Search results for Information Decoration

Visual of Information Decoration: Our Environment as an Information Carrier

Information Decoration: Our Environment as an Information Carrier

Picture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …

Visual of Information Decoration Scarf

Information Decoration Scarf

Remember the Information Decoration essay which argued our so-called information society barely employs our human bandwidth, as most of the data in our lives is presented in …

Visual of Information Decoration for Dummies

Information Decoration for Dummies

With this cooking timer gadget , you can explain information decoration to anyone. In addition to its default explicit digital time display, it has a modus in which the passing of …

Visual of Analogue vs Digital: Information Storage

Analogue vs Digital: Information Storage

In search for information people once used to go to libraries.

Visual of Feelling Information with Our Fingertips

Feelling Information with Our Fingertips

ching 64GB SD cards to each of our fingers challenges how we store and share information in a world were our digital privacy is at risk.

Visual of Harvesting traffic information through GSM's

Harvesting traffic information through GSM's

TomTom and Vodaphone want to use mobile phone signals sent from traffic jams to gather real-time travel information. The data will be used for TomTom users to establish if roads …

Visual of DNA as Information Storage

DNA as Information Storage

Scientists have written a message into the DNA of a living organism , a breakthrough they believe could lead to a new era of organic computers capable of healing themselves if …

Visual of Highway Decoration

Highway Decoration

Highway rural decoration.

Visual of An Ecstatic Dialogue with Richard Doyle

An Ecstatic Dialogue with Richard Doyle

When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …

Visual of Wine making = Math

Wine making = Math

Enologix makes software that predicts how a wine will rate in reviews even before it is made. It claims that wine quality can be measured chemically, and a score assessed, much …

Visual of There’s Plenty of Room at the Bottom

There’s Plenty of Room at the Bottom

So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …

Visual of Cutters

Cutters

Hope you have a strong stomach for this one: There are many ways known for decorating the body (both human and f.e. swine ). But it's fascinating to see that so many "cutters" …

Visual of The Playboy Interview

The Playboy Interview

In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …

Visual of 20k human chip

20k human chip

AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …

Visual of Wild Style

Wild Style

Using animals as canvas. To advertise here, call 0900 BANKSY. banksy.co.uk

Visual of IVY - hard disk cover evolves with your data

IVY - hard disk cover evolves with your data

IVY is an external hard disk which shows the content of the hard disk on its skin. When no data is stored on IVY, its skin will remain blank. When you purchase IVY, it appears to …

Visual of 3D Print Your Favorite Song

3D Print Your Favorite Song

What will the future of music look like?

Visual of Water Shows When the Heat is On

Water Shows When the Heat is On

Designer Carlijn Compen upgraded her watertap with some LED's that shift color along with the heat of the water. A simple yet effective example of information decoration that will …

Visual of Merkel Rainbow

Merkel Rainbow

German chancellor Angela Merkel is quite a phenomenon of colors. Blazer remains invariant.

Visual of This Color-Changing Glass Could Stop Date Rape

This Color-Changing Glass Could Stop Date Rape

Because date rape drugs are odorless, colorless and tasteless, victims don't normally realize they've been attacked until it's too late. In a clever, necessary bit of information …

Visual of Energy Consumption Shown on Power Plant

Energy Consumption Shown on Power Plant

Information decoration on a city scale. Every night from the 22 to the 29 of February 2008, the vapor emissions of he Salmisaari power plant in Helsinki will be illuminated to …

Visual of SMS Skyscrapers

SMS Skyscrapers

I reckoned Amsterdam did not have any sky scrapers, but I guess I wasn't looking through the right lenses. This sms-traffic Amsterdam skyline – made on new years eve 2007 – was …

Visual of Mini's Augmented Reality Driving Goggles

Mini's Augmented Reality Driving Goggles

The popular car brand is working on augmented reality goggles that enhance the driving experience.

Visual of Evolving Logo

Evolving Logo

Generative graphics and organic information design are making their way into the world of the applied arts. For the Max Planck Institute of Molecular Cell Biology and Genetics, …

Visual of Reading the Body: Finger Length Ratio Predicts Athletic Ability

Reading the Body: Finger Length Ratio Predicts Athletic Ability

The human body is increasingly recognized as a biometric source of information for a wide spectrum of issues, including security, psychopathology, personality and health. Earlier …

Visual of A day made of glass

A day made of glass

This video shows the design vision of Corning, a company that specializes in glass. Not just any glass, but glass incorporating technology, electronics and displays. And it sure …

Visual of Tattoo 2.0

Tattoo 2.0

As a child you probably had one of those temporary tattoos that come packed with over-sweetened chewing gum. It was a nice decoration, and a way to stand out. Recently researchers …

Visual of NANO Product: The Necklace

NANO Product: The Necklace

Breast cancer is a disease that comes with feelings of helplessness and loneliness. This nanotechnological necklace allows you to regain some control regarding your disease, in …

Visual of Helix, the App Store for Your Genome

Helix, the App Store for Your Genome

Startup Helix launched an online hub where you can digitally explore your genetic code by downloading different apps on your computer or smartphone.

Visual of The Coronation

The Coronation

For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …

Visual of Periodic table of the internet

Periodic table of the internet

A periodic table of the most popular websites on the internet . websites are categorized according to search engines, internet tools, site ranking, aggregators, web comics, …

Visual of Design = No sign

Design = No sign

The Wilson Quarterly profiles the in January 2008 departed traffic engineer, Hans Monderman , of the "less is more" school of traffic control: " (...) Previously, Monderman, like …

Visual of Agenda Wallpaper

Agenda Wallpaper

Using thermochromatic ink, which changes color when the temperature exceeds a specific degree, designer Josien Pieters created a prototype of a dynamic wallpaper that …

Visual of Nano Product: Honest Egg

Nano Product: Honest Egg

Do away with dishonest health claims for eggs and uncertain promises of organic, free-range hens. With eggshells that change color according to hormones, medicines, and nutrients, …

Visual of Nanotech Bracelet Detects Allergies

Nanotech Bracelet Detects Allergies

Designed by Luc de Smet, Awear is a speculative bracelet that can detect and record the sources of allergies for children in uncontrolled environments, such as schools and …

Visual of Shark Deterrent Wetsuits

Shark Deterrent Wetsuits

A new way to project yourself against sharks while enjoying your favorite watersport!

Visual of WikiGalaxy

WikiGalaxy

Turning 100,000 entries from the Wikipedia into a growing nebula of human knowledge.

Visual of Minimalist Effect in the Maximalist Market

Minimalist Effect in the Maximalist Market

The multidisciplinary design consultancy Antrepo Team created a project named Minimalist Effect in the Maximalist Market in 2010.

Visual of Teasing the Internet of Things

Teasing the Internet of Things

When there is such abundance of areas where IoT could be applied, several ridiculous, unnecessary products are inevitable.

Visual of Preventing Data Leaks with Smell

Preventing Data Leaks with Smell

The Smell of Data alerts Internet users in any case of data leakage and communicates digital hazards by means of smell.

Visual of Storing Knowledge for Eternity

Storing Knowledge for Eternity

Researchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.

Visual of AR City: Paving the Way for Augmented Reality Navigation

AR City: Paving the Way for Augmented Reality Navigation

Augmented reality applications are a promising alternative to GPS. At least that is what Blippar’s AR City app claims to be.

Visual of Branded Butterfly Wings

Branded Butterfly Wings

"A glowing green logo drawn by scientists on the wing of a genetically altered butterfly could herald the day that the insects are adorned with adverts and slogans . A team at the …

Visual of Digital Stock Market Garden

Digital Stock Market Garden

The Ticker Garden is a stand-alone data visualization application that monitors a stock portfolio. Different flowers represent the real-time performance of selected stocks via the …

Visual of Pimp my heart

Pimp my heart

The machine and the experience of the machine are becoming one. I've seen these kind of things in computer games, but now they are becoming real— Feels like plugging in to the …

Visual of Sexual Behaviour Totems

Sexual Behaviour Totems

These totems were developed by analyzing online pornography viewing habits. Custom software was written to sniff all incoming Web traffic at a discreet location, sorting packets …

Visual of shadow-creatures and digi-ants

shadow-creatures and digi-ants

New creatures arise through interactive media. Shadowmonsters found here Digitally generated ants found here

Visual of Snoil

Snoil

Snake, the video game that came out in the mid-to-late 1970s gained popularity in the 1990s for its inclusion on some mobile phones. Perhaps the reason why Martin Frey (Berlin) - …

Visual of Surreal weather conditions

Surreal weather conditions

Fascinating old nature. Somehow I find it hard to believe these weather photos are not computer rendered. Must be because of my Hollywood-special-effect-conditioned mind.

Visual of The Animal Sweater

The Animal Sweater

The pattern on the Animal Sweater suggests a new way to experience commercial imagery. The Animal sweater, designed by Karl Grandin, was first shown at The Biggest Visual Power …

Visual of Visual Kitchen

Visual Kitchen

This concept is a cutting board that has an integrated scale within a defined area on it's surface. This allows a person to both cut and measure ingredients on the same surface …

Visual of Brainbow Mice

Brainbow Mice

In the 1960s, scientists found that a particular jellyfish makes a protein that glows, known as green fluorescent protein. In the 1990s, using genetic engineering, researchers …

Visual of Business is Peanuts!

Business is Peanuts!

We designers often have to exchange business cards and usually they sit in a drawer forever, forgotten and out of date. In Japan there is quite a ritual about exchanging meishi or …

Visual of Food for Thought

Food for Thought

Food is no food. Food is scent. Food is temporary experience. Food is message. Welcome to this magical gastronomy tour. You will enjoy the tasty (video)links below: Works by Chef …

Visual of Generative graffiti

Generative graffiti

Here 's a work by Theodore Watson (Amsterdam) on the face of the Maritime Hotel (New York) The particles are attracted to one another but will repel away from the non-lit windows. …

Visual of Nanosculpture

Nanosculpture

This copy of Rodins "Le Penseur" / "The Thinker" (1880) shouldn't have that much on its mind... By using laser-technology, Korean researchers have crafted the microscopic version …

Visual of Sleeping beauty

Sleeping beauty

Where there is light, there is life. When you switch on the lamp, it provides you with light. You provide it with the generating power it needs togrow. Similar to living …

Visual of Sneak Preview Food

Sneak Preview Food

Lets face it: we spoiled western people are pretty much imprisoned by our self created safe environments and remotely disconnected from the wonders and chaotic surprises of old …

Visual of Temporary printing machine

Temporary printing machine

A nice light printer by rAndom International . The printer makes images with light on a light reactive surface. Really nice and high tech, but what I like is that the images fade …

Visual of Video dress

Video dress

Sometimes I have a hard time choosing between going out and staying home watching TV or my computerscreen. The great fashiondesigner Hussein Chalayan made these choices a lot …

Visual of Warp your room

Warp your room

Remember the e-paper brainstorm we had on this blog? Here's a nice example on that wallpaper-wish , though these "warps" are customly printed on fleece that can be papered the …

Visual of Crash–Test Pizzas?

