (1979) is a simple-minded gardener named Chance, played brilliantly by Peter Sellars, who has spent all his life as a servant in the Washington …
Next Nature Spotter – iPhone application
While the spotting of old nature phenomena in our surroundings – birds, insects, trees, stars, etc – has a large tradition enjoyed by millions, the spotting of next nature …
Nomadic Plants
Koert van MensvoortNomadic Plants are a species assembled from a group of robotic-electronic-biological organisms living in symbiosis in order to survive in habitats affected by human activity. The …
Old People as Old Nature
Orestis TsinalisTwo grannies assessing the milk productivity of two goats by means of a chart: this is the story of the commercial behind this screenshot. The first granny is a data analysis …
Onion Pill
Koert van MensvoortSince the intake of medicines has become a mundane ritual nowadays, why not naturalize the interface? French artist Mathieu Lehanneur is rethinking the pill-person interface in …
Reading the Body: Finger Length Ratio Predicts Athletic Ability
Martijn van MensvoortThe human body is increasingly recognized as a biometric source of information for a wide spectrum of issues, including security, psychopathology, personality and health. Earlier …
Runaway Robots Hunted by the Mammals They Were Designed to Replace
Zack GottliebLast week, the U.S. Navy announced that four of their “ REMUS 100 ” unmanned underwater vehicles sailed off-radar and stopped responding to commands. The ‘bots were part of a …
Seashells are becoming Unnecessary
Minke KampmanAt the beach, I'm always on the look-out for seashells big enough to hold against my ear to hear the sound of the sea . This child-like behavior still resonates with me. But I got …
Self Catching Fish
Koert van MensvoortResearchers at the Marine Biological Laboratory at Wood's Hole, Massachusetts, are testing a plan to train fish to catch themselves by using a sound broadcast to attract them into …
Sex or Cellphone? Survey says 29% prefers the phone
Koert van MensvoortSamsung has released the results of a consumer study that indicated nearly a third of Denver–area residents would sooner give up sex for a year that go without a cell phone for …
Skin Paper
Koert van MensvoortSkinpaper is a speculative work by Tommaso Lanza and Vanessa Harden that explores the cross section between a living specimen and paper. "Skin paper is made of breathable …
Smart vending machine
Arnoud van den HeuvelAt Tokyo's Shinagawa Station visitors can now select beverages from a 47-inch touch panel. An embedded camera will recognize your gender and age, allowing the machine to …
Stephen Hawking: Übermensch
Koert van MensvoortThis sculpture of scientist Stephen Hawking – who is both highly intelligent as well as highly dependent on technology – is our peculiar image of the week. Created by by Dinos …
Sign Out Forever
Hendrik-Jan GrievinkAn earlier post on Next Nature learned that The Good People behind Webwill provide us with a service to extend our lives on social networks after our physical death. But what if …
The Anthropocene Debate: Marking Humanity’s Impact
Elizabeth KolbertIs human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …
Transgenic Stingrays for Fashionable Feet
Allison GuyRayfish Footwear, a company based in Thailand, has recently produced what may be the world's first genetically modified stingray. This ray exhibits an unusual, colorful pattern …
Transnatural Expo + Symposium
Koert van MensvoortIf you happen to be in the neighborhood you might want to attend the Next Nature lecture I will be throwing at the Transnatural symposium this Saturday 13-03-2010 at the Trouw …
Unlimited Urban Woods
Rolf CoppensWhat to do when you have a small city with limited space, and you rather turn available space into parking lots instead of parks? You turn to DUS Architects for an unlimited …
Washable Tattoo
Hendrik-Jan GrievinkSo we know now that we can embed the traces of our every day lives in our clothes . Well, some might find this strategy unsatisfying and would like to embed the traces of their …
A day made of glass
DesignDirkThis video shows the design vision of Corning, a company that specializes in glass. Not just any glass, but glass incorporating technology, electronics and displays. And it sure …
Afterlife for Atheists
Lisa van der VoortWhere religions promise their believers a life after death and cryonics also needs a kind of belief in future technological development, designers James Auger and Jimmy Loizeau …
Animal-Free Meat Could Put a Hold on Global Warming
Koert van MensvoortGrowing meat in the lab, rather than slaughtering animals, could become a viable alternative for people who want to cut the environmental impact of their food consumption, but …
Beetle Egg
Koert van MensvoortOur peculiar image of the week presents us the lustrous uncannyness of a Beetle car in its embryonic stage. Rest assure: this is fiction, however, metaphorically the sculpture by …
Blue, Belgian and Beefy
Allison GuyThe Belgian Blue is a unique cattle breed that was developed quite accidentally in the late 1800s. An chance mutation lead the cattle to develop 'double muscling,' which occurs …
Bulletproof Skin
Lisa van der VoortRecent work of artist Jalila Essaïdi exemplifies of how science and art can meet and create meaningful inventions for society. Jalila Essaïdi used the spider silk produced by …
City Rats Love Ethnic Food
Allison GuyCity rats, it seems, prefer the same foods that humans do: Greasy, fatty, sweet, and salty. Although rats are usually seen as the billy goats of city life, ready to chow down on …
Conquering the Skies
Luc de SmetEverywhere we go, we conquer the land and shape it to our preferences. The next place to build might as well be the clouds. Tiago Barros , designer and architect, has decided to …
Did Nature Cease to Exist in the '60s?
Koert van MensvoortOur historical snippet of the moment is a Canadian television fragment from 1968 featuring a debate between Norman Mailer and Marshall McLuhan on the implications of media …
Drugs are Nuts
Stefan FinckenThinking about Next Nature can sometimes result in a feeling of vertigo. Normal standards are eroded and slowly replaced by next natural ones. A bewildering example can be found …
Entoforms
Bastiaan EkelerArtist Dolf Veenvliet ( Macouno ) is creating future fossil trilobites that have yet to exist. Using generative computer models, his Entoforms are not the result of millions of …
Fly Paper Clock
Koert van MensvoortBionic horror by designers James Auger and Jimmy Loizeau , who have created a clock that traps insects on flypaper before depositing them into a vat of bacteria. The resulting …
Gamers Solve Enzyme Riddle
Natalie DixonIn a vivd example of the blur between culture and nature, players using an online game called Foldit have helped solve complex questions for researchers about enzyme models. The …
Glowing Glucose
Marco van BeersMaybe you still remember the tattoo which helps to monitor a diabetic’s glucose level. A permanent solution. Now Japanese scientists from the University of Tokyo created a new way …
I am not a Robot. I am a Unicorn.
Arnoud van den HeuvelAt Cornell Creative Machines Lab they were curious to see how two "chatbots" would make conversation. Powered by Cleverbot , created by AI researcher Rollo Carpenter, the robots …
Incredibly Shrinking Humanity
Allison GuyArne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow
Information Decoration Scarf
Koert van MensvoortRemember the Information Decoration essay which argued our so-called information society barely employs our human bandwidth, as most of the data in our lives is presented in …
Is that a hamster in your pocket or are you just pleased to see me?
Natalie DixonMobile phones may be the most affective technology we own but researchers at the Design Research Lab in Berlin have taken this notion to its most outlandish limit. Their cellular …
Live a happy life!
Marco van BeersRemember the movie Eternal Sunshine of the Spotless Mind, where Jim Carrey removes his memories of a relationship with Kate Winslet? According to researchers at the University of …
![Visual of Manko & Dinner [#7]](https://nextnature.net/media/pages/magazine/story/2011/manko-dinner-7/fa6279d39a-1602632753/manko9-868x486.jpg)
Manko & Dinner [#7]
Aston RevolaManko blinked. Then blinked again, and again and again. While he did, he went through various layers at once and he was dazzled and amazed, his jaw dropped at all that he saw. He …
![Visual of Manko & The Children [#9]](https://nextnature.net/media/pages/magazine/story/2011/manko-the-children-9/3d8fe20352-1602632753/manko9-868x486.jpg)
Manko & The Children [#9]
Aston RevolaAs they went down the elevator shaft, going deeper underground, neither Nada nor Manko spoke a word. To Manko it seemed to take forever. In his mind, he went over the long …
Meet the New Meat
Koert van MensvoortWhat do you think of lab-grown meat? "Yuck" might be your first reaction. One day, however, it could become the environmentally friendly alternative for breeding cows and pigs for …
Mushrooms in the Mokum
Allison GuyMediamatic is hosting a pop-up urban mushroom farm in the middle of Amsterdam. Rows and rows of shiitake, oyster, and the elusive almond-flavored Agaricus subrufescens are …
Nano Supermarket seeks Assistants
Always wanted to work in a Supermarket? Here is you chance. The Nano Supermarket seeks assistants. The Nano Supermarket assistant is part of a team, knows the products and knows …
New steps to meld mind and machine
Gabi RasUntil now we've seen the types of brain-computer interface where the human has to put on some sort of bulky hat full of wires to control a machine. It won't be like that for long: …
Parks & Planes
Natalie DixonAlong with a library and museum, Amsterdam's Schiphol Airport recently added a park to its list of attractions. Officially opened by Princess Irene, the first Airport Park in the …
Peelable Ice Cream
Koert van MensvoortFiled under Biomimicmarketing . Pleases your inner monkey. Peelable banana ice cream by Nesle . Thanks Jurrian.
Phone Camouflage
Arnoud van den HeuvelIn twenty years , the mobile phone has become man's closest utensil. Can you imagine living without this umbilical box? Too bad it's often still a box that we hold to our ears... …
Plastic Planet
Koert van MensvoortWe tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …
Policing Genes
Rolf CoppensThe genetics of the plants in your garden could become a police matter. Pharmaceutical companies are experimenting with genetically engineering plants to produce useful and …
Remediation
Koert van MensvoortThis disposable aluminum barbecue on top of an original Weber barbecue nicely illustrates how people – time after time – employ technology to make life more convenient while …
Resizing Daddy
Allison GuyA little girl gets angry at her father, and uses her index finger and thumb to make a pinching motion . No, she's not trying to hurt him. She's using iPad sign language to say, "I …
Shopping in 2015?
Natalie DixonA panacea Yoghurt? Cures athlete’s foot, acne and dandruff! Triple irradiated Spinach? Three-week shelf life! Funa sushu? Asian carp fresh from Lake Superior! Minority Report …
Shrink
Rolf CoppensYou are what you eat, taken seriously. Shrink is a work by the artist Lawrence Malstaf . Visitors place themselves between two large, transparent plastic sheets. The air gets …
Skyscrapers for Pandora
Erik SwaagstraWe've previously featured architecture that imitates nature by opening its walls like a flower , or drifting like a cloud . However, maybe this is not imitation enough. The next …
Snapshots from the Next Nature Lab
Koert van MensvoortLast week, the young and talented designers of the Next Nature lab at the Eindhoven University of Technology presented their end of term works in an internal exhibition. There are …
Social Microbial life
Marco van BeersMyMicrobes , interestingly dubbed "Fecesbook" by ABC News , is the new social network for your gastrointestinal bacteria. For only $2,100 and a bit of poo you can become a member …
Soundmixtree
Arnoud van den HeuvelDiego Stocco is sound designer and composer from Burbank CA/US. He plays a tree as a rhythmic musical instrument, recording its sounds using a custom stethoscope. I suggest him to …
Spidergoats & Superskin
Stefan FinckenWhile some of us might have heard of the humorous but fictional ' spider pig ,' spidergoats are the real deal. Although you might expect to see them lounging in giant webs or …
Steve Jobs 1955 -2011
Arnoud van den HeuvelSteve Jobs , former Apple CEO, passed away on Wednesday October 5th after a long battle with pancreatic cancer. Technology conceived from his vision has changed the world …
Sympathy for the Device
Robin PohlTweenbots are small robots that depend on the kindness of strangers. They are only able to move straight forward and do this constantly. Once they get stuck in a hole or at a …
Tattoo 2.0
Marco van BeersAs a child you probably had one of those temporary tattoos that come packed with over-sweetened chewing gum. It was a nice decoration, and a way to stand out. Recently researchers …
Use and Abuse of Vegetational Concepts
Koert van MensvoortOur proposal to study the financial system as an ecosystem is sometimes criticized as 'abuse of vegetational concepts'. Interestingly enough BBC documentary maker Adam Curtis now …
The Afterlife of PIG 05049
Allison GuyChristien Meindertsma spent three years tracking down every product made from a single pig. Pork made a showing, but the more strange goods were "ammunition, medicine, photo …
The Nauga's Hyde
Allison GuySometimes new technology has to bio-mimic old nature to be accepted. In the late 1960s and early 70s, Uniroyal Engineered Products invented the 'nauga' a beast that gives its name …
The Neighborhood's DNA
Allison GuyI've noticed DNA spray notices springing up around Amsterdam. I assumed it was a fairly standard anti-theft device: A crime is committed, a little nozzle is activated by the …
The Real Coming to America
Jeffrey BraunChristopher Quinn and Tommy Walker's documentary ' God Grew Tired of Us ' tells the odyssey of four boys from Sudan who embark on a journey to America after years of wandering …
The Search for the "Real" Thanksgiving
Allison GuyThanksgiving is fake-for-real. While it's true that there was a minor harvest feast in 1621, held by English immigrants and Wampanoag Indians, the event was never celebrated …
The Sound of the Blue Canary
Berry EggenBlue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
Vertical Farming
Koert van MensvoortColumbia professor Dickson Despommier imagines filling New Yorks skyscrapers with farms. As over 50% of the world population now lives in urban areas, this scenario could solve …
The Woods Smell of Shampoo
Koert van MensvoortNamed after the story of a city girl that washes her hair with pine-needle shampoo and one day walks in the woods with her daddy says "Daddy! The Woods Smell of Shampoo", this …
Think Breast is Best? Try Udder
Allison GuyScientists in China have created transgenic cows that produce 'human' milk. The researchers boosted the fat content of the milk and added three types of proteins, unique to …
Transgenic Jell-O, more human than ever!
Allison GuyThe American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …
Trips to the Moon
Billy SchonenbergWhen watching a science fiction flick, it can be hard to determine what time in the future it is set, although this is a usually an integral part of the movie. However, it is …
Typically Dubai
Koert van MensvoortPresumably the only place on Earth where burkas & protein supplements coincide in jolly harmony. Peculiar image of the week. Photo by me .
Using Pigeons as Protestors
Allison GuyArtist Jaroslav Kyša has invented a novel form of social protest . By scattering seed in front of targets in London, he can attract droves of pigeons that disrupt shoppers and …
Visualizing Wifi Landscapes
Rolf CoppensThis project explores the invisible terrain of WiFi networks in urban spaces by light painting signal strength in long-exposure photographs. A four-metre long measuring rod with …
Want Ketchup with those Flies?
