Fake-nature

USB Tanner

Don’t let the sun have the monopoly on making people love you more. Get the USB Desktop Tanning center and, in the comfort of your own cubicle, a scrumptiously golden tone can be yours in about the same time it takes you to update your lame blog with another meaningless entry that nobody will ever read. Ever.

Features:

  • Two base units attach to either side of your monitor
  • 4 WOLFFE Ultra-violet 100 watt bulbs
  • USB Powered
  • Variable rate knob features three settings (Powder, Tea, Malignant)
  • Comes with eyeball cover thingies!

Buy here

Read more (9 reactions)

Information Decoration

20k human chip

AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT
Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes in tens of thousands of genes can be evaluated at once. Every color represents a different kind of change to a cell. It’s all about measuring energy and classifying structures, f.e. to eventually be able to mutate our building blocks into their NEXT NATURE.

cell scanning

Read more (5 reactions)

Fake-nature

Hoax Dragon

“The baby dragon, in a sealed jar, was discovered with a metal tin containing paperwork in old-fashioned German of the 1890s. (…)
Some scientists believe that dragons, though the product of imagination, were inspired by the extraordinary creatures that once roamed the Earth.”

article: smh.com

Read more (4 reactions)

Manufactured Animals

Child Care Robot

NEC corporation is developping a “Childcare Robot PaPeRo” capable to play with and watch over children. The Childcare Robot is capable of recognizing and verbally communicating with people, sending images by mobile phone to persons far away, as well as playing games and singing along with others. With it, NEC is looking for new relationships and possibilities as a part of children’s groups at daycare centers, kindergartens and elementary schools.

“The aim of our research at NEC is not just to further robot technology, but to examine and develop better human-machine interface through the concept of living with robots“, said Yoshihiro Fujita, Project Manager, NEC Incubation Center.

www.incx.nec.co.jp

Read more (7 reactions)

Hyperreality

The Sleeping Garden

How to design an expierience of retrieving in nature in the middle of Holland’s second-biggest city? Design a park, built entirely from used railway sleepers. That was the basic idea of this proposal by graphic designers Hendrik-Jan Grievink and Kim Engbers (TEST), together with Henk Hartzema and Ruby van den Munckhof (ex-West 8 architects). The park was situated in a so-called “leftover space”, an area between three railroads near Rotterdam Central Station (NL). By simply creating a labyrinth of stacked up railway sleepers, a new and exciting urban environment is being achieved. Is it a park? Is it a playground? Is it a forest? Is it a monument? The no-programming of the spot will eventually lead to new and creative ways of using public space. In time, all kinds of flora will grow and take over the wooden structures. The Sleeping Garden was conceived for the competiition “A design for places leftover after planning”, commissioned by Atelier HSL.

www.atelierhsl.nl

Read more (11 reactions)

Biomimicmarketing

3D rendered bunnies prefer calm diesels

Kenichi Nagahiro, Honda’s chief engine designer, hated diesel engines. When asked to design Honda’s first diesel he flatly refused – unless he was allowed to start completely from scratch. The result is one of the cleanest, most refined diesel engines on the market today. Cute bunnies, pretty flowers and rainbows show their dislike of dirty, noisy, smelly diesel engines by destroying them in exchange for something better.

Read more (7 reactions)

Designed-by-Evolution

Fishscale

Sometimes this Old Nature thing seems so foreign and mysterious. Fortunately Next Nature is just around the corner! Check out this sweet site about deep-sea and oceanic life.

Explore the abyss

Read more (2 reactions)

Welcome back!

We have noticed you are a frequent visitor to our website. Do you think we are doing a good job? Support us by becoming a member.

Join