Crash–Test Pizzas?

Schwan Consumer Brands, a leading frozen pizzas brand, has launched a challenging brand: UGLY. The design embraces the rising trend for natural, honest food and the notion that …

Visual of Dashboard Tree

Dashboard Tree

What is that growing on my car dashboard? Is that a tree? Indeed, Ford and Honda's next-generation dashboard instrument clusters feature trees (a vine in Ford's case) that grow …

Visual of Greenvertising

Greenvertising

Brain Kane proposes to fund the re-foresting of clearcut areas, with Greenvertising. See also: Branded butterfly wing , Plantvertising , Information Decoration , Dataplant , …

Visual of Hurricane$ approaching

Hurricane$ approaching

Economy is ecology . At least, according to the biomimicmarketeers of the US Wachovia Bank who created this weather report like newspaper advertisement. Nowadays most people worry …

Visual of It is Nature... but not as we know it

It is Nature... but not as we know it

No, this isn't the newest picture of some star system or nebula taken by Hubble telescope in deep space. This is a map of the internet. It might not be of much use since it is …

Visual of Museums becoming billboards

Museums becoming billboards

After selling his school , entrepreneur Teun Castelein is now selling the Dutch museum of graphic design.

Visual of Small Talks

Small Talks

An installment in the series of: " Things I have learned in my life so far ". sagmeister.com These dividing pages for Austrian magazine .copy spell out:"Starting / a / charity / …

Visual of Brandscape: Welcome Home

Brandscape: Welcome Home

Wednesday May 21st the boeing I was in, flew over some crop–fields near Schiphol (Amsterdam airport) where I took this picture. It reads: "Welcome home!". Unox is a famous Dutch …

Visual of Where it came from

Where it came from

Processed lunch meats etched with a laser cutter. The images show the source of the meat, making you more aware of where that great taste comes from. Link

Visual of Flyvertising

Flyvertising

To draw attention to a stand at the publishing house of the Frankfurter Buchmesse , a publisher hired some flies. The paper mini-banners -- attached with self-dissolving wax -- …

Visual of Kiwi Juice Packaging

Kiwi Juice Packaging

What you see is what you get – at least that is what you hope – with this biomimicked kiwinut juice packaging designed by Naoto Fukasawa. See also: Image consumption , Image …

Visual of Mapping the human desire to be touched

Mapping the human desire to be touched

Fleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …

Visual of Pantonebow

Pantonebow

Never believed in pots of gold anyway. Related: Credit on Color - rainbow of credit cards | Datafountain - money translated into water | Ceci n'est pas une Roche | Faked Fireworks …

Visual of The Nanosong

The Nanosong

The American Chemical Society is holding a contest seeking short videos that answer the question: "What is nano ?" UC Berkeley graduate student Patrick Bennett and his colleagues …

Visual of Unfolding the Earth - Myriahedral projections

Unfolding the Earth - Myriahedral projections

How can we unfold the Earth? Making a map of the earth is an ancient problem. For thousands of years cartographers, mathematicians, and inventors have developed methods to …

Visual of Debugged: 'Graphic Design Bugs'

Debugged: 'Graphic Design Bugs'

The Eindhoven-based design team ' Edhv ' made an installation to turn creepy crawlers into genuine graphic designers. By letting crickets, woodlice, ants and many other insects …

Visual of Digital Trashcan in a Physical Office

Digital Trashcan in a Physical Office

The Swedish design group Front brings the principle of the digital computerdesktop trashcan back to the physical world. When your trashcan basket is full it bulges outward. When …

Visual of Europe airspace reboot

Europe airspace reboot

After a ban on flying last weeks due to the volcanic eruption in Iceland, the European airspace was slowly rebooting to its old state of activity. This movie shows the movement of …

Visual of Fat/slim magnifying label

Fat/slim magnifying label

With an optical trick, this German bottle of water is trying to prove its effectiveness for the body. Though drinking water is a necessity for life, the downside of this product …

Visual of HappyLife

HappyLife

As our everyday living spaces are packed with electronics and become increasingly sentient, we might one day wake up in a house that knows more about your family's state than you …

Visual of Marching Back to the Tribe

Marching Back to the Tribe

Hurray, the Next Nature tribe is growing! Today, we’ve welcomed our 2,000th friend on Facebook . And what better way is there to honour this person with a celebrational parade …

Visual of Memory Helmet

Memory Helmet

Protection is the fundamental purpose of the helmet. This helmet, a conceptual design project by Seungjoo Lee , enables the storage and protection of memories. Plug in your USB to …

Visual of Nano Supermarket – Jury Report

Nano Supermarket – Jury Report

Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …

Visual of Toy Emissions

Toy Emissions

You know the HeHe collective from their laser projection on a power plant emission cloud . But did you know these folks have a real emission clouds fetish going on? In this …

Visual of Twitwee Clock

Twitwee Clock

Haroon Baig from Germany has figured out a way to key up the amount of 50+ Twitter addicts. This progressive nostalgic cuckoo device displays new tweets from any twitter stream or …

Visual of Body Manipulation and Music

Body Manipulation and Music

Lucy McRae uses spandex to deterritorialize the body. #powershow #bodyart http://bit.ly/th7KyR

Visual of Disgusting Switches

Disgusting Switches

If a light switch would be hairy or snotty nobody would want to turn on the light anymore, which is exactly why designer Katrin Baumgarten created some of the most one nauseating …

Visual of Feel-o-Meter Feels for a Whole City

Feel-o-Meter Feels for a Whole City

In cities across Germany, Big Brother looks like a smiley face. The Fühlometer, a piece by Julius von Bismarck, Benjamin Maus, and Richard Wilhelmer, uses security cameras and …

Visual of Transformer Owl

Transformer Owl

So, what do you get when an owl watches too much animated TV cartoon series? An amazing shape-shifting Transformer Owl! Now seriously, we don't actually think this wondrous White …

Visual of How People spend their Day

How People spend their Day

The layers in this visualization represent an average of how thousands of Americans spent their day

Visual of Pantone SkinTone

Pantone SkinTone

Should made-to-order babies become a reality in the near future, one piece of the design puzzle has been solved now Pantone has release their SkinTone system. Indexing 110 skin …

Visual of Robot Fridge Forces You to Smile for Food

Robot Fridge Forces You to Smile for Food

Feeling grumpy and hungry? Unfortunately, the University of Tokyo's Happiness Counter refrigerator won't open up until you give it a big smile. The concept is based on the fact …

Visual of Transparent Smart Window

Transparent Smart Window

Displays have been on our desks for too long. Samsung makes space and introduces the Transparent Smart Window . This LCD touchscreen is powered by the sunlight shining from the …

Visual of Filling Vacant Lots with Augmented Reality Grocery Stores

Filling Vacant Lots with Augmented Reality Grocery Stores

A Chinese company wants to transform vacant lots into virtual shopping centers.

Visual of The Pulsating Heart of Tokyo

The Pulsating Heart of Tokyo

An astounding tangle of multi-colored water flowing throughout 18 arteries represents what happens every day in the pulsating heart of Tokyo. This is how Takatsugu Kuriyama , from …

Visual of Traffic organized by Color

Traffic organized by Color

Made by Cy Kuckenbaker

Visual of Blaming Car Technology for Dumb Drivers

Blaming Car Technology for Dumb Drivers

Cars increasingly rely on technology designed to make driving easier and safer. But are these improvements creating less-skilled drivers?

Visual of High Frequency Trading Visualized

High Frequency Trading Visualized

Our peculiar image of the week is titled "High Frequency Captured on the Surface of Augmented Objects" by Ryota Matsumoto , Mixed Media 140718 110cmx85cm.

Visual of Modern African Classics

Modern African Classics

Textiles manufacturer 'Vlisco' updates African classic pattern to represent personal educational preferences.

Visual of Robotic Easter Egg Decorator

Robotic Easter Egg Decorator

A robot that applies computer controlled motion to precisely decorate your Easter eggs.

Visual of Smart Tags Change Color as Food Spoils

Smart Tags Change Color as Food Spoils

Smart Tags stick to containers of food and change color when something has expired.

Visual of Styles for Anti-Face Detection

Styles for Anti-Face Detection

The desire to avoid face recognition algorithms could bring us a whole new set of make up styles,

Visual of Analogue vs Digital: Still Antisocial

Analogue vs Digital: Still Antisocial

Some modern thinkers argue that new technology is making us antisocial.

Visual of Intimate Technology: the Battle for Our Body and Behaviour

Intimate Technology: the Battle for Our Body and Behaviour

Technology is nestling itself within us and between us, has knowledge about us and can act just like us.

Visual of Seeing the Sun Through Data

Seeing the Sun Through Data

The Smithsonian’s National Air and Space museum has taken the sun observation to the next level with a giant public display of images and data that show the sun in hyper-real detail.

Visual of The Candle of the Future

The Candle of the Future

My New Flame uses LED technology to faithfully recreate the experience of light from the ancient past

Visual of The Face of Litter

The Face of Litter

Hong Kong is using DNA analysis to publicly shame litterbugs

Visual of Every Wikipedia Article Leads to Philosophy

Every Wikipedia Article Leads to Philosophy

According to the Wikipedia page 'Wikipedia: Getting to Philosophy', more than 94% of all articles will eventually lead to the English article "Philosophy".

Visual of Coming Soon: Video Face Hacking for All

Coming Soon: Video Face Hacking for All

team of computer scientists at the universities of Germany and California has created what they call photoshoping videos in real time.

Visual of The Complex Networks of Our Planet

The Complex Networks of Our Planet

This video by Nature explains the complexity of networks on our planet.

Visual of A Map of Mars for Regular Humans

A Map of Mars for Regular Humans

If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …

Visual of Tangible Money in Digital Currency Era

Tangible Money in Digital Currency Era

The Scrip, a new universal cash device is bringing back the old metallic sparkle of the money and mixing it with today’s technology in order to fill the deficiencies of our credit and debit cards.