Allison GuyIndustrial-scale in vitro meat may be a long way off, but for meat-lovers looking for a cheap, eco-friendly source of protein, there's no need to wait. We just have to swear off …
Who Watches the Watchers?
Allison GuyIn The Watchers , the creative geniuses at Studio Smack picture a world where surveillance systems don't just watch us - they actively judge. Are you a green-coded Conformist or …
Windmill Trees
Rolf CoppensA new Dutch landscape with windmills up to 120 meters. Designed by NL Architects .
YouTube preserves unmediated Nature
Allison GuyOn Youtube, there's a whole sub-genera of safari videos that show, in gruesome detail, what exactly it means to live and die in Old Nature. The above film is a particularly …
3D Printing a New Face
Koert van MensvoortEarlier this year, Belgian surgeons successfully performed the country's first full-face transplant using 3D printing. The operation was conducted by a medical team of Ghent …
A Computer that Nods and Waves When You Do
Allison GuyEver wish you could express yourself better over Skype? Tired of being a disconnected head-in-a-box? A team at Stanford University has rigged a Mac computer screen to shake its …
A Fake Sun for Your 25/7 Life
Allison GuyThe earth operates on a 24 hour cycle, and so do humans. For most of history, we didn't have much choice in the matter. However, in the absence of visual cues light sunlight, some …
A More Realistic Mermaid
Koert van MensvoortAfter being denied permission to reproduce the famed Little Mermaid statue from Copenhagen, the authorities of Vancouver decided to go for something more realistic.
A Space-Faring Backup for Earth's Biota
Allison GuyElon Musk, the chief executive of spacecraft company SpaceX, believes we need to reinvigorate popular interest in space colonization, not just to boldly go where no man has gone …
Algae in the Supermarket
JenniferAs mentioned earlier , the world seems obsessed with algae. Not limited to producing light or energy , algae has also found its way to our plate as a new vegetable, and maybe …
Antifreeze from Fish Blood Keeps Low-Fat Ice Cream Rich and Creamy
Allison GuyFat is what makes ice cream taste rich and creamy. It's called ice cream, after all, not ice skim milk. So how have some manufacturers managed to make reduced fat ice cream that …
Arne Hendriks – Incredible Shrinking Man
Koert van MensvoortArtist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.
As Corn Withers in the Drought, Farmers Fatten Their Cows on Candy
Allison GuyFarmers have long made frugal use of their table scraps, feeding their leftovers to hogs, dogs and now, cows. In a bizarre sign of our cash-strapped and climate-changing …
Bacteria Inspire Magnetic Hard Drive
Allison GuyCertain types of bacteria can navigate using magnetic nanoparticles as tiny compasses. Researchers at the University of Leeds have extracted the protein that controls this process …
Better Than Nature?
Rachel ArmstrongAt the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments. These teeny tiny photogenic doggies, which had been …
Book as Human-Computer Interface
Stefan FinckenIn combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.
Bunny Doesn't Grow on Trees
Allison GuyHaving trouble getting the kids to eat their fruits and vegetables? Try turning their 5-a-day into a trendy, collectible toy. We've seen Buddha fruit and square watermelons …
Charging Phones by (and with) Camp Fire
Allison GuyWith areas of New York still without electricity, BioLite recently came to the rescue of Brooklynites by setting up a charging station with camping stoves that convert excess …
Complete Computer Simulation of a Bacterium Holds Hope for Medicine
Allison GuyResearchers at Stanford and the J. Craig Venter Institute recently created the first complete computer model of an organism. The simulation models the genome and life processes …
Complexity and Evolving Synthetic Soil
Rachel ArmstrongTwenty-first century society draws from a world that is less determined by objects and increasingly shaped by connectivity. The clear either/or distinctions that formerly informed …
Corpus 2.1
Hendrik-Jan GrievinkCould you imagine yourself having QR-code freckles, or a chlorophyl skin? Dutch artist Marcia Nolte visualises these kind of speculative scenarios in a very non-spectacular yet …
Creating the World's Cutest Fruit
Allison GuyJust like corn, bananas , and essentially any other plant we cultivate, the Cutie mandarin is the result of a concerted effort to produce an ideal food. Mandarin oranges come from …
Dolphin Wannabe
Arnoud van den HeuvelSame article , different example: Water Powered JetPack by Jetlev . (Thanks: Marlies Peeters)
Don't turn that page, it's patented
Rolf CoppensApple's recent work on iOS has been using as much references to "natural" elements as possible, making the digital as physical as possible. Doing how they do, they have been …
Dumpster Fish the Future of Farming
Allison GuyCities have seen guerilla gardens, rooftop honey production, and fire escape chicken coops. Now, urban farmers may be adding aquaculture to the mix. Headed by ex-banker …
Dyeing Salmon Pink for Farms and Profit
Allison GuyWild salmon gets its robust pink color from a diet rich in red-hued krill. Farmed salmon are fed on fish meal, chicken byproducts, soybeans, wheat and a long list of other …
Eating In-Vitro: Kitchen Meat Incubator
Koert van MensvoortThe Kitchen Meat Incubator does for home cooking what the electronic synthesizer did for the home musician. It provides its users with a set of pre-programmed samples that can be …
Eating In-Vitro: Knitted Meat
Koert van MensvoortRather than growing whole steaks in bio-reactors, Knitted Meat assumes that it is more feasible to create thin threads of protein. Supermarkets sell balls of meat fiber seasoned …
Eating in Vitro: Magic Meatballs
Koert van MensvoortMagic Meatballs are designed to playfully familiarize children with lab-grown meat.
Meat, the Expectations
Koert van MensvoortAs the planet’s population speeds towards 9 billion, it’s becomes impossible to continue consuming meat like we do today. Will we all be eating rice and beans? Grasshoppers …
Eating In-Vitro: Rustic In Vitro
Koert van MensvoortMany people still find in vitro meat too alien and artificial to put it in their mouths. With the Rustic In Vitro incubator, this outdated perception is about to change. Similar …
Edible Deodorant Candy
Marco van BeersRemember Lucy McRay's swallowable perfume ? Well, now you can buy it. Annu Alpi has developed a piece of deodorant candy which presumable makes women smell like roses for up to …
Enjoy Udder Milk
Koert van MensvoortImaginary infomercial on the hypernatural udder cows, optimized for milk production
Gordan Savicic - Facebook Suicide
Koert van MensvoortSlowly but steadily the digital environment is becoming the primary living space where we interact and define ourselves. According to Gordan Savicic however, some things are still …
Fake Leaf is Twice as Efficient as the Real Thing
Allison GuyImproving on photosynthesis has long been a dream for scientists. The so-called artificial leaf – which wouldn't necessarily look like one – would run on only solar energy and …
Photoshop Your Way to Beauty
Lisa van der VoortFilmmaker Jesse Rosten shows his critical views on body standards by presenting the exclusive beauty breakthrough Fotoshop by Adobé. This revolutionary product features pro-pixel …
Free Range Robot Filters Out the Ocean's Plastic
Allison GuyWhale sharks are great at filtering; plastic needs to be filtered. For now, however, whale sharks only have an appetite for plankton. Industrial designer Elie Ahovi has jumped …
Frying Nemo
Koert van MensvoortImage consumption in the overdrive. Peculiar image of the week. Created by Erin Murphy, Victoria Bellavia, Yong Jun Lee & Sanggun Park . Thanks Jeroen van der Meij.
Further Incredibly Shrinking Man
Koert van MensvoortArtist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.
Genetic Screening for Christmas Trees
Allison GuyIf you've turned to plastic Christmas trees because the real ones leave piles of needles behind, science is working to bring live conifers back into your holidays. A $1.3 million …
Glass Gem Corn Looks Like Jewelry
Allison GuyMost corn has been selectively bred over the centuries to be a single color: yellow, white or blue. Glass gem corn, a varietal grown by Greg Schoen , harkens back to the days when …
GM Bacteria Turn Carbon Dioxide into Biofuel
Allison GuyIn a twist on the classic " microbes that turn shit into petrol ", researchers at MIT have developed a bacterium that turns carbon dioxide into a direct substitute for gasoline. …
Growing Fruit into Its Own "Juice Box"
Allison GuyBrazilian ad agency AGE Isobar spent two years experimenting in order to grow fruits into the shape of Camp's juice boxes. Immature limes, guavas and passionfruit were packed …
Growing Plants in the Dark
Allison GuyWhile sunlight contains all colors, the dominant type of chlorophyll in plants only needs purple light to function. This simple fact has big implications for the future of …
Helmet Crafted from Wood and Cork is just as Safe as Your Plastic and Foam One
Koert van MensvoortBack to the natural future? A startup company in Oregon is manufacturing bike helmets made of wood and cork that should meet or surpass the impact performance of plastic and foam …
Herons Eat at the Local Snack Bar
Floor FrintsOriginally herons are migratory birds, in the winter they leave to warmer habitats. In the city there is enough food to survive the winter. Some herons are even too lazy to find their own food and try to collect it from the local snack bar.
Humans Caused Mass Extinctions Before There Were Even Humans
Allison GuyHumans and other hominids have a reputation for bringing about mass extinctions. Homo erectus has been blamed for the disappearance of many African carnivores, our ancestors …
Hybrid Meat
JenniferOn society's search to becoming a meatless one, several new kinds of 'meat' pop up in the food industry. From so called 'hybrid' meatballs, to 'the chicken that isn't', when will …
Implanted Magnets to Keep Your iPod Close
NextNature.netBody-mod enthusiast David Hurban has decided to make a lifelong commitment to his iPod Nano. By implanting magnets in his wrist, Hurban has created a permanent bracket to hold his …
Inside the Fastfood "Photokitchen"
KrisWhy does your food look different in advertising than it does in the store? A Canadian McDonald's marketing manager tries to answer this common question with a behind-the-scenes …
Eating In-Vitro: Instant Meat Powder
Koert van MensvoortThe number one argument for eating meat: it provides nutritious proteins that cannot be entirely supplied by vegetarian alternatives. Like it or not, humans are omnivores. Meat is …
iPhone Entertainment for Pets
Lisa van der VoortChildren can be effortlessly entertained for hours thanks to tablet and smartphone games, but these technologies also provide a solution for the lazy pet owner. More videos of …
Latro Algae Lamp
Koert van MensvoortAs advances in nanotechnology bring us increasingly energy efficient products, plant life such as algae could become attractive sources for tapping energy. The Latro lamp by …
Mainstream Perceptions on In Vitro Meat
Koert van MensvoortNothing wrong with a bit of juicy television on 'In Vitro' meat. We propose to lock this video in a time capsule so that our kids can watch it and be horrified in 30 years or so.
Making Deserts Flourish
Simone KochUsing only plastic sheets and an irrigation-nutrient system, a Japanese researcher has found a way to change agriculture as we know it. Professor Yuichi Mori argues in his talk at …
Mark Post - Meet the New Meat
Koert van MensvoortAccording to professor Mark Post, lab-grown meat could become the environmentally friendly alternative for breeding cows and pigs for meat consumption. Watch his talk!
Meanwhile in the Next Nature Lab
NextNature.netLast week, the young and talented designers of the Next Nature lab at the Eindhoven University of Technology presented their end of semester works in an internal exhibition. There …
Meat the Future
Koert van MensvoortThis promotional video for in-vitro meat was brought to you by the bureau for in-vitro meat promotion students of the Beckmans College of Design .
Mice Reporting For Duty
Jeroen PillaerdsResearchers have developed genetic manipulated mice, with extra smell receptors that make them highly sensitive to the smell of explosives. Scientists hope to use these mice in the future to discover land mines
Modern Flint Tools
Allison GuyStone tools are the most ancient evidence of our ancestor's ingenuity, proof that we've been augmenting our bodies for millions of years. These flint tools by Ami Drach and Dov …
Mul & De Mul – God's Browser
Koert van MensvoortPhilosopher and professor Jos de Mu l and media artist Geert Mul set out to visualize the Gods Browser in a unique art-science collaboration. The result is a conceptual poem of …
NANO Supermarket - Introducing the Jury
NextNature.netLittle over two weeks left to submit your speculative product idea for the Nano Supermarket . The jury that will select the finest submissions – to be exhibited in the Nano …
NANO Supermarket Unveils New Products
NextNature.netFrom sleek fashion to life-saving medicines. During the forthcoming Dutch Design Week , our lustrous NANO Supermarket debuts a new line of speculative nano products that might hit …
Natura Prossimo a Milano
NextNature.netThis week our NANO Supermarket will be visiting Milan as part of the Salone Internazionale del Mobile.
New Volvo Recognizes Shapes of Animals like Deer & Elk to Reduce Crash Impact.
Koert van MensvoortVolvo cars is testing a new safety system that automatically hits the brakes once an animal is detected in the vehicles vicinity. The Animal Detection System expands the range and …
Organic Drink Dispenser
Koert van MensvoortI didn't need to insert a coin before collecting my refreshment!
Pantone SkinTone
Rolf CoppensShould made-to-order babies become a reality in the near future, one piece of the design puzzle has been solved now Pantone has release their SkinTone system. Indexing 110 skin …
Playing With Pigs
Lisa van der VoortBesides children and pets , it turns out that pigs are also attracted to interactive interfaces. Pig Chase is a computer game in which pigs and people can play together. The aim …
Portable Data Silence
Rolf CoppensExperience full data silence with the Faraday Bag. Made from electromagnetic shielding silver coated fabric, it prevents devices inside it from being contacted. Made by artist …
Put on your Pixelhead
Rolf CoppensA while ago we wrote about the Pixelhead mask by artist Martin Backes . Now he informs us that the masks are for sale. Get one while they last!
Real Vanilla is Natural, but Natural Vanilla is Fake
Allison GuyWhat most gourmands would define as "real" and "natural" vanilla flavoring is simple: Vanilla beans steeped in alcohol. But vanillin, the chemical responsible for vanilla's taste …
Regrowing Bones with Silk
Allison GuyTime to add another superpower to insect silk, which already includes bulletproof skin and implantable microelectronics . Recent research indicates that silk may be an ideal …
Robot Fridge Forces You to Smile for Food
Allison GuyFeeling grumpy and hungry? Unfortunately, the University of Tokyo's Happiness Counter refrigerator won't open up until you give it a big smile. The concept is based on the fact …
Robutt
Arnoud van den HeuvelTokyo University of Electro-Communications , revealed SHIRI (? = "buttocks"), a "Buttocks Humanoid That Represents Emotions With Visual and Tactual Transformation of the Muscles." …
Ronald van Tienhoven - Techno Animism
Koert van MensvoortOnce upon a time animism ruled people's beliefs: both organisms and objects were imbued with a conscience. Artist Ronald van Tienhoven states that as technology closes the gap …
Rule #5: Consider Zoomorphism as an Alternative
NextNature.netFor past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. When a product imitates animal behavior, the strict social rules …
Should I be Afraid of...
