Dynamic-architecture

The Living Tower

According to Environmental Health Science Department of Columbia University, nearly 80% of the earth’s population will, in the year 2050, reside in urban centers. At present, throughout the world, over 80% of the land that is suitable for raising crops is in use (sources: FAO and NASA). The “Vertical Farm Project” shows a possible solution to this space-dilemma.

Read more (10 reactions)

Calm-technology

Technology behind Google’s results

As a Google user, you’re familiar with the speed and accuracy of a Google search. How exactly does Google manage to find the right results for every query as quickly as it does? The heart of Google’s search technology is PigeonRankâ„¢, a system for ranking web pages developed by Google founders Larry Page and Sergey Brin at Stanford University.

www.google.com/technology/pigeonrank.html

Read more (5 reactions)

Calm-technology

Dreamkeeper

Skin conductivity sensors are used to deduce the emotional state of the sleeper. This information is brought to 3-D studio where a script is used to transform this into physical forms. Objects can be 3-D printed and keep as a physical mnemonic device to keep the dream memories from slipping away.

Creating tangible objects that are physical manifestations of dreams can have personal, social and psychological benefits. For example, tangible dreams can be worn as unique accessories or collected for personal remembrance. The tangible dreams can also be shared between friends and family to deepen relationships.

interaction-ivrea.it

Read more (6 reactions)

Fake-nature

USB Tanner

Don’t let the sun have the monopoly on making people love you more. Get the USB Desktop Tanning center and, in the comfort of your own cubicle, a scrumptiously golden tone can be yours in about the same time it takes you to update your lame blog with another meaningless entry that nobody will ever read. Ever.

Features:

  • Two base units attach to either side of your monitor
  • 4 WOLFFE Ultra-violet 100 watt bulbs
  • USB Powered
  • Variable rate knob features three settings (Powder, Tea, Malignant)
  • Comes with eyeball cover thingies!

Buy here

Read more (9 reactions)

Information Decoration

20k human chip

AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT
Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes in tens of thousands of genes can be evaluated at once. Every color represents a different kind of change to a cell. It’s all about measuring energy and classifying structures, f.e. to eventually be able to mutate our building blocks into their NEXT NATURE.

cell scanning

Read more (5 reactions)

Fake-nature

Hoax Dragon

“The baby dragon, in a sealed jar, was discovered with a metal tin containing paperwork in old-fashioned German of the 1890s. (…)
Some scientists believe that dragons, though the product of imagination, were inspired by the extraordinary creatures that once roamed the Earth.”

article: smh.com

Read more (4 reactions)

Manufactured Animals

Child Care Robot

NEC corporation is developping a “Childcare Robot PaPeRo” capable to play with and watch over children. The Childcare Robot is capable of recognizing and verbally communicating with people, sending images by mobile phone to persons far away, as well as playing games and singing along with others. With it, NEC is looking for new relationships and possibilities as a part of children’s groups at daycare centers, kindergartens and elementary schools.

“The aim of our research at NEC is not just to further robot technology, but to examine and develop better human-machine interface through the concept of living with robots“, said Yoshihiro Fujita, Project Manager, NEC Incubation Center.

www.incx.nec.co.jp

Read more (7 reactions)

Welcome back!

We have noticed you are a frequent visitor to our website. Do you think we are doing a good job? Support us by becoming a member.

Join