Visual of The Wordless Language

The Wordless Language

Emoji are taking our communication to a faster, simpler level.

Visual of How Much Carbon Do Your Clicks Cost?

How Much Carbon Do Your Clicks Cost?

How much carbon does a Youtube video burn? Greenpeace's #ClickClean initiative calls on big tech companies, like Google, to use renewable energy sources.

Visual of The Future of Firefighting

The Future of Firefighting

Firefighters can see through smoke with new thermal mask.

Visual of The Ephemeral Future of Internet Data

The Ephemeral Future of Internet Data

What the Internet would look like if all data were ephemeral?

Visual of Kangaroos Confuse Self-Driving Cars

Kangaroos Confuse Self-Driving Cars

Volvo's driverless car system has trouble recognizing kangaroos because it gets confused by the hopping of the marsupial.

Visual of Meet the Emoji Snake

Meet the Emoji Snake

Python breeder designed emoji snake.

Visual of iPhones Are Happy to See Us

iPhones Are Happy to See Us

What if you could unlock your phone by simply looking at the camera? According to Apple, this is precisely how the iPhone X will work. But how secure is it?

Visual of A Robot Will Spark the Next Avant-Garde

A Robot Will Spark the Next Avant-Garde

­­ “An illegal theme park exposing the ideology of the aesthetics of hacking”. “A hybrid drone targeting technological domination”. “A psychedelic fridge to raise doubt about fake …

Visual of Your Smartphone Is Your New Eye Doctor

Your Smartphone Is Your New Eye Doctor

The EyeQue personal vision tracker is a smartphone app that allows you to test your eyes from the comfort of your couch.

Visual of Virtual Poetry Museum Opens in Amsterdam

Virtual Poetry Museum Opens in Amsterdam

A virtual museum for poetry opens "its doors" at Museumplein in Amsterdam.

Visual of This artwork lets trees tell the story of climate change

This artwork lets trees tell the story of climate change

In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …

Visual of Drones Protect Indonesia from Volcanic Danger

Drones Protect Indonesia from Volcanic Danger

In Bali, volcanic danger looms large. Scientists are trying to use drones to forestall the danger and make the invisible workings of the volcano visible.

Visual of Period emoji could smash the stigma surrounding menstruation

Period emoji could smash the stigma surrounding menstruation

Astonishingly, we’re still living in a world where most women feel uncomfortable talking about their periods and some don’t even have access to sanitary products. This is why …

Visual of In-Formed

In-Formed

With this project, Nadeem Haidary is trying to make life's facts more tangible by creating products that tell you facts and statistics about the context that the item is designed …

Visual of Dataplant: Money translated to plants

Dataplant: Money translated to plants

Remember the datafountain ? Of course there are many other applications of information decoration: datawallpaper, datasounds, datafurniture and dataclimate. The picture above …

Visual of First A4 colour e-paper unfurled

First A4 colour e-paper unfurled

Philips presented an A4-sized colour electronic paper . A paper-thin and bendable viewing panel. "This represents the next generation in display technology," Chung In-Jae, chief …

Visual of Moral Shortcomings in the Technology Debate

Moral Shortcomings in the Technology Debate

Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …

Visual of 'Listen' to your genetic heritage: Curate a playlist based on your DNA

'Listen' to your genetic heritage: Curate a playlist based on your DNA

Genealogy services have exploded over the past few years, and Spotify is capitalizing on the boom by providing curated playlist based on users’ DNA. Here's what you should know. …

Visual of Entryparadise

Entryparadise

Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …

Visual of Next Nature Interview

Next Nature Interview

For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …

Visual of Humane Technology #4: Resonate with human senses

Humane Technology #4: Resonate with human senses

Principle number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …

Visual of Next Landscapes

Next Landscapes

Quoted in a recent interview about his work, Landscapes without Memory , artist Joan Fontcuberta asked, “Could a natural nature exist? The answer is no, or at least, not anymore: …

Visual of Solving Crimes Thanks to Amazon Echo

Solving Crimes Thanks to Amazon Echo

Amazon's Echo smart speaker may have witnessed a murder. But will it talk?

Visual of Bacteria Are the New Hard Drives

Bacteria Are the New Hard Drives

DNA is the densest known storage medium in the universe - and Harvard University researchers have managed to use it to store GIFs inside bacteria.

Visual of Next Generation: Searching for Null Island with Deborah Mora

Next Generation: Searching for Null Island with Deborah Mora

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Info Toaster

Info Toaster

Toasted bread as an information display device (originally developed in 2001 but somehow still intruiging): a toaster that parses meteorological information from the web and then …

Visual of Topic Flowers

Topic Flowers

An online application that generates artificial flowers from text . Type in any sentence you like and it is being transformed to a fake flower. via information aestethics

Visual of Biomapping

Biomapping

Bio Mapping is a research project which explores new ways that we as individuals can make use of the information we can gather about our own bodies. The project envisages new …

Visual of Cell Phone Disco

Cell Phone Disco

Electromagnetic radiation of active mobile phone sets off the LEDs in relative proximity. Light shadow follows the conversation through the space. …

Visual of Wallpaper Blooms When the Heat is On

Wallpaper Blooms When the Heat is On

Now this is a spot on example of  information decoration : a heat–sensitive wallpaper of which the printed flowers will be blooming when the radiator is on. Created by Shiyuan .

Visual of Sixth Sense

Sixth Sense

Although this TED video has been all over the web and commented on this website already, it still deserves a separate post: Desigineers Pattie Maes and Pranav Mistry of the MIT …

Visual of ISEA 2010: Artists addressing NextNature

ISEA 2010: Artists addressing NextNature

At ISEA 2010 , the International Symposium on Electronic Arts, media artists and media researchers from all over the world present their work in Dortmund (Germany). This year, …

Visual of A bacteria of a different color

A bacteria of a different color

In 2009, undergraduates at the University of Cambridge worked with scientists and artists to engineer E. coli into E. chromi , a new type of bacteria that secretes a range of …

Visual of Age of Internet Empires

Age of Internet Empires

A map of the most visited websites in each country. Google or Facebook, which one will conquer the world?

Visual of Analogue vs Digital: Basic Parts of Matter

Analogue vs Digital: Basic Parts of Matter

Do you think you are made from bits and bytes? Stop playing video games and spend some more time offline! Both atoms and bits are basic parts of matter.

Visual of Anonymity Becomes the New Privacy

Anonymity Becomes the New Privacy

Artists respond to biometric technology and data collecting software through subversive projects.

Visual of Interview: Huub Ehlhardt on the evolution of products

Interview: Huub Ehlhardt on the evolution of products

"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …

Visual of Biopresence - Human DNA Trees

Biopresence - Human DNA Trees

Imagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …

Visual of Dreamkeeper

Dreamkeeper

Skin conductivity sensors are used to deduce the emotional state of the sleeper. This information is brought to 3-D studio where a script is used to transform this into physical …

Visual of Hotspot Bloom

Hotspot Bloom

Hotspot Bloom is a wearable flower that glows and changes color to indicate the signal strength of a nearby wireless network (802.11b/g). With its mobile interface, Hotspot Bloom …

Visual of The infoBreath

The infoBreath

A flower arcing from a frosted pane of glass. Rigged with a breath sensor and connected to an internet packet sniffer, the flower is cued in to the wireless network flowing in the …

Visual of Weather forecasting umbrella

Weather forecasting umbrella

An umbrella that provides information about the likelihood of rain so that users can make a simple, informed decision about whether to take the umbrella with them as they leave …

Visual of Car Navigation - Just Follow the Red Cable

Car Navigation - Just Follow the Red Cable

Just follow the yellow brick road ... thin red cable and you know where to go! Instead of looking at a small 6 inch screen, or listening to less than exact turn by turn …

Visual of EnergyTree

EnergyTree

The EnergyTree is a device dedicated to monitoring your household energy use. It monitors you energy output from sockets and any device that is using electricity. It also monitors …

Visual of On the Road

On the Road

Excuse me, I am lost. Can you point me to the information super highway? Rendering by Chris Baker, photo Erik Pawasser. Via Wired . See also: Car Navigation - Follow the red cable …

Visual of NANO Supermarket Jury Report 2012

NANO Supermarket Jury Report 2012

After the successful introduction of the NANO Supermarket in 2010 it became even more clear that the contest and the presented results produced discussions and many challenges to …

Visual of What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks

What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks

Ever notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …

Visual of Beautiful Wallpapers Created with Vaccine

Beautiful Wallpapers Created with Vaccine

Created by Vik Muniz and Tal Danino, Flowers uses livers cells treated with smallpox vaccine in order to create floral patterns.

Visual of Brexit: the Cultural Climate Warms Up

Brexit: the Cultural Climate Warms Up

On the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.

Visual of Visualize the Hidden World of Digital Networks

Visualize the Hidden World of Digital Networks

Have you ever wondered what the infosphere looks like? Dutch designer Richard Vijgen’s app Architecture of Radio is a field guide to the hidden world of digital networks.

Visual of The Internet of Bees

The Internet of Bees

What can we learn from listening to the buzz of bees' conversation? With the help of a new monitoring system, a Canadian researcher is hoping to find out.

Visual of Chat with Plants in the Botanical Garden

Chat with Plants in the Botanical Garden

Exploring methods to better connect people to the natural world, Waag Society, in collaboration with the Dutch Botanical Gardens Association, have developed an app that allows visitors to talk with plants.

Visual of Twittering Trees Talk Climate Change

Twittering Trees Talk Climate Change

How do trees feel? A team of scientists have developed a network of twittering trees to monitor their feelings and raise awareness over climate change.

Visual of Using Spinach to Detect Explosives

Using Spinach to Detect Explosives

Introducing nanobionic spinach plants that can detect explosives.

Visual of Why human enhancement requires technological citizenship

Why human enhancement requires technological citizenship

New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …

Visual of How to design your Self

How to design your Self

Who are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …

Visual of Ambient bathtub

Ambient bathtub

I am sorry I couldn't be there— I had an important meeting with my bathtub that could not be rescheduled. This bathtub with an internal multicolour LED light fitting, creating a …

Visual of Stone Typography

Stone Typography

On a day trip to Brighton in the summer of 2004, this dude found a stone in the shape of the letter B. And then the rest of the alphabet.