Koert van MensvoortFor doom-mongers delight, the Berlin-based design studio Bold Futures made a handy interactive graph of the fatal disasters that might snuff us.
Cake Made from Human Skin
Allison GuyCake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.
Slurpee Machines Add a New Flavor: Mashed Potato
Allison GuyConvenience store chain 7/11 is serving up the latest in a line of futuristic near-foods: Instant mashed potatoes from a Slurpee-style spigot. The machine dispenses a stream of …
Spray On Liquid Glass
Koert van MensvoortNow here is a product that should soon find its way into the NANO Supermarket soon. At least, if supermarkets are willing to put it on their shelves, as they currently make huge …
The Action Plant Runs Away from Your Touch
Allison GuyPlants have it tough. They're tasty, silent, and stuck to the spot. With Jurema Action Plant, artist Ivan Henriques has given plants the mobility they deserve . Henriques' pieces …
The "Plantascraper" Sprouts in Sweden
Allison GuyWe're used to seeing proposals for high-tech vertical farms that never seem to translate to real life, but the city of Linköping in Sweden has finally taken these buildings out of …
The Relative Size of Old Nature
Allison GuyCreated by Cary Huang, this interactive scale of the universe shows the relative sizes of everything from quarks to the Hoover Dam. Be prepared for some cosmic gee-whiz moments …
The Right to Privacy
Orestis TsinalisPrivacy is a right. A right given to people by telecommunications companies and social networking websites. It can be described by multiple-choice lists of settings. And it seems …
The Rise and Fall or Rayfish Footwear
Koert van MensvoortFor almost three years, we worked on a sneaker company that we knew would go bankrupt on the day it was founded. This is our coming out...
Those Blueberries in Your Cereal, Muffins and Baking Mixes? All Fake.
Allison GuyWhat do blueberries have in common with sugar, corn cereal, modified food starch, partially hydrogenated vegetable oil, artificial flavor, cellulose gum, salt and and Blue …
Tiny Amounts of Alcohol Might Extend Life
Stefan FinckenA new study on the effects of cholesterol on the life span of Caenorhabditis elegans, a tiny worm often used in experimentation, resulted in some surprising finds. The life span …
Twitter Implant becomes a Reality
Marco van BeersYou all probably know the ' Twitter implant ' from the Nano Supermarket . Scientist at the University of Princeton now created the first working prototype. The implant is actually …
Using Simple Scents to Trick Shoppers into Buying
Allison GuyRetailers have long known that certain smells get us into the buying mood – cinnamon or warm cookies around the holidays, for instance – even if we're shopping for completely …
What is Next Nature?
NextNature.netAt the Next Nature Power Show 2011 our master of ceremony, Koert van Mensvoort gave a mini lecture on our changing notion of Nature.
Where Have All the Cucumbers Gone?
Allison GuyThis stunning graphic, courtesy of Nature & More , shows the astonishing drop in food crop diversity from 1903 to 1983. Lettuces available from commercial seed houses now …
Why does a Salad Cost More Than a Big Mac?
Koert van MensvoortRemarkable infographic by pcrm.org . Via NY Times , via Consumerist.com .
Will a Cockroach Save Your Life?
Steef PeppingOften cockroaches aren’t people's best friends, but maybe in a few years you will be relieved when you see a cockroach. Researchers of the North Carolina State University …
33% of All Seafood in the United States Is Fraudulently Labeled
Allison GuyA new study from the marine conservation group Oceana reveals that a full one-third of seafood across the US is mislabeled. Not surprisingly, the most expensive fish is also the …
3D Pizza Printer for Astronauts
Alessia AndreottiPrintable pizza. The next big food innovation after sliced bread.
3D Print Your Body in Gummy Candy
Hendrik-Jan GrievinkFabCafe in Tokyo offers a sweet new way to make self portraits.
3D-Printed Skin Cells as an Aesthetic Statement
Insoo HwangAn exploration of one way we might use 3D printed stem cells for body modification.
A Frankenstein-esque System
Fenna Klein TuenteThe boundary between humans and machines is slowly but steadily blurring. The Immortal is a machine which exists out of several life-support machines connected with wires and electric cords.
A More Interesting, More Depressing Theory of Easter Island's Downfall
Allison GuyA new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.
Anthropo-scene #1: From Rocks to Thoughts
ChristianHow geology and humanity turn ancient algae into high-tech gadgets.
Anti-BP Diseased Dolphin Ride
Allison GuyIn what's probably the most fun form of environmental protest ever, Banksy has created a morose-looking dolphin ride to protest the BP oil spill. The ride is complete with fish …
Are We Seeing the Same Thing?
Stephen PerryA fundamental philosophical question, how do we know my blue isn't your yellow? The current human and "natural" understanding of color is fundamentally based on a …
Artist Creates Portraits of Strangers Using DNA in Discarded Hair
Jiwon KimHeather Dewey-Hagborg just needs a strand of your hair to know what you look like.
Bacterioptica
Marco van BeersLiving lamps like Latro Algea Lamp by Mike Thompson are nothing new. But design studio MADLAB has created Bacterioptica , a lamp that contains organisms and bacteria from the …
Microchips Learn to Repair Themselves
Daniel BlokbergenTaking a cue from the human brain, a new microchip can rewire itself after damage.
Birdhouse Sweet Birdhouse
Alessia Andreotti3D printer company MakerBot recently launched a contest inviting designers to create the birdhouse of the future. The winner is The American Craftsman Bungalow by Brent J. …
Bizarre Retro-Futuristic Visions of Meat
Jonathon MarkowskiIllustrators from the 1800s to the 1950s offer strange prediction for the future of meat.
Bored with Sex? There's a Pill for That
Allison GuyTrials for new drugs hold promise for a "cure" for female boredom in the sack.
Bright Streetlights Make Us No Safer, and Why That's Good News
Allison GuyArtificial lighting at night makes us fat, depressed and sick. What are the alternatives?
Can This Virtual World Save the Real One?
Alessia AndreottiA Dutch artist designs a Utopian eco-socialist online society.
Cockroach Farms Do Big Business for Food and Pharmaceuticals
Allison GuyBig bugs make big bucks for Chinese farmers turning to roach ranching.
Customizing the Brain with Psychoactives
Jan Willem van der LindenIt’s long been a desire of the human species to have complete control over our own thoughts. We’ve all had these moments where we curse our brain. Asking questions like: “Why …
Dad Hires Virtual Hitman to Kill Son's Online Avatars
Allison GuyA 23-year-old in China was recently puzzled why his online avatars were being killed off at disproportionate rates. After asking around, the young man eventually discovered that …
Now Dads Can Experience Pregnancy Too
Alessia AndreottiA new device replicates the kicking and moving of a baby inside a mother's womb.
Did Forks Really Give Modern Humans an Overbite?
Allison GuyThe food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …
Diet-in-a-Pill Promises Weight Loss with Synthetic Genes
Allison GuyFat rats with unrestricted access to high-calorie food still lose weight with the help of a genetic implant.
DIY Body Modification to Hack Evolution
Alessia AndreottiBiohacker Tim Cannon inserted a chip into his arm to monitor his bodily data and transmit it to an Android device.
Eating In Vitro: Meat Paint
Koert van MensvoortPaint with meat! is a product for children of 5-10 years old. It allows them to prepare a meat dish on their own and in a very creative, fun and safe way: by painting with meat!
"Ento" Brand Normalizes Eating Insects
Allison GuyWhile Next Nature is hard at work normalizing the idea of eating lab-grown meat , a group of British design students are working to bring insect-eating into the mainstream. Though …
Our Image of Nature is Naïve
Koert van MensvoortA while ago I tried to make a landscape paintings as seen on the Bob Ross television show, yet thing turned out a little bit different in my wilderness. Nature is perhaps the most …
Food Familiarization #2: Celebrity Endorsement
Allison GuyHow "celebrity endorsements" transformed the potato from the devil's tuber into a global staple.
Free Electricity from the Technosphere
Teije OudshoornScientists learn how to harvest electricity from radio waves.
Frisky Whisky: Radioactive Booze from the Atomic Age
Allison GuyThe world's first – and hopefully last – whiskey aged with radioactivity.
From Fast Food Packaging to Flowerpot
Alessia AndreottiDesigner Michal Marko created a biodegradable food bowl. Can you imagine this bowl being used in fast-food restaurants?
Fuel Your Body With Algae Headgear
Alessia AndreottiAlgae as the future alternative fuel for the human body.
Get Your One Way Ticket to Mars
Alessia AndreottiWhat to do when earth is not enough? Thousands of people, tired of their life on Earth, are ready to emigrate to Mars. Since subscriptions opened on April 22, 80,000 people have …
Google's Shoes Talk to Runners
Alice FumeyNeed a personal trainer? Google's new sneakers fulfill the role of a human coach.
Green Colors Make Food Seem Healthier
Allison GuyWhich candy bar you choose depends on the color of the packaging.
Grossed Out by Lab-Grown Meat? Here's 7 Reasons Why You Shouldn't Be
Allison GuyIn vitro meat is creepy, unnatural and downright disgusting – and so is every other kind of food we eat.
Have We Passed "Peak Automobile"?
Jonathon MarkowskiYou’ve heard about peak oil, but what about peak automobile?
How Food Scientists Engineer the "Bliss Point" in Junk Food
Allison GuyCheetos and other junk foods are more carefully engineered than the average bridge.
Hug & Pay
Koert van MensvoortThe rise of digital currencies reduces the need for physical interaction and communication between people. At the same time every payment method still leans on trust. But how can …
In-Vitro Meat Visions in The Guardian
Koert van MensvoortLast weekends edition of the Guardian featured some of the In-Vitro Meat Visions developed at Next Nature Lab.
Invasive Sushi from Invasive Species
Allison GuyChef Bun Lai of Miya's Sushi in New Haven, Connecticut, has a cheeky solution to invasive species: he eats them. His menu regularly features lionfish and Asian shore crabs, …
iTypewriter
Hendrik-Jan GrievinkMiss the soothing clacking of typewriter keys? Long for satisfying clang of a carriage return? Get iTypewriter for iPad.
Jellyfish Ice Cream Glows When Licked
Alessia Andreotti$220 ice cream glows thanks to synthetic bioluminescent proteins derived from jellyfish.
Kid Convinces Mother to go Vegan
Koert van MensvoortWhile most children nowadays believe the woods smell of shampoo, there are still those critical young minds out there eager to question things.
La Surconsommation
Koert van MensvoortFor those who "eat meat, but don't like in-vitro meat, because it is so unnatural" . Please spend 5 min to watch this video and change your thinking. You were watching the …
Living Among Pests – Designing the Biosynthetic City
Joyce HwangJoyce Hwang discusses the challenges for designers, and gains for citizens, of living in a truly biosynthetic city.
Living Food
Koert van MensvoortMinsu Kim created a wonderful series of living dishes that wiggle and wave on your plate.
Loyal Lamps that Follow You Like Pets
Alessia AndreottiTwo lights that behave like pets, acting and reacting like autonomous creatures.
3D Print Your Thoughts
Alessia AndreottiHow incredible would it be to imagine a thing and have it magically appear in concrete form? After food , organs and virtuality , here comes the thought printer! Thinkerthing , …
Making Fake Eggs to Beat the Real Thing
Allison GuyTech experts are betting that they can make vegetarian eggs that outperform the real thing.
Manufacturing Imperfection in Processed Luncheon Meats
Allison GuyFood companies are hard at work inventing processes to make luncheon meat look "deli fresh".
Moments in Meat History Part III- Preservation
Jonathon MarkowskiThe oldest evidence of cold food storage dates back to 1700 BCE.
Moments in Meat History Part IV- Substitutes
Jonathon MarkowskiThe story goes that in the 7th Century, Buddhist monks in China stumbled upon the product now known as "wheat gluten" while cooking. Noting that it looked, felt and tasted …
Moments in Meat History Part IX - In-Vitro Meat
Jonathon MarkowskiIn 1995, the US FDA (Food and Drug Administration) approved the use of in-vitro techniques for commercial meat production, paving the way for lab-grown meat products to make their way to the market.
Moments in Meat History Part V- Industrialization of Farming
Jonathon MarkowskiIn 1876, the first cattle feedlot was established near Chicago.
Moments in Meat History Part VI - Meat the Future
Jonathon MarkowskiBy the turn of the century, some people began raising questions about our meat consumption habits.
Moments in Meat History Part VII - Factory Farming
Jonathon MarkowskiIn the 1950s, the transition towards what is now known as factory farming picked up speed with farmers.
Moments in Meat History Part VIII- Fast Food
Jonathon MarkowskiThe very first restaurant to typify the modern fast food genre was White Castle, who opened their first location in 1916 in Witchita, USA. Ironically, at the time fast food was …
NANO Supermarket nominated for Dutch Design Award
NextNature.netOur traveling NANO Supermarket is nominated for a Dutch Design Award. Winners will be announced late October.
Nanoscale Bouquet of Flowers
Stefan FinckenRoses are red, violets are blue. Nanoscale flowers are what some scientists grew.
NASA Solves the Toxic 'New Car Smell'
Jonathon MarkowskiA new material can stop toxic off-gassing from plastics, but the 'new car smell' is so valuable the car industry might not change.
"News Machine" Illustrates the Effects of Media Distortion
Alessia AndreottiThe News Machine is a contraption that explains the news distortion that happens when a message is broadcast through different media. The starting point is a tweet sent from a …
Next Nature Interview on London Real
NextNature.netLondon Real interviewed Koert Van Mensvoort on the concept of Next Nature and its implications on our planet.
Next Nature saves Old Nature
Koert van MensvoortConservation workers ask synthetic biologists to help them save the world's endangered creatures and habitats.
Next Nature TEDx Talk in Budapest
NextNature.netIndulge in the Next Nature stump speech at TEDx from Dr. Van Mensvoort
Now Your Smartphone Can Smell Like Barbecue and Buttered Potatoes
Alessia AndreottiAn olfactory device for Smartphones that spreads the aroma of barbecue using an app.
Our Electronics, 100 Years Later
Alessia AndreottiAn artist envisions our consumer electronics in a century, moss-covered and half-decayed.
Paint by Numbers, then Eat It
Stephen PerryAn innovative workshop points out future directions for in-vitro meat products.
Protocell Shoe Mends Itself
Rachel ArmstrongThe self-repairing sole is a dynamic solution to an everyday problem.
Purple GM Tomatoes Prevent Cancer
Allison GuyA new strain of purple GM tomatoes last longer on shelves and help out cancer-prone mice.
Rural India's Next Nature Testimonial
NextNature.netVideo testimonial for our Next Nature appzine, all the way from India!