Visual of A plant that glows when thirsty

A plant that glows when thirsty

SINGAPORE (Reuters) Some people like to talk to their plants. Now, students at Singapore Polytechnic say they have created a plant that can communicate with people - by glowing …

Visual of Bit.fall Aquadisplay

Bit.fall Aquadisplay

A screen of water displays images by controlling drops of water falling down. Density creates light/dark shades that create the image— Project site

Visual of Cameleon concept car

Cameleon concept car

The GloCar uses LED lights to change body panel colours, intensity and frequency. A driver can thus choose at will to either stand out or blend in. Alongside the cosmetic value …

Visual of Datafountain: Money translated to water

Datafountain: Money translated to water

"In the morning paper, I can read the weather report as well as the stock quotes. But when I look out of my window I only get a weather update and no stock exchange info. Could …

Visual of Excitement Clothing

Excitement Clothing

The body suit pictured above has LEDs that illuminate according to the wearer's state of excitement. Skin signals are measured and change light emission through biometric sensing …

Visual of Firefox crop cirle - Aliens prefer firefox

Firefox crop cirle - Aliens prefer firefox

Take back the field. This past weekend, the OSU Linux Users Group descended on a field in Oregon to create a 45,000+ square foot crop circle of Firefox.

Visual of GloFish

GloFish

  A tropical fish that fluoresces bright red is set to become the first genetically modified pet to go on sale in the US. Alan Blake and colleagues at Yorktown Technologies …

Visual of GPS Drawing - Global Positioning System

GPS Drawing - Global Positioning System

GPS drawings over land , on water , and in the air were created to investigate principles and techniques of geodesic drawing. The maps were made to measure travels and tracks and …

Visual of Harddisk tree visualisation

Harddisk tree visualisation

Remember the beautiful sequoiaview harddisk visualisation posted a while ago? Above a more illustrative harddisk tree visualisation by professor Jack van Wijk. Branches are …

Visual of More leg = more money

More leg = more money

The Stock market skirt Nancy Paterson made a blue taffeta & black velvet party dress that represents the real-time stock market situation by lowering or raising its hemline. …

Visual of N is for Nature

N is for Nature

There are people who think what makes a good wine comes from nature - factors like rain and soil and temperature. Then there are those who think it's a matter of second nature - …

Visual of WiFi-enabled Ambient Rabbit

WiFi-enabled Ambient Rabbit

There may even come a moment that our connection with an industrially manufactured coke bottle may be richer and more mythical that our relation with a genetically analysed and …

Visual of Need for Speed

Need for Speed

A transformation of the big flashing arrows from the computer game Need for Speed Underground 2, NFSU 2 to physical space. Although computer games generally try to imitate the …

Visual of Pollstream

Pollstream

pollution + streaming = pollstream; an intervention in environmental ethics. It creates a series of interactive environments in which members of the audience are in a process of …

Visual of Power Aware Cord

Power Aware Cord

The Power Aware Cord transports electrical power while simultaneously visualizing energy usage. Electrical transfer is represented through glowing pulses, flow, and intensity of …

Visual of RFID ladybag

RFID ladybag

a purse that visually keeps track of valuable items such as keys, wallets, personal identification cards, & cellular phones through various sensors embedded in the bag. if …

Visual of Sababa

Sababa

The Sababa is the first real time lava visualiser kit of global city flows. It takes the lava lamp one step further by reconstructing it according to the language of the current …

Visual of Semantic landscapes

Semantic landscapes

Semantic landscapes use the natural metaphore to visualize abstract data. The project above visualises different meanings of the word 'cold' in Biomedical patent documents.

Visual of Sequoiaview - harddisk visualisation

Sequoiaview - harddisk visualisation

Did you ever wonder where all that hard drive space went too? Sequoiaview generates organic-like views of the files and folders on your hard drives using cushion treemaps. …

Visual of Walls with Ears

Walls with Ears

A traditional textile heritage is celebrated with flocked wallpaper that comes to life as it reacts to ambient noise levels. The louder the space the brighter the wallpaper glows. …

Visual of Typing With Water

Typing With Water

A technique developed by the German Claus Winterfor an installation artist makes whatever word you type into a computer visible by a "water-curtain". The video shows the World …

Visual of World Mapper

World Mapper

The toy export map of the world. The toy import map of the world. The way we map things can make a world of difference. Worldmapper's maps transform traditional cartographic …

Visual of my death space

my death space

What happens to your digital presence when you die? Does your website, MySpace and Second Life live on? Nope, it goes to mydeathspace.com Funny enough, the Amsterdam based …

Visual of An American Self-Portrait

An American Self-Portrait

In his new series Running the Numbers , photographer Chris Jordan looks at contemporary American culture through the austere lens of statistics. Each image portrays a specific …

Visual of Augmented Christmas

Augmented Christmas

The AR+RFID Lab at KABK (Royal Academy of Art, The Netherlands) sends this marker card, wishing an Augmented Christmas. Funny they need a real tree for hanging those markers... …

Visual of Candyfab

Candyfab

This home-built hot air gun printing in sugar has great potential for making all kinds of interesting foods. Imagine getting tired of your second life avatar --> just print out …

Visual of Crop Circles

Crop Circles

In the UK farmers recall simple circles appearing on their land for generations. The British media first reported on the circles in the early 1980s. By 1990 crop circles had …

Visual of Digizerk

Digizerk

Henk Rozema displaying his invention (2006), the digital tombstone "Digizerk". It was only a question of time that global digitalization would be introduced on cemeteries. The …

Visual of Email Flight Sim

Email Flight Sim

This must be the best worst software concept I've seen this year.. An email mailbox represented as a 3D, virtual LAX airport. in this world's coolest email program, based on the …

Visual of Espace Pur

Espace Pur

Espace Pur by Marc Hottinger & Lucien Iseli (MID-ECAL) is an air ionizer that uses dust as pixels and that displays patterns thanks to it, in a very slow motion way. It cleans …

Visual of Eyebox

Eyebox

Future billboards will be looking back at you! The Eyebox2 can track the gaze of several people at once from 10 metres away in order to know how much attention the billboard is …

Visual of Forest clock

Forest clock

TiWalkMe is a clock (still in conceptual stage) designed to track 1,000 years using a forest seeded along a ribbon of land to tell time. Annual tree plantings set the pace, …

Visual of Human LCD

Human LCD

New media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .

Visual of Ibar

Ibar

ibar | video | related post: Reac-table | Shadow-creatures and digi-ants

Visual of iBiogenetics

iBiogenetics

In 1998 at the introduction of the iMac , Apple declared that the "i" stood for "internet". Apple later adopted the "i" prefix across its consumer hardware and software lines. …

Visual of Observe/me Bags

Observe/me Bags

No, these aren't X-ray pictures, these are designers bags! Part of the Observe/me fashion line of bags, wallets, gloves and coats created for the modern observed people. …

Visual of Packet garden

Packet garden

Packet Garden is an experimental artwork that seeks to provide an alternative and accessible approach to visualizing daily internet use. Plants are also grown for each protocol …

Visual of Philips Vibe Emotion Sensor

Philips Vibe Emotion Sensor

The VIBE - emotional sensing necklace combines conductive ink and textile sensors. The necklace can read multiple biometric signals of the wearer and communicates them to other …

Visual of Sandwatch

Sandwatch

Nice analog to digital watch by Balykin Pavel

Visual of Separating streets and words

Separating streets and words

When he's not saving the word, artist Matt Siber is disecting street images and their typography. Seen before in many forms on this blog, but very well done!

Visual of Skyscreen - largest urban LED screen in Asia

Skyscreen - largest urban LED screen in Asia

Alright, we can agree most of old nature has been altered by human activity. We're not just talking rain forest, icecaps and genetically modified fruit and kittens . Now you might …

Visual of Urban Camouflage II

Urban Camouflage II

Aaron Larney made these urban camouflage printed hoodies, just in case you need to blend into your dorm's notice-board. See also: Urban Camouflage I .

Visual of Air traffic

Air traffic

The paths of air traffic over North America visualized in color and form. Created by Aaron Koblin .

Visual of All the water and air on earth..

All the water and air on earth..

... gathered into spheres and compared to the Earth. The water sphere (blue) in this computer visualization measures 1390 kilometres across and has a volume of 1.4 billion cubic …

Visual of Ambient Umbrella

Ambient Umbrella

The Ambient Umbrella shows when rain or snow is in the forecast by illuminating its handle. Light patterns intuitively indicate rain, drizzle, snow, or thunderstorms. Local …

Visual of Cloudmaker

Cloudmaker

Always dreamed of creating your own clouds? You can now create them... from text. Wordle is a toy for generating 'word clouds' from any text, url or rss stream you provide. The …

Visual of Image Fulgurator

Image Fulgurator

This gun style camera projects messages on the objects of which people take pictures. It can not be seen by the naked eye, but is only visible on the pictures strangers take of …

Visual of Light weeds

Light weeds

Lightweeds is a project by Simon Heijdens and currently exhibited at the MoMA - part of the Design and the Elastic Mind exhibition . The organisms - plants, weeds, trees - exist …

Visual of Meet the Worms, Viruses and Trojans

Meet the Worms, Viruses and Trojans

Now there is an interesting biomimicmarketing technique we had not seen before. For their new marketing campaign internet security company Messagelabs worked with digital artist …

Visual of Multicultural Gourmet Pack

Multicultural Gourmet Pack

Multicultural Gourmet Pack is a new meat package that contains a variety of butchered meat products based on different religions and believes. The pack contains a total of 4 …

Visual of Recycled Coat

Recycled Coat

In the countdown to the Biggest Visual Power Show 2008 in Los Angeles we post some video's of earlier presentations. The Powershow 2003 in Paradiso, Amsterdam had the world …

Visual of Speaking at the Wall

Speaking at the Wall

I used to hear voices in my head, but now they seem to be coming from the walls – am I back in to the womb? No wait.. it's a wall that reacts to the spectators voice (quicktime) . …

Visual of The Breathe Table - Visceral Interaction

The Breathe Table - Visceral Interaction

Now why is that girl so excitingly staring at a few blurry blobs on a flat screen? Is it because these blobs are connected to her breath... What? Yes that is right, you are …

Visual of The Telepresence Frame

The Telepresence Frame

The Telepresence Frame is a domestic object which utilises the fact that one's bodily functions are digitised in order to create a new form of telepresence. Allowing loved ones to …

Visual of Type trousers

Type trousers

Beauty and the Geek jeans by Erik de Nijs. The trousers offer a full Querty keyboard layout as well as a mouse, speakers and a little joystick. As he calls it: "Beauty is skin …

Visual of Water in my phone

Water in my phone

Water inside your phone used to be rather devastating, but with the NEC FOMA N702iS (only in Japan) , designed by Oki Sato, it is turned into a joy. Watch the faked fluid move on …

Visual of Work in progress

Work in progress

"I think we are all "work in progress", this necklace is featuring a cool progress bar to indicate that." Nice work Irina!

Visual of A plate that regulates the speed of eating

A plate that regulates the speed of eating

Many people tend to eat too fast. As a result they do not receive signals from the stomach that they are in fact full. The result can be overeating and obesity . To encounter …

Visual of Economy, as Seen From Space

Economy, as Seen From Space

Reliable data on economic growth is hard to come by in many parts of the world, especially in developing countries. Yet according to scientists, outer space offers a new …

Visual of Freshness Label

Freshness Label

Japanese design agency To-Genkyo proposes a dynamic freshness label for meat products. The hourglass-shaped label contains special ink that changes color based on the amount of …

Visual of Fun River Waterslide

Fun River Waterslide

"A clean river is a fun river." Peculiar ad by stirmarketing.com Related: Playing with Dry Water | Datafountain | A Future Love Story

Visual of Miracle Banana Diet

Miracle Banana Diet

The 150 people watching this Youtube-commercial right now, will copy the source and blog or twitter it forward because it diggs. 40 of them have remorse over the fact that it is …

Visual of Second Sight - Augmented Contacts

Second Sight - Augmented Contacts

Getting information as fast as possible and on the spot is the trend. So what could be more direct than having information fired directly into the eye? Today - together with his …

Visual of Tattooed Goldfishes

Tattooed Goldfishes

If a tattooed pig is a bit too much for you, why not go for a tattooed goldfish? They bring you lost of luck and are available Chinese characters such as “Wealth, Dragon, …

Visual of Ars Electronica 2010: Artists Adressing NextNature

Ars Electronica 2010: Artists Adressing NextNature

Sind wir noch zu retten? That was the slogan of this year’s Ars Electronica festival in Linz (Austria). Titled ‘REPAIR’, the media art festival urged to leave our scepticism and …

Visual of Augmented (Hyper)Reality

Augmented (Hyper)Reality

Augmented (hyper)Reality offers a glimpse of an alternate universe, with augmented reality cranked up to the next level.

Visual of Intimacy Dress

Intimacy Dress

The Intimacy dress takes our notion personal space to a next level: the closer someone approaches, the more transparent the dress becomes. As such, the garment becomes a sort of …

Visual of Nano Tattoo to Monitor Diabetes

Nano Tattoo to Monitor Diabetes

Now here is something for the NANO Supermarket : Massachusetts-based Draper Laboratories have developed a special injectable ink with nano–particles. This ink eventually could …

Visual of Newspaper Wood

Newspaper Wood

How to upcycle old newspapers? Mieke Meijer (a.o.) from Vij5 took a jar of glue and started imitating tree rings. "The product surprisingly mimics the quality of real wood" she …

Visual of SMSlingshot

SMSlingshot

Urban intervention, naughty boy-style! The public media interventionists of VR/Urban have designed a cool tool to intervene into next nature: the SMSlingshot. A wooden, embedded …

Visual of Squamata headset dances with the Music

Squamata headset dances with the Music

Inspired by body language of animals (in particular squamates and porcupines), designer Jop Japenga created a headphone with an adaptive skin that responds to the music played on …

Visual of Squirming ‘umbilical’ phone cable

Squirming ‘umbilical’ phone cable

This umbilical cord-inspired charger cable by interactive media artist Mio I-zawa comes to life when connected to an iPhone. Don't watch the video if you are anthropomorphobic . …

Visual of The most expensive liquid

The most expensive liquid

Printer ink is assumed to be the most expensive liquid on Earth. If you believe the many websites that quoted the figure above. But little research learns that this is figure is …

Visual of Traces of Everyday Embedded in Textile

Traces of Everyday Embedded in Textile

The ‘Decay’ project explores how traces of time and use can be embedded in textile. By wearing a carbon fibre suit over a white blouse, textile designer Marie Ilse Bourlanges …

Visual of Birthmarks Tattoo

Birthmarks Tattoo

As the name suggests, Birthmarks Tattoos , are fake - but permanent - birthmarks that you can add to your body. Aside from its decorative potential, Birthmarks Tattoo makes it …

Visual of The Sound of the Blue Canary

The Sound of the Blue Canary

Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …

Visual of Theriomorphous Cyborg

Theriomorphous Cyborg

The Animal Architecture Awards have just announced the winners of their 2011 contest. Taking first place is Simone Ferracina's Theriomorphous Cyborg , a (speculative) augmented …

Visual of Visualizing Wifi Landscapes

Visualizing Wifi Landscapes

This project explores the invisible terrain of WiFi networks in urban spaces by light painting signal strength in long-exposure photographs. A four-metre long measuring rod with …

Visual of Just Browsing

Just Browsing

Dutch designer Boris Rijksen experiences a culture shock when he enters the real world after a day of screen work. Before, the ‘digital immigrant’ struggled to understand digital …

Visual of Leaf Thermometer

Leaf Thermometer

Designer  Hideyuki Kumagai must have been inspired by the seasonal colors of nature when he designed this thermometer. Stick the leaves to your window, or make a bush at your …

Visual of Nano Product: Nico

Nano Product: Nico

Nico is cute, cuddly and serious about your child’s health. Many adults smoke around children with no thought for their developing lungs. Covered in nicotine-sensitive nano-cloth, …

Visual of

"Smart Highways" to Power Streetlights and Electric Cars

Roads are a ubiquitous, even defining aspect of our urban and suburban spaces. In the United States alone, parking lots and roads cover 16,000 square kilometers. So why must roads …

Visual of Years

Years

Artist Bartholomäus Traubeck created a hyper-nostalgic record player that, rather than making music from vintage vinyl records, uses slices of woods to generate sound.

Visual of Bird Sounds Visualised

Bird Sounds Visualised

Made to beat the real thing. By digital artist Andy Thomas .

Visual of The Talking Window: a New Audio Medium

The Talking Window: a New Audio Medium

Advertisers have figured how how to induce auditory hallucinations into your morning commute.

Visual of A Jewel That Stops You From Checking Your Phone

A Jewel That Stops You From Checking Your Phone

For every smartphone user to recognize, is that merely the lighting of your screen, a vibration or ring distracts you from almost every activity. Even when you are spending time …

Visual of Camouflaged Ships

Camouflaged Ships

These unbelievably rich and dazzling graphics were made to avoid enemy attack.

Visual of High-Tech Cemetery

High-Tech Cemetery

In the Ruriden cemetery, in Tokyo, over 2.000 Buddhas statues are illuminated by high-powered color changing LED lights.

Visual of Listening to Wi-Fi

Listening to Wi-Fi

Modern technologies give deaf people the ability to hear again, not only regular sounds but also the invisible Wi-Fi signals.

Visual of Play Buttons on Paper Magazines

Play Buttons on Paper Magazines

Updating the old paper magazine into the digital realm.

Visual of Timeline Of The Far (not so bright) Future

Timeline Of The Far (not so bright) Future

BBC predicts the far future.

Visual of Analogue vs Digital: Never Lost with GPS

Analogue vs Digital: Never Lost with GPS

Before global positioning systems, we all used maps. And they could be very annoying.

Visual of Analogue vs Digital: News, Now and Then

Analogue vs Digital: News, Now and Then

We are all journalists in a century in which Twitter is the main news outlet.

Visual of Artworks that Look Virtual, but Are Completely Hand Painted

Artworks that Look Virtual, but Are Completely Hand Painted

These paintings by  Johnny Abrahams look almost computer made - except they are not. Working mainly with black and white acrylic paints and with a lot of patience, the American …

Visual of When Was the Last Time you Were Bored?

When Was the Last Time you Were Bored?

The Bored and Brilliant project asks people to measure their smartphone use take some conscious steps to limit the digital interactions.

Visual of 53 Shades of Blue

53 Shades of Blue

An artist installed a sculpture on the main street of Ljubljana, Slovenia, that measures the blueness of the sky.

Visual of Australia Moves Too Fast for GPS

Australia Moves Too Fast for GPS

The entire continent of Australia has shifted and that's a problem for GPS, meteorologists, automated cars and even drones.

Visual of Fitness Trackers Help Improve Cycle Paths

Fitness Trackers Help Improve Cycle Paths

Tracking your workout can help improve the safety and optimize routes for cyclists and pedestrians in your town.

Visual of A Political Weather Forecast

A Political Weather Forecast

James Bridle is comparing vast amounts of historical weather data and polling results in order to produce hybrid weather forecasts.

Visual of Keeping Up with the Eagles: Birdwatching 2.0

Keeping Up with the Eagles: Birdwatching 2.0

This live stream video of a Bald Eagles family nesting in Florida has counted more than 72 million viewers.

Visual of Meteorology Captures the Technosphere

Meteorology Captures the Technosphere

There is a WiFi network illegally configured that interferes with the rain radar creating a ray of "clouds" that won't bring any water.

Visual of The Smell of Global Economy

The Smell of Global Economy

The Pollution Pods installation replicates the smell and air quality of five different urban environments, forming the smell of a global economy.

Visual of How AI and genomics will impact the future of making babies

How AI and genomics will impact the future of making babies

As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …

Visual of The Dictionary of Online Behavior adds a virtual layer to your vocabulary

The Dictionary of Online Behavior adds a virtual layer to your vocabulary

To some extent, it's a chicken-and-egg question: Are you unable to think about things you don't have words for, or do you lack words for them because you don't think about them? …

Visual of Microbiocene: A microbiological archeology of the future

Microbiocene: A microbiological archeology of the future

In configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …

Visual of Hello, superorganism

Hello, superorganism

When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …

Visual of POND: A symphony of lights and water

POND: A symphony of lights and water

Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …

Visual of Next Generation: Louise Silfversparre illustrates the remains of the Anthropocene

Next Generation: Louise Silfversparre illustrates the remains of the Anthropocene

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Exploring Next Nature (2004)

Exploring Next Nature (2004)

The first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …

Visual of Erkundungen im Nächste Natur (D)

Erkundungen im Nächste Natur (D)

Die Natur verändert sich mit uns (English version: Exploring Next Nature ) by Koert van Mensvoort , published in Entry Paradise, Neue Welten des Designs, Gerhard Seltman, Werner …

Visual of Brainwave Binoculars

Brainwave Binoculars

The eye passes on more information to the brain than the brain will process. In that sense, the brain functions as a filter. But on the battlefield the risk of neglecting …

Visual of Cultivating the Money-verse

Cultivating the Money-verse

Alright, we were mistaken. Money isn't virtual after all.   A recent TV commercial of a Greek bank shed light on the issue. Your money lives, is anthropomorphic and inhabits an …

Visual of Innovative Nostalgia

Innovative Nostalgia

We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.