Scientists Implant False Memory in Mice
Alessia AndreottiManipulations of the mind that were once the terrain of futuristic fantasy are now one step closer to becoming reality. Scientists at the Massachusetts Institute of Technology …
Shape-Shifting House Acts like a Flower
Jelle LangeraapImagine your home adapting itself to seasonal, meteorological and even astronomical conditions by changing its shape. D*Dynamic is based on the discovery of mathematician Henry …
Sitting on Tofu
Alessia AndreottiItalian Designer discovers new material. A ideal throne for a vegan king.
Swap Your Bones for an Improved, 3D-Printed Version
Alice Fumey3D printed organs are on the way. Could they be designed to be aesthetically appealing?
The 10th Anniversary of the World's First Lab-Grown Steak
Allison GuyMany people don't know that growing and cooking in vitro meat is a decade old.
The (Almost) Invisible Dancing Wheelchair
Jonathon MarkowskiDesigned by a dancer, a new wheelchair moves intuitively with the user's movements.
The birth of the artificial womb
Alessia AndreottiResearchers in Tokyo have developed an artificial womb (for goats).
The Hedonometer Uses Social Media to Measure Global Happiness
Orfeas LyrasScientists are using Twitter, blogs, and news sites to categorize the global psyche.
The Pulsating Heart of Tokyo
Alessia AndreottiAn astounding tangle of multi-colored water flowing throughout 18 arteries represents what happens every day in the pulsating heart of Tokyo. This is how Takatsugu Kuriyama , from …
The Sci-Fi Prehistory of "Victimless" Meat
Allison GuyA (very) short history of a century's worth of "disembodied" meat in fiction.
The Smart Desk: Exercise While Working
Alessia AndreottiA "breathing" desk that reminds you to change positions throughout the day.
The Talking Window: a New Audio Medium
Alessia AndreottiAdvertisers have figured how how to induce auditory hallucinations into your morning commute.
This Color-Changing Glass Could Stop Date Rape
Allison GuyBecause date rape drugs are odorless, colorless and tasteless, victims don't normally realize they've been attacked until it's too late. In a clever, necessary bit of information …
Tykkään or En tykkää? Digital Voting Takes to the Streets
Silvia CelibertiHelsinki tested out a Facebook-like interface to get public opinion on a new construction project.
'Victimless Shelter' Grown from Pig Cells
Allison GuyWhile Next Nature was busy dreaming up new in vitro meat (IVM) foods, the mad scientists of Terreform ONE in New York went ahead and designed an entire dwelling made of IVM pig cells.
We Are Not Alone Eating Fast Food
Lucie ViolleauBeekeepers in France have been puzzled by their bees producing blue and green honey. Turned out the bees were eating waste from an M&Ms factory.
What Will We Look Like in 100,000 Years?
Alessia AndreottiIn 100,000 years human beings might look like a manga character: big intense eyes, high forehead, large head, straight nose, more pigmented skin, and perfect symmetry. “There will …
Why Isn't Cream Cream-Colored?
Allison GuyOur language preserves evidence of a type of food that's all but extinct.
With "Stealth Wear", Hide from Unmanned Drones in Style
Daniel van PaesschenTired your ugly duds? Sick of surveillance drones? Does Adam Harvey have the clothing for you!
World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center
Hendrik-Jan GrievinkWorkers are completely controlled by algorithms in Amazon's fulfillment center
You Can Never Go Back To Nature
Annalee NewitzOne of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …
50 Years Ago Asimov Predicted WiFi, Smartphones and Today's World Features
Alessia AndreottiIsaac Asimov predicts in 1964 what the world will look like today, in 2014.
A Brief History of Humankind
Koert van MensvoortHistorian Yuval Noah Harari takes us on a journey through the whole human history.
A Net will Collect Debris from Outer Space
Julia WeberJAXA developes a net that could collect debris from outer space.
A Plan to Eliminate Predators
Alessia AndreottiBritish philosopher David Pearce believes we should to stop animals from hunting and killing other animals.
Acoustic Instrument That Sounds Digital
Francesca BarchiesiYaybahar is an acoustic instrument that emits sounds like a music synthesizer.
Ambulance Drone
Alessia AndreottiThe ambulance drone: an autonomously navigating mini aeroplane that can quickly deliver a defibrillator.
Balloon-Powered Internet For Everyone
Alessia AndreottiProject Loon by Google has the mission of providing Internet access to rural and remote areas, with a hot air balloon network.
Beyond the Possible with Floris Kaayk
Koert van MensvoortFloris Kaayk, artist and fictive documentaries maker, confronts us with the impossible.
Biofabricate – NN Lecture in New York
NextNature.net4th of December Dr Van Mensvoort lectures in New York at the BIOFABRICA summit. Other speakers include Paola Antonelli and Andras Forgac.
BrainDriver: the Mind Controlled Car
Alessia AndreottiImagine you could drive your car using only your thoughts. It is now possible!
Breathing Lights
Alessia AndreottiInspired by the movement of spider webs in the wind, Dutch designer Jeroen Van Der Meij created Breathing Lights.
Bugs Developed Immunity to GMO Corn
Alessia AndreottiThe Western Corn Rootworm has evolved to eat genetically engineered corn, designed to kill it.
Cosmos Tourism
Alessia AndreottiThe World View Experience offers an expensive journey to the edge of space.
Digital Native
NextNature.netDigital natives have trouble understanding life before 24/7 online connectivity.
DIY Wire Networks In India
Robin BergmanIndian fragile DIY electronic infrastructure gives an insight into our complex electronic wire systems.
Drone Crash
Lotte BiesheuvelDuring a triathlon ace a drone operated by a local photographer hit one of the athletes.
Exploring the City Soundscape
Alessia AndreottiBuq are electronic life forms that shift the experience of the street scape from the primarily visual to a more auditory experience.
First 3D-printed Skull implanted
Julia WeberFirst 3D-printed skull has been implanted on a 22 years old dutch women.
Floating Underwater Self-Sufficient City
Francesca BarchiesiAsian architects of AT Design Office want to build an incredible floating underwater metropolis that is also self-sufficient.
Food To Eat With Your Eyes
Francesca BarchiesiIn Japan, fake food industry represents a century of old crafting tradition and a multi billion business.
Glow in the Dark Trees
Lotte BiesheuvelDaan Roosegaarde is exploring possibilities to replace streetlights with luminous trees.
Google Street View Camel
Alessia AndreottiMost of the images for Google Street View are collected with a car, but for the first time, the task has been given to a camel.
Graffiti Drones
Robin BergmanLast month graffiti artist Katsu presented his graffiti drone called the ‘’spray copter’’.
Hemihelix: A New Geometric Shape
Alessia AndreottiRubber band distortions lead to discovery of a new shape called hemihelix.
High-Tech Cemetery
Alessia AndreottiIn the Ruriden cemetery, in Tokyo, over 2.000 Buddhas statues are illuminated by high-powered color changing LED lights.
How modern sanitation gave us polio
Allison GuyFor most of history, poliomyelitis was a relatively unremarkable disease – it caused paralysis and occasionally death, but only in a tiny fraction of those infected. It was …
In Memory of New Materials Gone
Koert van MensvoortA deceased scrollbar in a Church. What does it mean?
In Vitro Recipe #10: Home Incubator
NextNature.netThe home incubator does for cooking what the electronic synthesizer did for musicians.
In Vitro Recipe #11: Meat Fruit
NextNature.netMeat fruit combines the femininity of fruit with the masculine sensibilities of red meat in a hybrid celebration of our post-patriarchal, post-gender society.
In Vitro Recipe #12: Meat Flowers
NextNature.netIf vegetarian products can mimic meat, then why not the other way around?
Lab-Grown Bread for Your In Vitro Burger
Allison GuyA novel process turns wood into tasty, edible starch
Let the Drones take care of the Biosphere
Koert van MensvoortDrones are typically thought of as flying spying robots, or even worse flying spying shooting robots. But could we also employ drones for good? The people of …
Lonely Sculpture Your Next Tinder Match?
Koert van MensvoortTinder users beware: somewhere out there a mechanical finger is surfing the popular dating smartphone app. This could be your next match.
Our Tribal Gut Bacteria Are Disappearing (And Why We're Getting Fat)
Allison GuyHealthy gut bacteria may hold the key to weight loss – but only isolated communities may preserve "natural" intestinal biomes.
OUT NOW: The In Vitro Meat Cookbook
NextNature.netOn the 5th of August, one year after the lab grown hamburger, the In Vitro Meat Cookbook was launched.
Rainbow Station
Alessia AndreottiStudio Roosegaarde created a giant rainbow of light for the Amsterdam Central Station east side.
Reinventing Nature with Synthetic Biology
Alessia AndreottiBioengineer Drew Endy shares his idea of biology as a precision manufacturer that could potentially transform civilization as we know it.
Retro-Futuristic Society of Simulations
Alessia AndreottiIn 1930 Germans envisioned our Society of Simulations.
Robot Cheetah Now Runs Free
Alessia AndreottiResearchers created a robo-feline able to run and bound while completely untethered.
Robotic Easter Egg Decorator
Alessia AndreottiA robot that applies computer controlled motion to precisely decorate your Easter eggs.
Save the Humans - Call for Quotes
NextNature.netFor our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.
Share the Smell of Your Delicious Dish
Julia WeberThe oPhone and oSnap allow you to send pictures with aromatic vocabularies.
Shark Deterrent Wetsuits
Lotte BiesheuvelA new way to project yourself against sharks while enjoying your favorite watersport!
Signs From The Near Future
Lotte BiesheuvelWill these futuristic signs become part of our near future?
Solaris: Mind-Controlled Magnets
NextNature.netSolaris gives participants the power to control a pool of magnetic fluids with their brainwaves.
The Bottle of The Future is an Edible Blob
Francesca BarchiesiWhat if we could drink from a giant drop of water? The bottle of the future has the shape of a soft, hygienic, biodegradable and edible blob.
The Flying Car
Alessia AndreottiFrom automobile to airplane: the flying car is built to travel as easily on the road as in the sky.
The Human Hamster Wheel Desk
Alessia AndreottiThe Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!
The Mood Ring of the 21th Century
NextNature.netThe Moodmetric ring measures the autonomous nervous system signals that can be used to understand emotional reactions and improve quality of life.
The Tribes We Lead
Koert van MensvoortSeth Godin argues the Internet has ended mass marketing and that it brings us back to the tribe.
To Be Human Is To Be Transhuman
Alessia AndreottiBuckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.
Touching your Unborn Child
Marco van BeersThanks to 3D Babies and a mere $600,- you can now experience that excitement of holding your baby in your hands before he or she is born.
Using Tomato Skins to Make Car Parts
Alessia AndreottiHeinz and Ford team up to use tomato skins in car parts.
Veggie Burger That Bleeds Like Real Meat
Alessia AndreottiProf. Patrick Brown developed a meatless burger that look and taste like meat, made out of plant ingredients.
Virtual Reality Headset for Chickens
Alessia AndreottiA virtual reality headset could give chickens the freedom to roam without the roaming.
We Are Weaker Than Our Ancestors
Alessia AndreottiHuman fitness has decreased so significantly that even the strongest of us would consider ancient men to have a supernatural force.
What Will Life Be Like Inside A Computer?
John MesserlyMany scientists believe that we will soon be able to preserve our consciousness indefinitely. This could be done by copying and transferring these contents into a computer, or by piecemeal replacement with parts of the brain gradually replaced by hardware.
Wow, Cool! A 3D model of the Save Icon!
Koert van MensvoortWhen a floppy disk becomes a 3D printed save icon.
A Robot Scientist Could Cure Malaria
Yunus Emre DuyarAlthough there seems to be no effective drug in use to cure malaria, a scientist robot named Eve may have found a cure.
A Self-Aware Mario Able to Learn and Feel
Yunus Emre DuyarSuper Mario is now able to learn and feel in the confines of his 8-bit universe.
A Wind Turbine That Looks Like a Tree
Yunus Emre DuyarThe wind turbines of the future will look like post-modern tree sculptures.
AI is as Intelligent as a Four-Year-Old Kid
Erik van der VeenComputer can already beat us in many tasks. Complicated calculation, processing speed and chess, to name a few. However, generally speaking, you’re still likely to be more …
An Adblocker for Your Eyes
Rolf CoppensMost VR concepts and products are coming from big tech companies. With their ad-driven business models they are likely to fill your Glass, Hololens or Oculus with ads at some …
Analogue vs Digital: Basic Parts of Matter
NextNature.netDo you think you are made from bits and bytes? Stop playing video games and spend some more time offline! Both atoms and bits are basic parts of matter.
Analogue vs Digital: Boomeranged Metaphors
Is it analog, or is it digital? It’s a boomeranged metaphor!
Analogue vs Digital Memory Game
NextNature.netThe Analogue vs Digital Memory Game explores the different ways of seeing, thinking and experiencing across the digital divide.
Analogue vs Digital: Never Lost with GPS
NextNature.netBefore global positioning systems, we all used maps. And they could be very annoying.
Analogue vs Digital: Phoning
NextNature.netRemember these? If you are a digital native there is a chance you never noticed one of them.
Anthropo-scene #10: From Thoughts to Geology
ChristianIt's more than two years since I have started this exploration of the Anthropocene for Next Nature for you. We have visited many places together, places I have traveled to as a …
Art Experiment Allows to Kill with a Click
Hessel HoogerhuisFlorian Mehnert, A German artist, has launched an experiment that will give internet users the power to shoot a rat with a single click on their keyboard or smartphone. A …
Artificial Intelligence Able to Create Music
Tijs DuelEmily Howell is an interactive interface able to compose and perform her own pieces of music.
Artworks that Look Virtual, but Are Completely Hand Painted
Alexandra BremersThese paintings by Johnny Abrahams look almost computer made - except they are not. Working mainly with black and white acrylic paints and with a lot of patience, the American …
Biomimicry in Action
Abby QinAn inspiring topic about recent developments in biomimicry, Janine Benyus gave a talk on how nature influenced our future.
Bistro In Vitro to Be Launched
NextNature.netInspired by the award winning In Vitro Meat Cookbook , Next Nature Network and Submarine Channel present Bistro In Vitro : an online design fiction documentary about the future …
Botox Makes it Harder to Feel Emotions
Alessia AndreottiStudies suggest that Botox impairs the ability to process the emotional content of language, limiting the quality of emotional experiences.
Do Kids Know Where Dinner Comes From?
Wei Lun WangSwimming salmon fillets confuse educate children about where dinner comes from.
Cities Evolve in Similar Ways as Galaxies
Koert van MensvoortScientists think the laws governing the structure of galaxies in outer space are the same laws underlying the growth of cities.