Visual of Internet Archeologists Reconstruct Vanishing Digital Artifacts

Internet Archeologists Reconstruct Vanishing Digital Artifacts

Data doesn't live forever – and a new breed of archeologists are trying to recover it.

Visual of Binary Code Able to Act Like DNA

Binary Code Able to Act Like DNA

There is a similarity between strings of binary and strands of organic DNA: they both carry actionable information encoded into reconfigurable symbols. Using nature’s biodiversity …

Visual of Pyramid of Technology: How technology becomes nature in seven steps

Pyramid of Technology: How technology becomes nature in seven steps

How technology becomes nature in seven steps

Visual of What Bits Want

What Bits Want

Digital bits have lives. They work for us, but we totally ignore them. What do bits really want? Here are the life stories of four different bits.

Visual of Smog: an Augmented Reality?

Smog: an Augmented Reality?

A few days ago, these images of iconic buildings in Beijing as they look with and without intense smog have been posted on Weibo, one of China’s most popular social media …

Visual of Digital Detox: Disconnect to Reconnect?

Digital Detox: Disconnect to Reconnect?

Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!

Visual of Looking into the Artificial Eye

Looking into the Artificial Eye

Sensor specialists recently developed a sensor that mimics the mammalian eye.

Visual of Managing the data deluge: Twitter as a tool for ecological research

Managing the data deluge: Twitter as a tool for ecological research

As early as 2009-10 , researchers were looking at Twitter data mining as a way to predict the incidence of flu. At the time, the H1N1 virus, or “swine flu,” had made the jump from …

Visual of Smart cities could give the visually impaired a new outlook on urban life

Smart cities could give the visually impaired a new outlook on urban life

Travelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …

Visual of Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman

Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman

What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …

Visual of What we can learn from 'The Social Dilemma'

What we can learn from 'The Social Dilemma'

Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …

Visual of Plant Sensors

Plant Sensors

One day you will step into the garden to look at the flowers - and the flowers will look back at you. Rich Fletcher, Nikolai Slavov, and Hiroshi Ishii from MIT Tangible Media …

Visual of Post History

Post History

Jos de Mul (Erasmus University Rotterdam), published in Next Nature Paperback, 2005 For someone whose main instrument is a computer, the world becomes a gigantic database. We see …

Visual of The World is not a Desktop

The World is not a Desktop

Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …

Visual of Augmented Cognition

Augmented Cognition

The Augmented Cognition System will help the brain adapt to data on computer-screens. If there's too much/little data, it will decrease/increase the information for you. If the …

Visual of Paradise by the Laptop Light

Paradise by the Laptop Light

Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on 23 November 2007 16:30, as part of STRP Art …

Visual of Call for Proposals: Designing for Next Nature

Call for Proposals: Designing for Next Nature

Nowadays, children know more corporate logo's and brands than bird or tree species. The average Western person has more worries about the instability of financial markets and …

Visual of Economy is ecology

Economy is ecology

Nature is itself a free market system. A rain forest is an unplanned economy, as is a coral reef. The difference between an economy that sorts the information and energy in …

Visual of Faustian Bargains and Pineapple Shampoo

Faustian Bargains and Pineapple Shampoo

Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …

Visual of Organic Coca-Cola

Organic Coca-Cola

Whoever you are, whatever you do, wherever you may be. You can’t beat the real thing. It really refreshes and brings real satisfaction in every glass. It was not until America’s …

Visual of Paradise by the Laptop Light

Paradise by the Laptop Light

Paradise by the Laptop Light is a next nature event with short films, speedlectures, special guests and one laptop. It will be held on 12 September 2008 16:30-17:30, as the …

Visual of Social Networking down to the Genetic Level

Social Networking down to the Genetic Level

If you've ever wanted to know just exactly how much DNA you share with your ridiculously tall brother or doppelganger best friend, you'll soon be able to find out. 23andMe , a …

Visual of The Blogging Houseplant

The Blogging Houseplant

Meet midori-san ,  the first blogging houseplant! Through sensors connected to the leaves of this Sweetheart Hoya reads bioelectric currents through the plant, this gives …

Visual of A Society of Simulations

A Society of Simulations

An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …

Visual of Designing Bugs That Eat Plastic

Designing Bugs That Eat Plastic

It is a well known secret that plastic hardly breaks down and almost all of the plastic ever made still floats around somewhere . With the great pacific garbage patch now twice …

Visual of Lab creates fake DNA evidence

Lab creates fake DNA evidence

DNA evidence has been the most bulletproof evidence for forensic sciences in recent years. Not anymore. A laboratory at Nucleix, a life-sciences company, has demonstrated it is …

Visual of Mapping the DNA World

Mapping the DNA World

DNA related tools, once expensive and restricted to research and crime labs, are rapidly becoming affordable. Like GPS – once a high-tech wonder now turned into a everyday gadget …

Visual of Repairing the Scars of War

Repairing the Scars of War

Lenka Clayton : A series of five digitally repaired images taken in Lebanon of buildings damaged by the 2006 conflict with Israel. The images were taken specifically for this …

Visual of The Uncanny Valley of the Pussycat Dolls

The Uncanny Valley of the Pussycat Dolls

Make no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …

Visual of Cough in Your Cell Phone, not Your Sleeve

Cough in Your Cell Phone, not Your Sleeve

Coughing into your cell phone could soon save you a trip to the doctor's office. Thanks to software currently being developed by Star Analytical Services , people may soon be able …

Visual of Having Invented the Gods, Perhaps we can Turn into Them

Having Invented the Gods, Perhaps we can Turn into Them

My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …

Visual of Natural-Born Junkies

Natural-Born Junkies

Hippopotamus: a 2,5cm-long tablet-shaped nonliving chewable animal, member of a multi-species flock known as the Animal Parade, which tastes like fruit and is found in little pill …

Visual of When Dreams become a Commodity

When Dreams become a Commodity

As neuroscience progresses, we gain access to previously inaccessible and unexplored areas of the human mind. Consequentially the intricate processes in our brain are cultivated …

Visual of Allergen Beagle – A Home Foodscanner

Allergen Beagle – A Home Foodscanner

No shellfish, no peanuts, no soy, no milk, no eggs. An increasing number of people suffer from various food allergies, which force them to constantly scan food packages for …

Visual of Manko & Nothing [#5]

Manko & Nothing [#5]

Manko was completely cut off from everything around him, virtually dead, buried alive inside of his own body. He remembered Zero's advice not to panic, but to no effect. He had no …

Visual of Book as Human-Computer Interface

Book as Human-Computer Interface

In combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.

Visual of Replacing Synapses with a Single Switch

Replacing Synapses with a Single Switch

Neural synapses in the human brain are extraordinarily complex structures. Responsible for relaying information between neurons, chemical synapses govern the release of over 100 …

Visual of The NBIC Convergence: When Machines and Matter ‘Have Sex’

The NBIC Convergence: When Machines and Matter ‘Have Sex’

The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …

Visual of Google's Shoes Talk to Runners

Google's Shoes Talk to Runners

Need a personal trainer? Google's new sneakers fulfill the role of a human coach.

Visual of Grow Your Clothing with Microorganisms

Grow Your Clothing with Microorganisms

Wine and bacteria combine to make seamless clothing.

Visual of Hire a Hyperreal Girlfriend to Look Better on Facebook

Hire a Hyperreal Girlfriend to Look Better on Facebook

Baudrillard intersects with social media in the world of fake online girlfriends.

Visual of Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.

Visual of NANO Supermarket 2014 Call for Products

NANO Supermarket 2014 Call for Products

Submit your speculative product to the NANO Supermarket and win 2500 euro.

Visual of Swallow a Pill to Turn Your Body into a Living Password

Swallow a Pill to Turn Your Body into a Living Password

Need a password that you'll never forget and can never be stolen? Try storing it in a pill in your gut.

Visual of The Artificial Touch-Sensitive Hand

The Artificial Touch-Sensitive Hand

Restoring the sense of touch with an artificial hand, using a brain interface.

Visual of New Plant Paradigms

New Plant Paradigms

In this approaching era, what might be biologically possible for plants?

Visual of Scan Yourself With Your Digital Doctor

Scan Yourself With Your Digital Doctor

There seems to be a high demand for the ability to self-diagnose. Consider Scanadu , a company developing a medical device for self-diagnosis, has become the highest funded …

Visual of The Anthropocene Explosion

The Anthropocene Explosion

We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.

Visual of The Smartest Artificial Skin

The Smartest Artificial Skin

Stretchy artificial skin lets prosthetic hand sense heat, humidity, and pressure.

Visual of A Self-Aware Mario Able to Learn and Feel

A Self-Aware Mario Able to Learn and Feel

Super Mario is now able to learn and feel in the confines of his 8-bit universe.

Visual of Artificial Brain Able to Perceive, Learn and Forget

Artificial Brain Able to Perceive, Learn and Forget

Scientists in Russia have taken a next step in the development of artificial intelligence by creating a "brain" that is able to educate itself.

Visual of Converting Gestures into Concrete Action

Converting Gestures into Concrete Action

Francesca Barchiesi's glove concept allows the user to translate hand gestures into images and information.

Visual of Diseases Of The Future

Diseases Of The Future

Nowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …

Visual of Genome Editing - Bringing the Übermensch to a Shelf Near You

Genome Editing - Bringing the Übermensch to a Shelf Near You

Last April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …

Visual of Over 300 Sharks are Now on Twitter

Over 300 Sharks are Now on Twitter

Recently 338 sharks in Western Australia subscribed to the microblogging service. They are now tweeting out where they are.

Visual of Should We Fear Thinking Machines?

Should We Fear Thinking Machines?

It seems thinking machines could put the human race in danger. How realistic these fears are?

Visual of Your Data Is Worth More Than You Think

Your Data Is Worth More Than You Think

How valuable are your data?