Controlling the Weather with Drones
Hessel HoogerhuisThe Federal Aviation Administration (FAA) picked six test sites throughout the US to experiment with drone-based cloud seeding.
Did a Robot Grow your Vegetable?
Alessia AndreottiThe world’s largest indoor farm is not the only firm developing vertical agriculture. Japanese company Spread plans to grow more than ten million heads of lettuce a year by …
Digital Mountains Shouting Your Tweets
Yunus Emre DuyarEver feel the need to hear two digital mountains read your tweets aloud with deep and sonorous voices?
Modernist Food
Hendrik-Jan GrievinkThis modernist food makes the future of 3D printed food look pretty tasty!
Eventually, Drones Will Be Everywhere
Hessel HoogerhuisCity of Drones puts you in a first person view of a drone drifting through an abstract futuristic cityscape.
Everything Stew from the Home Incubator
The home incubator you can prepare a stew made with thirteen different sorts of meat, is heaven for carnivores.
Experience Van Gogh in Virtual Reality
Abby QinAmerica artist Mac Cauley created a new way to experience the painting in virtual reality.
Experiencing Animal Vision Through Virtual Reality
Margherita OlivoEyes of the Animal is an interactive project that invites the public to an uncommon virtual reality setting conceived especially for experiences in actual forests, giving the opportunity to see the world as an insect would.
Experimental Office: No Chairs, No Desks
Koert van MensvoortTo counter the sitting dogma, design firm RAAAF and artist Barbara Visser created a dynamic office concept, entirely based on movement and leaning.
Fast Food = Lower Test Scores
Alessia AndreottiThe amount of fast food children eat may be linked to how well they do in school, a study suggests.
FB Graffiti: Reviving Ancient impulses
Alessia AndreottiFB Graffity: the extension that lets anyone “vandalize” the pictures shared by other users on Facebook
First Entirely Transparent Solar Panel Could Transform our Cities
Margherita OlivoOur constant need of new, cleaner energy led a Michigan State University research group to conceive a fully transparent solar panel that could replace ordinary windows.
First Puppies Born by In Vitro Fertilization
Margherita OlivoThanks to the work of researchers at Cornell University (USA), for the first time a litter of puppies was born entirely from in vitro fertilization.
From the Super Muscular Pig to the Hypoallergenic Cow: New GMOs May Soon Be on Your Plate
Alessia AndreottiThe acronym that keeps Europe awake at night is TTIP (Transatlantic Trade and Investment Partnership), a trade and investment deal that the EU is negotiating with the US. From …
Gene-Edited Micropigs Will Be Soon Sold As Pets
Wei Lun WangEarlier this year, a group of Chinese scientists published a paper about the modification of the genome of human embryos with the cutting-edge powerful technique called CRISPRs. …
Genome Editing - Bringing the Übermensch to a Shelf Near You
Daniel FragaLast April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …
Grow your Dinner in a Kitchen Insect Farm
Koert van MensvoortThe Kitchen Insect Farm enables people to grow their own protein source (read: larvae) at home.
Hacking And Controlling Cars Remotely
Robin BergmanTwo American hackers have been working on hacking cars to takeover full control of vehicles.
This Headset Will Widen Your View of Reality
Margherita OlivoThis augmented reality helmet allows the wearers to see all around them without having to turn their head.
Hunger Games for Robots
Yunus Emre DuyarHow would you feel if robots inherited ethical complications of existence?
In Vitro Meat Godfather Dies at Age of 91
Koert van MensvoortDutch researcher and entrepreneur, Willem van Eelen, has died in Amsterdam. For more than half a century, Van Eelen relentlessly researched and promoted In Vitro Meat.
Knotty Objects Summit @ MIT
The Knotty Object summit promises to be a paradise of anti-disciplinary delight. The event held at the renowned MIT Media Lab gathers designers, scientists, engineers and writers …
Forget Google Street View, Here's Cat Street View
Wei Lun WangJapan city has launched an online street view map to introduce the view of the city by a cat's perspective.
Mark Zuckerberg Discovers 'Books'
Koert van MensvoortBooks allow you to fully explore a topic and immerse yourself in a deeper way than most media today.
NANO Supermarket 100 m2 Pop-Up Store
NextNature.netOur lustrous NANO Supermarket opened a 100m2 pop-up store in Stavanger, Norway.
NANO Supermarket Opens in Norway
NextNature.netOur lustrous NANO Supermarket just opened a 100m2 pop-up store in Norway.
New 3D Printer Can Save Hours of Time
Yunus Emre DuyarA team of researchers recently developed a new method for 3D printing that can reduce the printing process down to minutes.
First Testings of Google's Project Loon Announced
Margherita OlivoGoogle plans to connect more than 100 million people in a cheap, new and sustainable way, in a territory where only one person on three has access to the Internet.
Next Nature at Futur en Seine Festival
NextNature.netNext Nature at "Mindfulness and Digital Detox: How to Tune Out to Tune In" Conference in Paris.
Next Nature Book Second Edition
NextNature.netAfter it sold out, the Next Nature book has been reprinted with a brand new cover.
Next Nature Talk at Nature 3.x Symposium
NextNature.netKoert van Mensvoort will take part in the Nature 3.x: Where is Nature Now? symposium at the University of Minnesota.
Next Nature Talk at SXSW
NextNature.netGoing to the lustrous SXSW festival in Texas this year? Don't miss out on the Next Nature presentation!
Poem Passes the Turing Test
Yunus Emre DuyarZackary Scholl developed a program to produce a poem that passed the Turing Test.
Art Installation Submerges Amsterdam
Hessel HoogerhuisWaterlicht shows how the Netherlands would look without waterworks — a virtual flood.
Robot Swans Monitor Water Quality
Alessia AndreottiThe National University of Singapore released a group of robot swans in the Pandan Reservoir to swim around and keep an eye on water quality.
Space Archeologist Unlocks Secrets of Ancient Civilizations
Margherita OlivoSarah Parcak is a pioneering "satellite archaeologist" from University of Alabama, a sort of Indiana Jones with 21st century tech. She has been awarded the 2016 TED Prize for her …
Save The Humans – Submit your Quote
NextNature.netWe call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.
Seaweed That Tastes Like Bacon
Alessia AndreottiA new seaweed that tastes like bacon and is better for you than kale.
Seconds for Sale: Domestication of Time
Sander DijkhuisTime Ingot is a solid piece of lead alloy, its mass can slow down time in the immediate vicinity.
Seeing the Sun Through Data
Adriene LillyThe Smithsonian’s National Air and Space museum has taken the sun observation to the next level with a giant public display of images and data that show the sun in hyper-real detail.
Self-Healing Concrete
Daniel FragaA microbiologist has developed a way to make the cracks in concrete structures heal themselves.
Solar Tree That Provides Electricity
Louise HuyghebaertA tree, made with 3D printed leaves that contain solar cells.
St. Pauli's Walls Pee Back On You
Yunus Emre DuyarTired of drunk people peeing everywhere on the street, people of St. Pauli, Hamburg decided to take a smart step to prevent it.
Stewart Helps People to Trust Self-Driving Car
Erik van der VeenStewart is a tactile interface that mediates the communication between human and self-driving car.
Teppanyaki from the In Vitro Aquarium
NextNature.netThese synthetic organisms from our In Vitro Aquarium are a hybrid between plants and animals. Would you eat them?
The art of growing grasshoppers
Ruben BaartGrasshoppers are a sustainable and cost-effective alternative to meat protein. Could the ability to grow them in your kitchen make them more appealing? Watch the video below and …
The Phone That's Just a Phone
Alessia AndreottiMeet the anti-smartphone. It literally does nothing but make and answer calls.
The Sketchbook Made Of Artificial Skin
Alessia AndreottiThe SkinBook is made of synthetic skin that allows beginner tattooists to practice their skills.
The Sound System that Knows your Mood
Martijn BohnenBeoSound Moment is an intelligence sound system that predicts the music the user is in the mood for.
The World's First Virtual Reality Park
Alessia AndreottiA virtual reality theme park where visitors can explore the virtual world in a physical environment.
Turning Cockroaches into Rescue Robots
Yunus Emre DuyarCyborg cockroaches might be used for search-and-rescue operations in the future.
Talkable Vegetables
Wei Lun WangBreaking the silence, vegetables in a Japanese supermarket start to talk to the customers.
Virtual Reality Dining Experience
Alessia AndreottiUsing immersive virtual reality and aromatics to make the brain believe we are enjoying a delicious dish.
Watch out for Bullied Robots
Alexandra BremersDystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …
When Was the Last Time you Were Bored?
Alessia AndreottiThe Bored and Brilliant project asks people to measure their smartphone use take some conscious steps to limit the digital interactions.
Adblock Plus Now Sells Acceptable Ads
Ruben BaartAdblock Plus, world’s most popular ad-blocking tool, just announced they are launching an advertising service for “acceptable” ads.
Agriculture Isn’t as Green as You Think
Megan Ray NicholsAgriculture today isn’t where it needs to be. Here’s how farmers are taking the next step for better agriculture tomorrow
AI Outsmarts Face Masking Methods
Monika KozubThe latest researches showed how AI can recognize human faces even if pixelated and meant to be incognito.
Australia Moves Too Fast for GPS
Mathilde NakkenThe entire continent of Australia has shifted and that's a problem for GPS, meteorologists, automated cars and even drones.
The Biggest Impact on the Planet Comes from Household Consumption
Margherita OlivoNew study suggests that the real environmental problem is embodied in the things we buy.
Bringing the Camera Back to Our Eyes
Monika KozubThe new Spectacles by Snap Inc. allow you to actually "make memories" (as their slogan claims) while capturing them.
Bringing In Vitro Meat to the Market
Margherita OlivoMark Post is planning to bring lab-grown meat on the market shelves within five years at a reasonable price.
Cockroach Milk: the Next Superfood?
Monika KozubA recent research reveals that the next extra nutritious ingredient may be the liquid produced by cockrach mothers to feed their offsprings. Are you willing to try it?
Designed to Survive Our Roads
Ruben BaartA road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.
Dessert Goals: Bistro In Vitro Ice Cream
NextNature.netIn the upcoming episode of Dutch youth education series Denktank (translated think tank) philosopher Stine Jensen and eight teenagers will explore the future of food and try our Bistro In Vitro ice cream.
Disney Lights Up the Sky with 300 Drones
Mathilde NakkenDisney’s latest attraction? 300 drones flying in formation.
EcoHelmet: Foldable, Recyclable and Cheap
Monika KozubThe new recyclable, foldable and affordable bike helmet can change city bike sharing for good.
Edible Crops Grown in Martian Soil
Margherita OlivoScientists at Wageningen University, The Netherlands, grew edible crops in Martian soil.
Father Hires Gamers to Virtually Kill His Son
Margherita OlivoThis father in China hired some professional gamers to find his son on online games and kill his avatar.
When FB Told Everyone They Were Dead
Ruben BaartDue to an algorithmic error, Facebook mistakenly "memorialized" vital user accounts with a banner announcing the user’s passing – turning their friend walls into memorial walls.
The First Artificial Intelligent Lawyer
Mathilde NakkenThere is an artificial intelligent robot called ROSS that is taking over the work of thousands of lawyers. Working non-stop, reading faster then any human attorney can do.
The First Fully Autonomous Soft Robot
Ruben BaartThe Octobot is the first of its kind made fully of soft materials and is aimed to pave the way towards a more safely interaction with humans.
Fitness Trackers Help Improve Cycle Paths
Margherita OlivoTracking your workout can help improve the safety and optimize routes for cyclists and pedestrians in your town.
Lost in the Forest? The Drones Will Find You
Daniel FragaResearchers are teaching drones to recognize and follow forest trails.
Future of Food: Eating From the Ditch
Mathilde NakkenFor years scientist and farmers are researching the possibilities of eating duckweed, shoveling it out of the ditches onto our plates. This proteinrich plants can be used in animal fodders or be eaten by humans.
Genetic Scissors Instead of Chef's Knife
Monika KozubCRISPRy cabbage has been served for the first time in the world.
Good Air Quality? You Get Free WiFi
Margherita OlivoThese birdhouses in Amsterdam share free Internet whenever the air quality improves.
Traffic Lights for Smartphone Zombies
Ruben BaartGround Level Traffic Lights For Smartphone Zombies
Growing Potatoes at JFK Airport
Ruben BaartThe 5th largest airline in the United States, JetBlue, is growing potatoes at John F. Kennedy Airport in New York.
Happy New Green 2017!
Alejandro AlvarezA bright green is the color of 2017, a perfect choice if we take into account some of the positive developments in renewables reached in 2016.
Harvesting Water from Thin Air
Margherita OlivoScientists in Harvard University have designed a new material inspired by organisms, such as cacti, that can effectively harvest water from thin air.
In Defense of the Eggplant
Ruben BaartThe eggplant emoji became a political weapon and gain cult status being the forbidden fruit of the web.
Robot Babies to Prevent Pregnancy
Ruben BaartAn Australian study has shown the use of lifelike robot babies increased teen pregnancy, rather than discouraging it.
Internet Open Daily from 7:00 to 22:30
Koert van MensvoortSymbol of the stalled development in the socialist state, or design for silence, quietude and meditation?
King Bee Inspecting His Drones?
Koert van MensvoortFacebook boss Mark Zuckerberg at the Mobile World Congress, in Barcelona.
Look for The Bistro In Vitro Ice Cream Cart
Margherita OlivoOur Bistro in Vitro Ice Cream Cart took off for the Spring/Summer season in Vondelpark, Amsterdam.
Computers Need Domestication
Alejandro AlvarezSoon we won’t program computers anymore, we’ll train them like dogs.
Making King's Day More Sustainable
Margherita OlivoOn King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.
Man Controls Prosthetic Arm with His Mind
Ingmar NieuweboerResearchers at the John Hopkins University School of Medicine succeeded in hooking up a prosthetic arm to the human brain.
A Map of Mars for Regular Humans
Margherita OlivoIf we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …
Explore Mars with NASA's VR Experience
Margherita OlivoExploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.
Meet Biomimic Alyssa Stark
Daniel FragaUsing biology as a model for innovation and progress, Alyssa Stark embodies the essence of Biomimicry.
Meet the Firefighter Drone
NextNature.netMeet the firefighter drone, she is the best at extinguishing fires and keep every species safe!
Morality of an Autonomous Car
Monika KozubWhen an autonomous car has to make a decision, will self-interest or the public good predominate?
More Babies for Italy
Ruben BaartThe Italian government just launched a campaign to raise awareness for falling birthrates and encourage family planning.
Moscow Spent $1.3M for a Day of Sunshine
Alessia Andreotti$1.3 million will be spent on dispersing clouds over Moscow for the May 1 holiday.