Visual of People, Use Your Drone to Map El Niño!

People, Use Your Drone to Map El Niño!

How to monitor the effects of El Niño ? The Nature Conservancy wants to take advantage of the massive image production that can be collected using smartphones and drones. From …

Visual of The Enlightenment Is Dead, Long Live the Entanglement

The Enlightenment Is Dead, Long Live the Entanglement

We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.

Visual of Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.

Visual of Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview with Mike Thompson and Susana Cámara Leret.

Visual of Meet the WiFi Drone

Meet the WiFi Drone

This is the WiFi drone, a useful companion that perfectly blend into our environment while providing us with information and connectivity.

Visual of Mentally Disordered Robots

Mentally Disordered Robots

While robots are becoming more and more human, with all their sensors and information processing abilities, may it be likely that they too could develop mental illnesses?

Visual of DNA Hacking: Catch a Computer Virus

DNA Hacking: Catch a Computer Virus

We know how it feels to catch a cold; how might it feel to catch malware?

Visual of Cyborg Cabin Crew

Cyborg Cabin Crew

Air New Zealand is equipping its flight attendants with AR headsets to explore in-flight optimization, giving its passengers a glimpse of what the future air travel service might look like.

Visual of Google Cars Can Now Sniff Out Pollution

Google Cars Can Now Sniff Out Pollution

Google cars can now measure urban air quality and collect data to create interactive maps with the most detailed views of pollution patterns ever created.

Visual of Next Nature Gift Guide 2017

Next Nature Gift Guide 2017

The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.

Visual of Technosphere Weighs 30 Trillion Tons

Technosphere Weighs 30 Trillion Tons

If humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.

Visual of Toilet Paper for Your Smartphone

Toilet Paper for Your Smartphone

Toilet paper for smartphones now on offer at Japanese airport.

Visual of Your Virtual Midwife Is Here

Your Virtual Midwife Is Here

An external device that helps you conceive, carry and raise a child. Too scary? Or extremely useful? It's up to you to decide, your virtual midwife is here!

Visual of The age of cyborgs has arrived

The age of cyborgs has arrived

How many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …

Visual of How blockchain technology is changing the agriculture industry

How blockchain technology is changing the agriculture industry

Blockchain is useful for more than cryptocurrency. It’s revolutionizing industry after industry. Next, it may change the way we get our food. The agriculture industry is complex. …

Visual of Digital islands: How this tiny country is embracing e-governance

Digital islands: How this tiny country is embracing e-governance

Recent years have proved that if you want to look for which countries are adopting innovative digital governing solutions, you don’t look at the usual tech suspects like the US or …

Visual of In Conversation with Marleen Hartjes: Introducing a digital door to the museum

In Conversation with Marleen Hartjes: Introducing a digital door to the museum

Don’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …

Visual of How the Dutch government is obstructing the advent of in vitro meat

How the Dutch government is obstructing the advent of in vitro meat

In 2017, two years after her father died , Ira van Eelen decided to call the Dutch Arable Farming Union. She couldn't help but wonder how come the Netherlands was still not …

Visual of Your next doctor might just be a robot

Your next doctor might just be a robot

Conventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …

Visual of Next Nature Academy presents: A workshop-in-a-box for your team

Next Nature Academy presents: A workshop-in-a-box for your team

Are you working on projects where technology and human interaction are involved, and are you looking for a new approach? As of today, we offer a brand new workshop concept for you …

Visual of China's state news agency has unveiled a virtual newsreader

China's state news agency has unveiled a virtual newsreader

Don’t adjust your TV set, that’s just a new computer-generated news anchor working out the bugs. Xinhua, a Chinese state-run media company, and Sogou, a Beijing-based search …

Visual of Air pollution may be making us less intelligent

Air pollution may be making us less intelligent

Not only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …

Visual of Experience bio design at Dutch Design Week 2019

Experience bio design at Dutch Design Week 2019

Bio design crosses the border between the ‘made’ and the ‘born’. Enabling living organisms as essential design elements, it brings us products that adapt, grow, sense and repair …

Visual of Next Generation: Elissa Brunato's bio iridescent sequin shimmers with nature

Next Generation: Elissa Brunato's bio iridescent sequin shimmers with nature

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of How technology keeps us connected, now more than ever

How technology keeps us connected, now more than ever

At this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …

Visual of Towards a global society as a superorganism

Towards a global society as a superorganism

Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …

Visual of Why I'm turning my son into a cyborg

Why I'm turning my son into a cyborg

Imagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …

Visual of 590

590

Digital becomes physical. Move your cursor using this mouse cursor. You can buy one here .

Visual of Better than the real thing

Better than the real thing

Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …

Visual of Crowd counter

Crowd counter

Crowd counter is a piece of software able to track moving features within a video clip. It works on the assumption that points that move together are most likely part of the same …

Visual of Designing for Next Nature (workshop report)

Designing for Next Nature (workshop report)

The extent to which new technologies are intervening with everyday life can hardly be underestimated. Virtual realities, nano- and biotechnology are increasingly providing new …

Visual of Dock painting

Dock painting

The new Bob Ross has arrived: his name be Gautam Rao. This painting shows a magnified part of the dock in OSX. I especially wanted to highlight the Picassoesque face on the Mac …

Visual of e-Paper

e-Paper

Will our mobile devices look like this in two years time? This is an example-application of the featherweight QVGA (320x240 pixels) active-matrix display: Phillips e-paper . (It …

Visual of Excuse me, is Your Tooth Ringing?

Excuse me, is Your Tooth Ringing?

The 'tooth phone' consists of a tiny vibrator and a radio wave receiver implanted into a tooth during routine dental surgery. Sound, which comes into the tooth as a digital radio …

Visual of Google Maps Mars

Google Maps Mars

Google has added it's first map of a Solar Planet to the google maps. The map of Mars provides detailed information of its mountains, craters, plaines and more (including …

Visual of MyTelescope

MyTelescope

However very little (background) information is given; in November or December 2006 the MyTelescope.com project and website are said to be up and running for everyone who want's …

Visual of They are made out of meat

They are made out of meat

A short story by Terry Bisson. For those who prefer video to literature, there's also this seven-minute film adaptation . "They're made out of meat." "Meat?" "Meat. They're made …

Visual of What's Epic?

What's Epic?

Epic is a fictional prospect (from 2004) on the future culture of media and internet-corporations. The human addiction to news and information must - according to this video - …

Visual of Wifi SM: Feel the global pain

Wifi SM: Feel the global pain

You have the impression that the disasters of the world do not touch you anymore? You feel vaguely sorry for other people's misfortunes but you don't feel the inner urge which …

Visual of A Tomb for All People

A Tomb for All People

Those crazy Germans are planning to build modern versions of pyramids that will function as gigantic burial sites. "The Great Pyramid can potentially be any human being's grave or …

Visual of Compubeaver

Compubeaver

Compubeaver by Kasey McMahon "I am interested in the way we interact with nature. As we become increasingly reliant on technology, we become disconnected from our natural …

Visual of Future Beauty: Hyperbreasts?

Future Beauty: Hyperbreasts?

Let's talk about hyperbreasts. Have you ever wondered why men like women with large breasts? Historically large breasts are presumably sexually attractive for men because they …

Visual of Karmeraflage

Karmeraflage

Kameraflage is a technique to put a layer on top of an image that can only be seen by digital cameras. In this way, an invisible layer of extra information can be added to a …

Visual of Ladybug cleans the Toilet

Ladybug cleans the Toilet

A bug that does the cleaning? This 1-meter (39-inch) tall, 1.35-meter (53-inch) long prototype robot ' named "Lady Bird" ' is designed to clean public restrooms at highway rest …

Visual of Map of Online Communities

Map of Online Communities

Just in case you hadn't seen this one . Informational spaces define physical spaces, rather than the other way around. The map is the territory? Let's just hope the territory can …

Visual of The 21th Century Paradigm

The 21th Century Paradigm

The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …

Visual of Typosperma

Typosperma

Another project by Oded Ezer, Typosperma is the second experimental typo project in his 'Biotypography' series. As a paraphrase on the biotechnology definition, 'Biotypography' is …

Visual of French USB wine

French USB wine

Remember the article N is for Nature , describing the Californian company Enologix, which creates software to predict how wine critics will rate a wine, so that it can be produced …

Visual of What does 200 Calories look like?

What does 200 Calories look like?

Everyone knows some foods have more calories than others. For many people eating turned into an information science, having to continuously read the amount of calories of the …

Visual of Feelings Translated to Plants

Feelings Translated to Plants

Ambient Biomedia is an investigative project about using living beings, in particular plants, to display human lifestyle problems information. The working principle of our systems …

Visual of Amsterdam Weekly on the Natural Revolution

Amsterdam Weekly on the Natural Revolution

The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …

Visual of Dirt 2.0

Dirt 2.0

To increase  decrease CO2 a lot of plans are made to cover city buildings with roof gardens. One problem however is that those gardens tend to be quite heavy. Especially when you …

Visual of DNA Synthesizer

DNA Synthesizer

Playing God? – "We are not playing..." After having seen this TED talk by Craig Venter , I came across a cynical yet clarifying comic (etcgroup.org) on his plans to build a new …

Visual of Flatscreen TV Now Required for Survival?

Flatscreen TV Now Required for Survival?

GRONINGEN (NL) – Low-income people in the Dutch city Groningen should be able to buy a flatscreen television, according to the alderman of social affairs Peter Verschuren. The …

Visual of Google tracks flue spread via sick searchers

Google tracks flue spread via sick searchers

This Tuesday, search giant Google released an experimental tool that tracks the intensity and movement of the influenza virus across the United States by monitoring the number of …

Visual of If the earth is not round..

If the earth is not round..