Nature-Inspired Nano-Robots
Ingmar NieuweboerResearchers developed tiny, autonomous robots able to repair circuits.
NANO Supermarket in Brussels
NextNature.netCome and check out the NANO Supermarket at SAS Software's Forum BeLux 2016 on October 13 in The Egg Brussels!
The New Cinema Is Smartphone-Friendly
Margherita OlivoCinemas for Millennials will include special sections where texting is allowed.
The New Era of Tourism is Underwater
Margherita OlivoSleeping underwater has always been your dream? Thanks to an ambitious project it will be soon reality.
VR Days Europe: Next Nature Habitat
Monika KozubNext Nature Habitat premiered at VR Days Europe in Amsterdam last weekend.
The Next Nature Sneaker Series
Mathilde NakkenWe present for the real sneaker heads amongst us, six new futuristic pieces of footwear. Going from pineapple leather to self lacing 'Back to the Future' Nikes.
Smart Spoon with Spilling Prevention
Mathilde NakkenPeople with parkinson or other diseases that cause tremors or uncontrable muscular movements, eating is a major challenge. Liftware launches two smart spoons which corrects the unexpected movements of its eaters.
Who Owns the Map?
Ruben BaartIn their pursuit of mapping the physical world online, mapping services simultaneously shape our understanding of it too.
Cutlery Set to Eat Bugs
Ruben BaartDesigner Wataru Kobayashi created a picnic cutlery set to promote eating insects.
A Political Weather Forecast
Ruben BaartJames Bridle is comparing vast amounts of historical weather data and polling results in order to produce hybrid weather forecasts.
New Diets for Cows Can Stop Gas Emissions
Mathilde NakkenYearly 90 million metric tonnes of methane are burped and farted into the atmosphere by cattle with effects on climate change. Researchers are looking for ways to change the cow's diet, feeding it oregano, seaweed and super grass.
Computer-Simulated Realistic Sounds
Daniel FragaResearchers at MIT have created a system that is able to simulate sounds that are so perfect that they can even fool human listeners.
This Robot Builds a House in Two Days
Ruben BaartA Bricklaying Robot builds low-cost houses in just two days.
This Robot will Grow Food in Your Backyard
Koert van MensvoortFarmBot Genesis is humanity's first open-source CNC farming machine designed for at-home automated food production.
This Robotic Stingray is Alive
Ruben BaartBy way of reverse engineering and taking heart cells from a rat, researchers at Harvard University have designed a miniature robotic stingray that is alive.
Are Robots the Future of Tattoos?
Ruben BaartAn industrial robot just tattooed the first person ever in San Francisco.
Robots Taking Government Jobs
Ruben BaartMeet Amelia, the first robot to work along with human coworkers in a council job.
Self-Driving Cars Are Here to Stay
Megan Ray NicholsThe first time you switch on your self-driving car, punch in your coordinates and cruise off to the soulless thrum of an electric motor you’ve got to wonder: does this thing know what it’s doing?
The Movie Written by Artificial Intelligence
Margherita OlivoSunspring is a Sci-Fi short movie entrirely written by an artificial intelligence.
Simulated Kissing Over the Internet
Nadine RoestenburgAfter calling, texting, chatting, video chatting, teledildonics (interactive and touch emulating sex toys) and sync-watching TV series while miles apart, you can kiss your beloved one over the Internet from wherever you are with Kissenger.
Solar Energy Day and Night
Margherita OlivoSpecial balloons able to catch the rays of the sun from above the clouds, producing clean energy day and night thanks to the help of a fuel cell.
Solar-Powered Donkeys to Stay Online
Margherita OlivoTurkish shepherds are installing solar panels on their donkeys to stay connected.
Solving Crimes Thanks to Amazon Echo
Ruben BaartAmazon's Echo smart speaker may have witnessed a murder. But will it talk?
This Indestructible Micro-Animal Will Help Us
Monika KozubWill a small step for Ramazzottius Varieornatus be a giant leap for mankind?
A Taste of RoboBee Honey
Mathilde NakkenWhere most researchers are focusing on keeping bees alive, researchers of Harvard are developing a bee replacement; the Robobee. The Robobee is only the size of half a paperclip, with ultra thin wings flapping 120 times per second. The main goal is to build a mechanic pollinator.
Your Teaching Assistant Is a Robot
Margherita OlivoJill Watson has been performing as teaching assistant for 5 months, but she is not a real person, and students didn't notice.
The Autonomous Tractor Is Here
Ruben BaartCase IH debuted their autonomous farm tractor that plants, monitors crops and harvests, all without a driver.
The Interactive Supermarket
Ruben BaartCoop Italia has opened a flagship store in Milan to present their vision of what grocery shopping might hold for us in 2050.
Painted by Drones
Ruben BaartGerman aerial-photography group Cooper Copter is exploring “vandalism 2.0” with drones that throw paint bombs.
Meeting the Future at TodaysArt
Monika KozubLast week The Hague hosted a festival dedicated to contemporary experiments in music, art and digital culture.
Turn Your Cursor into a Songbird
Alejandro AlvarezThe Bird Sounds experiment, powered by Google Creative lab, is a visualization of thousands of bird songs organized by their similarities.
Turning Coke into Water
Koert van MensvoortThis art installation turning coke into water raise questions on what, at the end of the day, should be considered 'the real thing'.
Turning Leaves into Batteries
Margherita OlivoOther than decompose and give nutrition to the soil, leaves can be used to store energy, becoming the raw material of batteries.
A Robotic Suit to Update Your Granny
Mathilde NakkenThe elderly may toss their walkers for this robotic suit.
Using Solar Powered Drones as Satellites
Ruben BaartThe experimental solar powered airplane Solar Impulse 2 succeeded its record-breaking journey over the Pacific. The Swiss team is now developing the next step of the project: solar drones.
Men Pregnancy: Reality or Science-fiction?
Margherita OlivoThe first uterus transplant in the United States raises the question: could uterus transplants allow men to get pregnant too?
Fake Grass Covered Roofs to Produce Energy
Margherita OlivoThe concept of using our rooftops to produce green, renewable energy for our houses is already very common if we look at solar panels. Now an international team of scientists is …
Scientists Connected a Brain to a Tablet
Ingmar NieuweboerSeverely paralyzed woman controls a tablet with her brain.
World's First 3D Printed Building
Margherita OlivoThe world's first 3D printed office building opens its doors in Dubai, paving the way for the building of the future.
1537 - Homunculus: the Semi-Human
Elle Zhan WeiIn 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.
1916 - Artificial Womb Appeared in Cinema
Elle Zhan WeiIn 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.
1923 - Term 'Ectogenesis' Coined
Elle Zhan WeiThe term "ecotogenesis" was first coined in 1923 in "Daedalus".
2014 - Womb Transplant Baby Born
Elle Zhan WeiA Swedish woman who had her uterus removed due to cancer in her twenties gave birth to her own child as the world's first person to undergo a uterus transplant. And the donor? Her own mother.
2015: Artificial Placenta Approaches
Elle Zhan WeiIn 2015, a group of scientists from the University of Michigan claimed to have made the world's first artificial placenta.
3D Print Your Pizza in Six Minutes
Ruben BaartMeet the commercial 3D pizza printer that takes your order via a smartphone app.
From Bad Selfie to Perfect Portrait
Ruben BaartSay goodbye to bad selfies with Adobe’s latest AI photo editor.
Air Pollution Mask for Kids
Ruben BaartDanish design studio Kilo created an air pollution mask suitable for kids aged six and up.
Animal Free Cow Milk
Elle Zhan WeiA San Francisco-based start up discovered a way to "brew" milk that has zero hormones, antibiotics, steroid or lactose inside, and a longer shelf-life.
Animal Guided Mediation
Elle Zhan WeiAnimal Meditation uses meditation guiding sounds to to enable user to feel as if he is an animal.
Obsolete Presence
Koert van MensvoortOur peculiar object in these summer weeks is a sculpture by Aram Bartholl, made for the Odyssey expo in Arnsberg.
Visualize the Hidden World of Digital Networks
Nadine RoestenburgHave you ever wondered what the infosphere looks like? Dutch designer Richard Vijgen’s app Architecture of Radio is a field guide to the hidden world of digital networks.
400 BCE - Myth of Princes Grown in Jars
Elle Zhan WeiIn year 400BCE in ancient Indian Sanskrit epics, 100 princes were created from a jar of ghee.
Bacteria Use Electronic Messaging
Julie ReindlBacteria use electronic messaging system to recruit new workers.
DNA Hacking: Catch a Computer Virus
Jack CaulfieldWe know how it feels to catch a cold; how might it feel to catch malware?
Cognitive Cooking with Chef Watson
Elle Zhan WeiThe AI chef nows more than 10,000 recipes from all over the world and is capable of combining any ingredient while following your personal food preferences.
Dinner with Chef Watson
Ruben BaartChef Watson knows over 10.000 recipes. The highbrow robotic cook invited us over for dinner during the first Neo-Futurist Dinner at Mediamatic.
A Whole Forest on a Surface Area of 3.5m2
Julie ReindlUsing moss cultures, the "CityTree" captures and filters toxic pollutants from the air, with the same environmental impact of 275 trees.
Digital Lemons to Make Virtual Lemonade
Ruben BaartWhen life gives you digital lemons, make a virtual lemonade!
Drones and Robots Co-Work in Solar Farms
Alessia AndreottiBladeRanger might have found the ultimate solution for solar panels cleaning putting drones and robots together at work.
ECO Coin Award 2017 Nominations Open
NextNature.netThe nominations for the ECO coin Award 2017 are now officially open. Let us know who you think deserves to earn the award.
ECO Coin Award Interviews: Shubhendu Sharma
Jack CaulfieldWe asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.
ECO Coin at Welcome to the Village
NextNature.netOn July 21, 22 and 23 you are invited to join us at Welcome to the Village festival in the Friesland province of The Netherlands for our next iteration of the ECO coin!
1955 - Artificial Womb Drawing Patented
Elle Zhan WeiIn 1955 Emanuel M. Greenberg patented his Illustration of an artificial womb, his invention contains all the apparatus he thought would be required to grow a baby.
Energy Generated from Polluted Air
Elle Zhan WeiScientists developed a device that converts polluted air into clean air while generating power.
A Fake City for Real Self-Driving Cars
Siebren de VosUber built a fake city called Almono to train self-driving cars. This town is full of fake houses, mannequins and chaotic intersections.
Farming in Silico
Jack CaulfieldFarming is more than manual labor. The hard part is knowing how to get the best yield. Thankfully, there’s an app for that: growing crops in silico.
Sustainable Flying with Electric Planes
Elle Zhan WeiGerman company revealed fastest electric plane.
Flying Car Modular Transport System
Elle Zhan WeiAirbus and Italdesign unveil modular urban land and air transport system.
Greenhouse for Space Colonies
Elle Zhan WeiResearchers from Arizona and NASA unveiled a plan to sustainably provide food in space, growing it in an inflatable greenhouse.
Grow Your Own Bio Bot
Julie ReindlResearches at the University of Illinois released a step by step guide to build 3D printed bio robots with living muscles.
Growing Norwegian Nori in the Lab
Ruben BaartNorwegian researchers have succeeded to grow nori under laboratory conditions for the first time.
Heart Repair with Spinach Leaves
Julie ReindlScientists developed a procedure to repair your heart with a spinach leaf.
Hire a Smart Robot
Daniel FragaWhat if your co-worker was a robot? Dutch startup Smart Robotics is a job agency for robots that allows you to hire a smart-robot.
NNN Presents HUBOT - The Job Agency for People and Robots
NextNature.netA horse can run faster than a human, yet nobody claims horses will make mankind dispensable. When a man rides a horse and the two work together, something new happens. Then, what …
HUBOT: Meet the Exoskeleton Mover
NextNature.netA job from HUBOT: as an exoskeleton mover, you wear a motorized exoskeleton suit that gives you the muscular power of a gorilla.
HUBOT: Meet the Home Healthcare Professional
NextNature.netThe home healthcare professional is one of the 16 positions from HUBOT, the job agency for people and robots.
HUBOT: Take the Jobtest!
NextNature.netThe robots are coming! They’re getting smarter, cheaper and more reliable. How long will I have my job before a robot steals it? The industrial revolution made muscular power …
HUBOT: Meet the Air Traffic Security Worker
NextNature.netAs air traffic security you make sure that birds stay away from the airport using your eagle drone. With an accessory console, you fly the quadcopter from the sideline to scare …
HUBOT: Meet the Blind Traffic Regulator
NextNature.netA visual impairment does not have to be confining and futile when it comes to traffic control. As a blind traffic regulator, you wear a haptic suit that translates the traffic …
HUBOT: Meet the Data Waiter
NextNature.netAs a data waiter you are working at the Tinder restaurant. Upon arrival, visitors log in with their social media account. An intelligent algorithm matches the guests based on …
HUBOT: Meet the Farm Director
NextNature.netGames are often played to escape a boring daily reality, but they can also teach us to take control over the land as farmers do. As a farm director you work in a gamified …
HUBOT: Meet the Supersmart Handyman
NextNature.netDon’t worry, a handyman doesn’t have to be a bookworm. You rather work with your hands than sitting in the library. And yet, you often need to read the manuals of the broken …
Insect Ramen: the New Food Trend
Julie ReindlTokyo restaurant offers sustainable new dish - ramen noodles topped with crunchy insects and people love it
An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018
Ruben BaartMeet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.
Watch Koert's TED Talk on Meat the Future
NextNature.netWe need to talk about the future of meat! Watch Next Nature Network director Koert van Mensvoort's TED talk on Meat the Future.
Making Tomatoes Tasty Again
Alejandro AlvarezScientists have found a way to bring back the lost flavor of tomatoes.
HUBOT: Meet the Robot Coach
NextNature.netCraftsmanship is generally very appreciated, but it takes a lot of time to master a craft. Therefore, as a robot coach you train - you guessed it, a robot - to transfer your …
A Robot Will Spark the Next Avant-Garde
Nadine Roestenburg “An illegal theme park exposing the ideology of the aesthetics of hacking”. “A hybrid drone targeting technological domination”. “A psychedelic fridge to raise doubt about fake …
Nomophobia: the Fear of Phonelessness
Jack CaulfieldNomophobia, no-mobile-phobia, is the fear of being separated from your smartphone.
Old Cows and New Ideas
Lewis JustWill cows still graze fields in an in vitro future? And what might we do with these animals when they naturally die?
AI Foodcial Recognition
Julie ReindlPic2Recipe is an artificial intelligence system able to recognize ingredients, identify a dish and suggest recipes from a single image.
Plants + Science = Meat!
Daniel FragaWhat if you could have the taste of a juicy, sizzling burger without the destructive impact of using animals for meat? That is what Impossible Foods wants to do with its new burger.
Preventive Punishment for Robots
Elle Zhan WeiThe Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".
Print Your House in a Day!
Julie ReindlA Russian construction firm prints houses in 24 hours on site with their mobile 3D printer.
Recharge! Sun for Your Brain Cells
Julie ReindlA gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.
Rent a Rain Room
Elle Zhan WeiRent a rain room with simulated rain with a motion sensor to go through the rain without getting wet.
The Solution to Nuisance Birds? The Robird
Jack CaulfieldBirds are fascinating creatures, but for farmers, airport staff, and waste management specialists, they can prove to be a profound nuisance. How to deal with a flock of birds …
Dubai Employs First Robotic Police Officer
Julie ReindlThe first robotic officer will soon report for duty in Dubai.
Jobs for Creators - Robots at Work #2
Mathilde NakkenHave a look at our series Robots at Work! In this episode we present you five jobs for creators, the ones that build with their hands.
Jobs for the Extraordinary-Robots at Work #5
Mathilde NakkenThis is post number five of our serie 'Robots at Work'. In this last episode we present you five jobs for the extraordinary, the ones who won't let themselves be categorized.
Scientists Create Ghost Heart
Julie ReindlThe Texas Heart Institute researches in the field of organ transplantation. With the “ghost heart” — an heart organ scrubbed clean of all its former cells, the researches are on the verge of creating a sustainable and effective way of transplanting organs.
The Self-Flying Taxi Drone
Ruben BaartPassenger-carrying drones will hit the skies in Dubai this summer.
Sexy Cyborg Sports Her Prosthetic Limb
Koert van MensvoortThe Brazilian model Paola Antonini uses her Instagram to show off her prosthetic limb.
HUBOT: Meet the Singing Package Deliverer
NextNature.netYou did not make it to the Idols final, but you can sing very well and you love to make people happy. As a singing package deliverer, you deliver packages with a personal song. …
Skyscraper Hanging from the Sky
Elle Zhan WeiWhat if we rethink the system and instead of building from earth to sky, we do it the other way around?
Slaughterbots Video Depicts Killer Bots Nightmare
Koert van MensvoortThis seven-minute video, titled 'Slaughterbots', shows a future in which palm-sized autonomous drones commit untraceable massacres.
Solar Powered Electric Cars
Daniel FragaThe sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.
Speech Development Lost in Screens
Elle Zhan WeiA study shows that screen time for kids between six months and two years triggers expressive speech delay.
Swap Your Smartphone for a Pineapple
Nadine RoestenburgDutch commercial telecom provider Ben recently launched an advertising campaign to sell smartphone plans by promoting disconnection.
Tattooing Fruits and Veggies with Lasers
Ruben BaartEco-friendly lasers might soon replace stick-on labels on fruits and veggies.
The Economy of Ecology
Lewis JustWhat if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?
The In Vitro Meat Cookbook Is Officially Art
NextNature.netThe Stedelijk Museum has added The In Vitro Meat Cookbook to its public art collection, turning the book into a piece of art!
The Robots Are Coming!
Koert van MensvoortRobots are getting stronger and smarter every day. They are taking over our whole lives. How long will I have my job before a robot steals it?
Tinder for Orangutans
Ruben BaartThe Apenheul primate park in Apeldoorn, the Netherlands, has launched a four-year experiment to study how the primates make their mating choices.
Toilet Paper for Your Smartphone
Ruben BaartToilet paper for smartphones now on offer at Japanese airport.
Transformative Appetite: Shape-Shifting Pasta
NextNature.netMIT Media Lab developed pasta programmed on a computer.
A Truly Exotic Fruit: the Space Mango
Julie ReindlScientists sent mango embryos to space lab in order to let them develop new genetic traits.
Turning Air Pollution Into Ink
Elle Zhan WeiIntroducing world's first ink completely made from air pollution.
Rescue Drone Will Save You in Open Water
Elle Zhan WeiDrone made to rescue in bad weather condition in open waters.
Using Spinach to Detect Explosives
Ruben BaartIntroducing nanobionic spinach plants that can detect explosives.
Virtual Baby Acts and Looks Impossibly Real
Charlotte KuijpersA rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.
Visit the Garden of Eden
NextNature.netDiscover the Next Nature Habitat VR and explore four future environments we might live in someday.
Meat the Future Exhibition: Appetizer
NextNature.netHave you already visited our Meat the Future exhibition? Consider this three course meal an introduction to what you may expect.
Plastic-Eating Worm Can Help Ease Pollution
Elle Zhan WeiA recently discovered plastic eating worm could be used to safely digest our massive plastic waste.
The World's First Floating City
Elle Zhan WeiIn effort of protecting and prospering their country, the Polynesian government has signed an agreement to realize the world’s first floating city.
World’s First Lab-Grown Chicken Is Here
Elle Zhan WeiMemphis Meats reveals world’s first lab-grown chicken.
How AI could revolutionize the teaching profession
Jack CaulfieldIn various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …
Anthropomorphism Puts a Friendly Face on Autonomous Vehicles
Jack CaulfieldDo you ever look at the bonnet of a car and see a face? Now, designers are looking at how to give self-driving cars the friendliest "faces" they can through anthropomorphism.
Next Nature Network x Border Sessions:
Calling for festival bloggers!
NextNature.net
Calling all bloggers! We’d love to have you on board for the 2018 Border Sessions festival in The Hague (NL). Join our team for behind-the-scenes access to festival events. To …
Call for projects: bring your groundbreaking creativity to tackle pressing energy issues
NextNature.netWe need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …
The Dictionary of Online Behavior adds a virtual layer to your vocabulary
Ruben BaartTo some extent, it's a chicken-and-egg question: Are you unable to think about things you don't have words for, or do you lack words for them because you don't think about them? …
How self-driving cars will change our sex lives
bryan clarkIt’s clear that driverless cars will revolutionize the way we get from Point A to Point B. Perhaps less obvious is how it’ll change our sex lives. According to a new study by the …
Turning surplus bread into craft beer
Meike SchipperGlobally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
The real-life gruesome experiments that inspired Frankenstein
Iwan MorusOn January 17 1803, a young man named George Forster was hanged for murder at Newgate prison in London. After his execution, as often happened, his body was carried ceremoniously …
![Visual of #French [Green] DreamTowers](https://nextnature.net/media/pages/magazine/story/2018/french-dream-towers/d09be6a9fe-1602632756/han-1xtu-868x486.jpg)
#French [Green] DreamTowers
Alec SchellinxFrenchDreamTowers is an eco-friendly high-rise complex imagined by Paris-based architect studio XTU , for the city of Hangzhou in Southern China. Currently under study, the …
HUBOT: Meet the Cybercrime Detective
NextNature.netAs a cybercrime detective, you search for suspicious patterns that indicate crime in the digital domain.
HUBOT: Meet the Walker Inspector
NextNature.netWhile many people consider a rollator as a sign of decay, you as a rollator inspector are just part of the headway! The walker inspector measures air quality, particulate matter …
HUBOT: Meet the Street Knitter
NextNature.netBricklayer, a physically heavy occupation, becomes a lot more bearable with the street-knitting robot. The street knitter is a job from HUBOT.
Human Nature, designing the equilibrium with Koert van Mensvoort
NextNature.netUnder the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …
How in vitro meat became a subject of debate in the Dutch parliament
Ruben BaartTo all in vitro meat optimists, hear hear! In May 2018 we launched the petition ' In vitro meat is here. Let us taste it. ' We proudly announce that this petition led to …
Why insects are not the new sushi
Jonas HousePeople across the world have been eating insects for thousands of years. We know that approximately 2,000 species are edible and that these insects are eaten in many different …
How the Dutch government is obstructing the advent of in vitro meat
Ruben BaartIn 2017, two years after her father died , Ira van Eelen decided to call the Dutch Arable Farming Union. She couldn't help but wonder how come the Netherlands was still not …
Interview: Designer Shahar Livne is geomimicing the future of plastics
Kelly van GemertWe sat down with Shahar Livne, an Israeli-born designer who graduated from the Design Academy in Eindhoven to talk about her vision on the future of plastics.
In vitro meat is here! But we are not allowed to taste it
NextNature.netPreviously we predicted that we would be eating in vitro meat by 2028. But as it turns out... In vitro meat is already here! And we are not allowed to eat it. The meat has been …
Proposing with a Phone Case
Charlotte KuijpersNot only does this phone case conceal your engagement ring in preparation for the big moment, but it’ll then take a video of your partner as you go down on one knee.
Sandra Rey wins ECO Coin Award
NextNature.netThis year we are proud to announce that, with her ambitious work within the field of bioluminescence for Glowee, Sandra Rey is the ECO Coin Award 2017 winner.
Welcome spring with this selection of NANO Supermarket products
NextNature.netWell, we finally made it. After a long, cold, dark winter, spring has officially started today. And guess what it's bringing with it? Nope, not spring flowers: Love flowers! …
Celebrate 10 years of Studio Drift at the Stedelijk Museum
NextNature.netTonight, Studio Drift is launching their debut museum solo exhibition at the Stedelijk Museum in Amsterdam: Coded Nature . As NNN Fellows , this Dutch duo is showcasing a …
The Ocean Cleanup heads for the Pacific
Koert van MensvoortThe Ocean Cleanup claims its device could cut the size of the Great Pacific Garbage Patch in half in five years.
The world’s plastic problem is bigger than the ocean
Christopher J. PrestonAs you read this, a strange object that looks like a 2,000-foot floating pool noodle is drifting slowly through the central north Pacific Ocean. This object is designed to solve …
How an app is helping restaurants cut food waste
Meike SchipperGlobally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
Games become jobs: Looking through the eye of the submarine with an X-Box controller
Kelly van GemertSubmarines feature a special device called a periscope that allows people inside the submarine to see what's going on above water. Controlling such an eye requires hours of …
AI creates images of food that doesn’t exist (yet)
Tristan GreeneA team of researchers from Tel-Aviv University developed a neural network capable of reading a recipe and generating an image of what the finished, cooked product would look like. …
Air pollution may be making us less intelligent
Barbara MaherNot only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …
This artificial reef was just deployed in Sydney Harbor
Vanessa Bates RamirezEarth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …
Why electric cars should be allowed to drive faster
Koert van MensvoortIn response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …
5 things to do at DDW19
Freya HutchingsLining up plans for Dutch Design Week ? Once more, 2600 designers gather in over 120 locations during 450 events. So whether you're a local, new in town, or just passing through, …
Future Food: here's what we'll be eating in 2050
Next Nature DevWhat will you be having for breakfast, lunch or dinner in 2050? Where will this food be sourced? And how will it be prepared? Edible insects? A hamburger made from cultured meat? …
Genetically engineered plants do it better
Ruben BaartWelcome to the conversation! Every week, we’ll open up a new conversation among members of the network about next nature topics we've encountered around the globe. We hope …
Why not all buildings have sustainable green roofs
Michael HardmanRooftops covered with grass, vegetable gardens and lush foliage are now a common sight in many cities around the world. More and more private companies and city authorities are …
Human-animal hybrids could be used for growing organs
Mackenzie GrahamAround the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …
Next Generation: Unleashing nature’s untapped potential with Amelie Unger
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Next Generation: Thinking about the future of food with Annie Larkins
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
10 Next Nature dinner table conversation starters
Ruben BaartSummer is here and the sun is out, and yes, this is awesome. After a long day in the sizzling summer sun, you get a group of people together to share some delicious food, …
The Next Nature gift guide 2019
Next Nature DevWhether you're in need of a holiday gift for your techie spouse or tech-adverse grandpa, the truth is, your loved ones deserve better than a generic gift card. Now we understand …
Why some plastic packaging is necessary to prevent food waste
Manoj DoraThere has been a surge in awareness of the damage that plastic pollution does to our planet in recent years. It has spurred a number of campaigns to remove single-use plastics …
Not a babysitter, but a social media sitter
Ruben BaartIbis, A popular European hotel chain, just introduced the world to the “social media sitter.” It’s the answer to a problem few knew existed, and even fewer though we needed …
The Coming World: ecology as the new politics
Ruben BaartIn science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …
A guide to parenting with AI Barbie
Siri BeerendsThe rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …
Open call: speculative product advertisements
Next Nature DevIn anticipation of the forthcoming Next Nature Magazine, we call upon you, dearest creatives, to submit a fictitious editorial advertisement: The Infotizement. The infotizement is …
Next Generation: listening to ultrasound waves with Sheng-Wen Lo
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Is in vitro meat good news for animals?
Ruben BaartThe Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …
Mediamatic offers a quarantine-approved dinner date
Ruben BaartDinner for two, please! Well we didn't expect to say that in a while. Luckily our friends at Mediamatic are working on an innovative solution. Their 'Serres Séparées' dinner dates …
Next Generation: Hearing the first breath of Earth with Dora Lionstone
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: illustrating the remains of the anthropocene with Louise Silfversparre
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Exploring the vegetal cyborg with Marie Declerfayt
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
9 creatives in biotech you need to know right now
Ruben BaartThe field of biofabrication is still new to most people. As founder and CEO of Biofabricate, Suzanne Lee shared with us this exciting online event series Creatives in Biotech . If …
7 ways to connect with your loved ones
Ruben BaartDuring these challenging times, we have tried to find happy moments together where we could find them. From weekly Zoom lunches to having online wine tastings, still, it doesn't …
6 gadgets to make your long distance relationship last
Claire Ouwejan"Absence makes the heart grow fonder" is a common phrase people associate with romance that has been forced apart by distance. But for long-distance couples (as many of us can …
Team Human is a manifesto for humankind
Ruben Baart' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …
The technosphere is outweighing the biosphere
Ruben BaartOur deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …
How a giant robot learns its true nature
Ruben BaartAt first glance, the premise of the film 'The Iron Giant' (1999) seems to be a total failure. An animation film set in the United States in 1957; while the Russian satellite …
Next Generation: Moving towards the plastic human with Max Ahluwalia
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
We are all parent Earth
Ruben BaartLast week I was strolling through the aisles of the supermarket when I heard a buzzing sound coming from my pocket. I looked up from my cart and saw it was a message from …
Welcome to the Novacene
Ruben BaartJames Lovelock (1919) has lived on Earth for over a century. You may find that long, but it is short for himself. He thinks big and from a long-term awareness. At the age of …
What will COVID-19 teach us about life?
Koert van MensvoortWe live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …
Why physical distancing feels so unnatural to us
Isabelle Catherine WinderFor many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …
Why screen games are still real play
Marcus CarterPlay is a core part of a healthy childhood , through which children develop social, communication, cognitive and physical skills. Children’s play adapts to its circumstances. …
Exploring the society of trees
Tracy MetzIn conversation with Canadian researcher Suzanne Simard, inventor of the Wood Wide Web.
Next Generation: Building aquatecture with Shaakira Jassat
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Blocking the sun with dust
Vanessa Bates RamirezIn the past few years, scientists have hatched some pretty crazy-sounding schemes in the name of protecting Earth and its inhabitants. From building an underwater wall 120 …
How cyborg soil reveals the secret microbial metropolis beneath our feet
Edith HammerDig a teaspoon into your nearest clump of soil, and what you’ll emerge with will contain more microorganisms than there are people on Earth. We know this from lab studies that …
Beijing's dust storm: part human, part nature
Ruben BaartThe skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …
How telecommunication cables could help detect earthquakes
MaithriAt the bottom of the Earth’s oceans lies an intricate network of over a million kilometres of fibre optic cables. These cables were laid on the seabed by telecommunication …
Elephants are geodesigners
Jeppe Aagaard KristensenImagine you’re in a hot air balloon flying over an African savanna in the late growing season. Below, herds of elephants, zebras, wildebeests and rhinos roam a mosaic landscape …
Explore the future of nature at IDFA Festival
Kelly van GemertHumans often claim to be at the top of the food chain, but is that really the case? We are experiencing – now more than ever – our own fragility: an increase in natural disasters, …
Gear up for our VR timemachine!
Next Nature DevTravel to big future in our VR timemachine at the Evoluon in Eindhoven
Printing houses with cow poop
Kelly van GemertNow here's a perspective: a pooping cow is like a living 3D printer
Humans could recolonize Earth after mass extinctions with ectogenesis
Matthew EdwardsLately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …
Next Generation: Pursuing digital tactility with Studio PMS
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
La Belle Verte imagines a world of harmonious existence
Leanne VoshellUtopianism and dystopianism are themes often found in today’s movies, especially considering the increased awareness of the damage done to the Earth by human activities. Often …
How a mantis shrimp can one day help build self-growing roads
MaithriDon’t get fooled by the colourful, unsuspecting demeanour and size of the mantis shrimp. Known as “death incarnate” to its prey on the seafloor, the crustacean hides two …
Meet Kaia the CO2 filtering lamp
Kelly van GemertDid you know that we owe every second breath we take to the algae in the sea? And that minerals have been absorbing CO2 for billions of years while converting it into important …
The Next Nature gift guide 2021
Next Nature DevAs winter arrives, so does the season of giving. Good gift giving is an art and can be quite the endeavor at times. But don’t worry, Next Nature is here to help! We present to you …
Notes on the plastisphere
Shahar LivneEvery piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …
Plant virtual flowers with Pikmin Bloom
Kelly van GemertSoon it will be possible to grow flowers with your phone. Niantic and Nintendo joined forces to create a new mobile game connected to the Pikmin franchise. In this augmented …
How plastic waste is hurting women in developing countries
Kutoma WakunumaIf we are to build a greener, fairer and more equal society in the wake of COVID-19, it’s time for rich countries to end their practice of dumping plastic waste in developing …
Science Friction explores living among companion species
Ruben BaartIs it possible to imagine other earthly stories? Can we conceive of other ways of living among different species? This exhibition explores these issues with the help of a …
Animals are shapeshifting to cope with climate change
Sara RydingGlobal warming is a big challenge for warm-blooded animals, which must maintain a constant internal body temperature. As anyone who’s experienced heatstroke can tell you, our …
Social media likes change the way we feel about our memories
David BeerMemories are often considered very personal and private. Yet, in the past few years, people have got used to notifications from social media or phone galleries telling them they …
This documentary tells the story of Biosphere 2
Ruben BaartCan we create a new biosphere on another planet? Documentary "Spaceship Earth" shows how - in the Arizona desert.
Donna Haraway rejects the doomsday rhetoric of the Anthropocene
Ruben BaartFor multispecies feminist theorist Donna J. Haraway, “it matters what stories make worlds, what worlds make stories.” She studies the current age as the Chthulucene (chthon, …
Join the Next Nature Talkshow on biodesign!
Next Nature DevA living lamp that you need to feed, a tapestry made of animal waste streams and tableware made from algae. Welcome to the wonderful world of biodesign.
How memes are evolving beyond the image
Chloë ArkenboutThe times where memes were geeky and funny, somewhat disturbing images have been over for years. Even a simple frog such as Pepe is not innocent anymore. Memes were hijacked by …
Tiny houses: why more people are living in miniature
Alice Elizabeth WilsonTiny houses have been heralded as a radical and creative way to address a lack of affordable housing, as well as reducing living costs and shrinking our carbon footprint. My PhD …
Meet the lungs of the sea: phytoplankton
Abigail McQuatters-GollopPhytoplankton are microscopic algae living throughout the ocean’s surface waters. They can’t swim and are at the mercy of the currents and tides. Despite their small size, …
Turn your garden into living artworks for bees
Kelly van GemertArt not for people, but for insects. That is the goal of the Pollinator Pathway project by Alexandra Daisy Ginsberg. With her concept she wants to change the way we perceive our …
We sequenced DNA from a million-year old mammoths
Ruben BaartMost people think of mammoths as the iconic woolly species from the last Ice Age, which ended around 12,000 years ago. But mammoths originated in Africa around 5 million years …
What Rachel Armstrong is reading this summer
Ruben BaartArchitect Rachel Armstrong establishes an alternative approach to sustainability. Through a close reading of computational properties of the natural world, Armstrong develops a …
Why urban gardens are crucial for conserving bees and butterflies
Ruben BaartAs humans have industrialised farming to feed a growing global population, pollinators – animals vital for plant reproduction – have seen their food supply decline. In the UK, …
Next Generation: Exploring blood, salt and iron as biomaterials with Hedwich Rooks
Kelly van GemertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch: magazine@nextnature.net. …
Discovering AI generated species
Marit BeerseSofia Crespo and Feileacan McCormick have made an AI-generated endangered species installation on Times Square.
Exploring public spaces, landmarks and landscapes in Beneath the Surface expo
Marit BeerseThe ‘Beneath the Surface’ exhibition organized by Taiwan Designers’ Web at the Chiayi Art Museum teaches us about unconventional connections, past and future.
Beware of the Smombies: how smartphones affect our infrastructure
Kelly van GemertNext time you are taking a walk to work, have a look around you. You will probably notice that most of your fellow pedestrians are glued to their phones, rather than enjoying the …
Next Generation: Adorning bio embellishments with Aradhita Parasrampuria
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Understanding the ocean's metabolism
Marit BeerseScientists have discovered the effect of sunscreen on corals. We need to understand our impact on the world to understand its problems.
Next Generation: Producing glass from ashes with Benedikt Peirotén
Marit BeerseBenedikt Peirotén has started a project called ‘From the Ashes’ proposing using waste streams to replace the energy-intensive ingredients in glass.
Time gets bendy in Disney Pixar's new film
Marit BeerseSpoiler alert: this article explains a key plot point, but we don’t give away anything you won’t see in trailers. At the beginning of the new Disney Pixar film, Lightyear, Buzz …
Next Generation: Tasting Landless Food with Malu Luecking
Kelly van GemertRegeneration of extinct flavor families via microalgae
Driving solar with Lightyear: the world's first solar car
Ruben BaartImagine driving along in your car, powered by the same solar energy that nourishes the landscapes around it. Lightyear 0 is the world's first solar powered car, charging itself …
Using tattoos in medicine
Marit BeerseWhat if we can use tattoos to measure the concentration of certain components in your blood? Scientists developed a film that can detect the amount of oxygen.
Next Generation: Emptying Out with Natasja Bökkerink
Kelly van GemertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Generation: Wandering through the post wilderness with Melissa Schwarz
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Nature Gift Guide 2022
Kelly van GemertThe most wonderful time of the year can turn stressful quite easily when you run out of exciting gift-ideas. Don't worry, we got you covered.
Submit your project to the Bio Art & Design Awards 2022
NextNature.netHello upcoming bio artists and designers! We invite designers and artists interested in bio art & design to propose projects for collaborative work across disciplines. The Bio …
Our VR timemachine comes to Amsterdam
Next Nature DevSo you missed your flight to the Big Future? Or do you have withdrawal symptoms from your previous trip? Not to worry, we have news for you. Schedule a new flight from 12 March—1 …
Why Borghildur Indriðadóttir wishes to perform on the Moon
Kelly van GemertWhat is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …
The carbon footprint of space tourism
Eloise MaraisThe commercial race to get tourists to space is heating up between Virgin Group founder Sir Richard Branson and former Amazon CEO Jeff Bezos. On Sunday 11 July, Branson ascended …
The No(nhuman) Consent Form
Kelly van GemertThere seems to be a green shift happening in Dutch Design, where the traditional vision is slowly sprouting into a newer, more refreshing one. The biodesigners are emerging from …
Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni
Kelly van GemertWhat if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?
Next Generation: Unlearning botanical narratives with Nina Škerjanc
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
We’re all radioactive – life isn't possible without it
Marit BeerseMost radiation is natural and life on Earth wouldn’t be possible without it.
Organs from genetically engineered pigs may help shorten the transplant wait list
David KaczorowskiDemand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …
AI meal planner suggests humans to cook with human flesh and bleach
Kelly van GemertAI sure knows how to throw a banger of a dinner party. One that guests will never forget - or outlive. When New Zealand grocery store chain PAK’nSAVE introduced their new …
Bacteria might have eaten the Titanic's wreckage by 2030
Selin KirIn 1912, the RMS Titanic met a fateful demise as it crashed into the depths of the North Atlantic Ocean, leaving a mark on the world's collective memory, and igniting a lasting …
Bluehouses are the new greenhouses
Kelly van GemertFishfarming , or aquaculture has been the fastest growing food-sector for decades. This is nothing to be surprised about: fishing as a practice has been in existence since the …
ChatGPT is getting stupider and we don't know why - so I asked ChatGPT
Kelly van GemertAI language model ChatGPT has hit the mainstream last year when it became widely accessible to everyone. Next to doing our (home)work, it became also a D&D Dungeon Master , …
People are now having sex in self-driving taxis
Selin KirIn the evolving scenery of self-driving taxis in San Francisco, passengers are getting frisky in the backseat of driverless taxis.
Dubai will soon house the world's largest artificial coral reef
Kelly van GemertA floating sustainable city where humans can live, work and study while supporting aquatic ecosystems. Soon this will become a reality in Dubai, as sustainable real estate company …
A Dutch startup is saving the banana from extinction
Selin KirThere is a banana crisis happening right now. Our beloved yellow fruits are being threatened with extinction due to a fungal infection called Panama disease, which can wipe out …
Fashion brand Ganni grew leather with bacteria
Kelly van GemertDanish fashion brand Ganni proposed a post-leather future: they grew imitation leather with bacteria.
Next Generation: Designing chairs with mealworms and Will Eliot
Kelly van GemertWilliam Eliot designs chairs while collaborating with mealworms.
Whoops! Our sustainability efforts are warming the oceans
Koert van MensvoortCleaning up ships' pollution is making the ocean warmer than expected. Less pollution means less cooling clouds, heating up the Atlantic.
How to plant seeds with your shoes
Selin KirImagine helping nature restore itself simply by going for a run. In a fusion of fashion and conservation, London-based designer Kiki Grammatopoulos has introduced her concept …
Saving the oceans by sinking a 1980's superyacht
Kelly van GemertSunshine, cocktails, and the lap of luxury; a yacht usually doesn’t seem to symbolize sustainability or charity. But this one might save the ocean.
Tesla enhanced Lotus, now Lotus returns the favor
Koert van MensvoortLo and behold the new Lotus Eletre Hyper SUV car. It shouldn't be allowed to exist, yet you may meet it in traffic soon.
All aboard the world's first hydrogen passenger train!
Selin KirAs the world is trying to keep carbon emissions under control, humans are also looking for viable carbon-neutral transportation options. The people from French rolling stock …
Making prosthetic nipples out of human hair
Kelly van GemertDesigner Arianna Pezzano creates prosthetic nipples using keratine coming from the hair that cancer patients lose during chemotherapy.
This vending machine gives out health advice in exchange for your personal data
Kelly van GemertYour biggest wealth is health, but what it the costs you your anonymity? This vending machine gives you nutritional advice based on the information you give it.
Like fish that don't know they are wet, we are dwelling in a waterworks of money
Koert van MensvoortThe ancient Egyptians and Greeks saw water as the source of life, the "origin of everything". Today that role is reserved for money.
We can now grow insulin from lettuce
Selin KirIn a ground-breaking discovery, researchers at the University of Pennsylvania have achieved to produce insulin out of lettuce. There's no need for needles and injections anymore, …
Why NASA sends giant disco balls into space
Kelly van GemertIn the 1970s, NASA and the ASI launched a giant disco ball into space. Its purpose? Teaching the humans of today and the civilizations of tomorrow about Earth.
Will 3D-printed mussel reefs be the next nature?
Saskia WesselingResearchers hope that 3D-printed, biodegradable mussel reefs help the growth of mussel banks.
Yes, we can fry potatoes in space!
Kelly van GemertThanks to the European Space Agency (ESA) and a team of enthusiastic researchers from the University of Thessaloniki we now know for certain: we can fry potatoes in space. …
Cleaning water with magnets
Kelly van GemertWhat if we could clean our water with magnets? Wageningen University & Research, introduces the Magnetic Adsorption-Desorption (MAD) project.
Food after flood: what's on the menu when sea levels rise?
Kelly van GemertAs sea levels climb, coastal communities brace for floods and erosion. Artist Allie Wist asked herself: what will we eat in a flood-filled future?
Merging AI with human brain cells
Kelly van GemertA team of researchers are currently investigating the fusion of human brain cells with artificial intelligence. Creepy or innovative?
Obese mice are losing weight without breaking a sweat
Kelly van GemertBye-bye gym membership, hello losing pounds. Scientists have found a new drug that helped obese mice lose weight.
Next Gen: Watching our collective heartbeats with Nino Basilashvili
Kelly van GemertHeartsync is an interactive art installation crafted by artist Nino Basilashvili that syncs up your heartbeat with others.
Why looking at beaver dams might save the world
Méline MaquartEddie Corwin studies beaver dams and ponds from satellite images in order to restore watercourses and wetlands, and establish nature reserves.
Future Festive Feast
Kelly van GemertAs the year is coming to a close, many of us are preparing our homes and dinner tables for a festive meal.
How to teleport sushi
Selin KirSushi designed in Japan, printed in Texas. This might sound like a wild dream, but actually became a reality during interactive media festival South by Southwest (SXSW) that took …
Sonograms of planet earth
Eleni Maragkou, Kelly van GemertTechnology can help us to connect with our surroundings. Think about the microscope: it revealed ecosystems beyond our visual reach allowing us to look at the smallest inhabitants …