://nextnature.net The convincing tone of the Iraqi Astronomy researcher Fadhel Al-Sa'd in his elaboration on the shape of the earth in an Iraqi television show, is just as …

Visual of Killer Robots

Killer Robots

Rule #1:  A robot may not injure a human being or, through inaction, allow a human being to come to harm. Remember Isaac Asimov's classic  three laws of robotics ? Surely thats …

Visual of Reconstructing Faces

Reconstructing Faces

The video below is featuring a computer-generated replica of actress Emily O’Brien’s face at high-definition resolution. The Image Metrics process takes a captured video and …

Visual of Scientists Extract Images Directly from Brain

Scientists Extract Images Directly from Brain

(Extracted directly from Pink Tentacle , thanks!): Researchers from Japan’s ATR Computational Neuroscience Laboratories have developed new brain analysis technology that can …

Visual of The First Pregnant Man

The First Pregnant Man

At first I thought this first pregnant man was a hoax, but after I saw it on Oprah I realized it must be 'real'. Well, the pregnant man is actually a former woman who had a sex …

Visual of Traffic nature

Traffic nature

Japanese scientists made people drive in circles to find out how traffic jams get born. Related: Human Swarms | Harvesting Traffic Information through GSMs |  The things we design …

Visual of Wear Your Social Network

Wear Your Social Network

Get Wickd (props for the name boys – totally wicked!) is a tech-fashion brand that sells basic clothes with barcodes that can link your mobile phone to any page on the web, from a …

Visual of A Future Love Story

A Future Love Story

By MARCEL VAN DER DRIFT. Ten years from now, a cell phone gently sinks to the bottom of the river. It's one of the latest models. The clever design, trendy colours and nifty …

Visual of Battery-Free Implantable Neural Sensor

Battery-Free Implantable Neural Sensor

The shrinking size of electronics allows for the implantation of increasingly sophisticated electronic devices in the human body, paving the way for new prosthetics and …

Visual of China limits use of 'virtual' currencies

China limits use of 'virtual' currencies

By DAVID BARBOZA SHANGHAI — China made public on Tuesday regulations aimed at cracking down on the use of virtual currencies amid worries that a huge underground economy was …

Visual of Conductive Bodypaint

Conductive Bodypaint

As our lifes are increasingly regulated by electronics and there is a drive towards the miniaturization and portability of electronics on and around the body it seems only logical …

Visual of Crowdsourced drink

Crowdsourced drink

Remember the days when the flavor of a fruity drink was simply connected to an apple, orange, strawberry, kiwi, or perhaps – if you felt really exotic – an acai berry? Nowadays we …

Visual of Energy-aware Internet-routing

Energy-aware Internet-routing

Data-hungry companies like Google, Microsoft and Amazon could reduce their energy consumption with 40% by rerouting data to locations where electricity prices are lowest on a …

Visual of Games Become Jobs: Gold Farming in China

Games Become Jobs: Gold Farming in China

Chinese workers slaying monsters to earn gold for western consumers. It sounds surreal, but it is a far from virtual reality for the so-called 'gold farmers', who are working in …

Visual of Liberate the Breast Cancer Genes

Liberate the Breast Cancer Genes

On May 12, 2009 the ACLU and the (not-for-profit) Public Patent Foundation, filed a lawsuit, charging that patents on two human genes associated with breast and ovarian cancer are …

Visual of Orthorexia Nervosa: the

Orthorexia Nervosa: the "healthy" eating disorder

Following anorexia nervosa (under eating) and bulimia nervosa (overeating and compensating), orthorexia nervosa (obsessively healthy eating) is the latest eating disorder in the …

Visual of Crops Running Wild

Crops Running Wild

Only for the title already I wanted to post this as soon as I read it on Nature.com. The newsarticle is entitled " GM crop escapes into the American wild ." Brilliant! Let's walk …

Visual of Digital Gastronomy

Digital Gastronomy

The food printer seems to be one of those lustrous concepts that continues to pop-up in the fantasy of techno-connoisseurs. Some years ago James King already proposed a printed …

Visual of Douglas Coupland: A radical pessimist's guide to the next 10 years

Douglas Coupland: A radical pessimist's guide to the next 10 years

Douglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …

Visual of Fake blood cells deliver medicines

Fake blood cells deliver medicines

Newly created synthetic particles that mimic red blood cells may one day carry drug molecules and/or oxygen through bloodstreams, scientists write in the Proceedings of the …

Visual of From Analog to Digital, back to Analog

From Analog to Digital, back to Analog

Bitquid is an installation by Jeroen Holthuis which shows digital information transferring in an analogue way, through the use of fluorescent liquid. Nowadays the use of internet …

Visual of Glamor & Oil

Glamor & Oil

In response to the latest oil spill famed photographer Steven Meisel made a shoot for the Italian Vogue (the only fashion magazine in the world worth reading, really) that …

Visual of Here Comes the iPhone Virus

Here Comes the iPhone Virus

By analyzing billions of phone calls, researchers at Scandinavian telecom company Telenor , mapped how social connections between people – measured partly by how often they called …

Visual of Infobesity

Infobesity

Could this 2.0-bird be suffering from Infobesity ? Then it must be the result of excessive infocalorie consumption. Following people and news-sources on microblogservices like …

Visual of Mercedes-Benz Was Here

Mercedes-Benz Was Here

In the older days, people had to cross natural barriers like mountains for survival purposes. Grains from one side of the mountain was traded with cloth from the other side, for …

Visual of Next Nature Movie #4: Blade Runner

Next Nature Movie #4: Blade Runner

Look around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …

Visual of Self–Repairing Architecture

Self–Repairing Architecture

All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …

Visual of Shell Logo Evolution

Shell Logo Evolution

Corporate logos constantly have to adapt in order to survive. In the case of the Shell oil company this results in an image that ironically resembles the ones we know from the …

Visual of Social Avatar Beats Death

Social Avatar Beats Death

Avatars are commonly known as virtual characters in the digital realm representing a user. But what if avatars could house personal history, profile and ideas? Could that enable …

Visual of Sign Out Forever

Sign Out Forever

An earlier post on Next Nature learned that The Good People behind Webwill provide us with a service to extend our lives on social networks after our physical death. But what if …

Visual of Transparency Suit

Transparency Suit

Image consumption has never been as cool as in this brand new clip by Studio Smack , which was created for the upcoming Graphic Design Festival . The ‘Transparency Suit' …

Visual of US Judge Rules Gene Patents Invalid ?because they are Natural

US Judge Rules Gene Patents Invalid ?because they are Natural

Did you know that about 20 percent of your body isn't really yours? It has been patented by some corporation you probably never heard of. You can't patent gold, you can't patent …

Visual of Alex Gross

Alex Gross

Indulge in the paintings by Alex Gross . There is 'something' next nature about them... If happen to have more information on what that 'something' is, feel free to enlighten us …

Visual of Animals Made from Other Animals

Animals Made from Other Animals

That's no reindeer, and it's certainly no moose. It's an Irish Elk, Megaloceros giganteous , a deer that happens to be neither an elk, nor really all that Irish. What it does …

Visual of Anthropomorphobia

Anthropomorphobia

Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …

Visual of Breeding QR codes

Breeding QR codes

You look at the great dane and wonder what information the QR codes on its pelt might contain. You point your smart phone camera at the dog and realize you’ve been hit by a …

Visual of Bugged Bugs

Bugged Bugs

Some of you might remember the Next Nature article by Rolf Coppens called Withus Oragainstus . Since then there have been occasional newsreports on cyborg insects. For instance …

Visual of Inventing an Extinct Horse

Inventing an Extinct Horse

Along with the  Heck cattle and Scottish Highlanders , another reconstructed species roams the Dutch dunes . The sturdy  Konik horse , also known as the Polish primitive, is the …

Visual of Manko & Time [#13, The End]

Manko & Time [#13, The End]

Many things have been rumored about the artist called Manko since he vanished about a year ago. Some even went so far as to claim he had died. So it was all over the news when …

Visual of Nano Product: Pharmaceutical Sushi

Nano Product: Pharmaceutical Sushi

Are we creating the penicillin or the asbestos of the 21st century? Prior to the arrival of the Nano Supermarket , we share some speculative nanotech products with you. Here’s the …

Visual of Nano Supermarket seeks Assistants

Nano Supermarket seeks Assistants

Always wanted to work in a Supermarket? Here is you chance. The Nano Supermarket seeks assistants. The Nano Supermarket assistant is part of a team, knows the products and knows …

Visual of Next Nature Server Dementia

Next Nature Server Dementia

Over the last few days the Next Nature website has been suffering symptoms of dementia due to a hardware failure at our very fancy and luxurious web hosting provider Media Temple …

Visual of Should we clone Neanderthals?

Should we clone Neanderthals?

If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …

Visual of Social Microbial life

Social Microbial life

MyMicrobes , interestingly dubbed "Fecesbook" by ABC News , is the new social network for your gastrointestinal bacteria. For only $2,100 and a bit of poo you can become a member …

Visual of The Monsters We Deserve

The Monsters We Deserve

Recently, a video clip has been circulating the web that  purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …

Visual of The Neighborhood's DNA

The Neighborhood's DNA

I've noticed DNA spray notices springing up around Amsterdam.  I assumed it was a fairly standard anti-theft device:  A crime is committed, a little nozzle is activated by the …

Visual of The Technological Sublime

The Technological Sublime

The sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …

Visual of Caterpillar in the Grass

Caterpillar in the Grass

How natural it is to travel with the train. The flat screens in the trains of Dutch Railways almost makes you believe that it is a yellow, blue spotted caterpillar in the long grass.

Visual of Complexity and Evolving Synthetic Soil

Complexity and Evolving Synthetic Soil

Twenty-first century society draws from a world that is less determined by objects and increasingly shaped by connectivity. The clear either/or distinctions that formerly informed …

Visual of Corpus 2.1

Corpus 2.1

Could you imagine yourself having QR-code freckles, or a chlorophyl skin? Dutch artist Marcia Nolte visualises these kind of speculative scenarios in a very non-spectacular yet …

Visual of Time Between Emergence and Design

Time Between Emergence and Design

Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.

Visual of Featured Page #01: Hypernature

Featured Page #01: Hypernature

During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . To kick the series off, we’ll start with a spread about hypernature; the …

Visual of Featured Page #02: Google Nature

Featured Page #02: Google Nature

During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week the second one in this series: Google Nature. Imagine you are an …

Visual of Featured Page #03: Tomorrow’s Fossils

Featured Page #03: Tomorrow’s Fossils

During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week the thirs one in this series: Tomorrow’s Fossils. Ode to the car …

Visual of Featured Page #04: The McWorld Map

Featured Page #04: The McWorld Map

During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week a tool that encourages us to experience local specialties through …

Visual of Featured Page #07: Brand New Worlds

Featured Page #07: Brand New Worlds

During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week, after nation branding, the brand nation. Entering the store or …

Visual of Featured Page #08: McLuhan’s Tweets

Featured Page #08: McLuhan’s Tweets

During the coming weeks, we present a selection of our favorite pages from the Next Nature book . This week a page that is an homage to Marshall McLuhan, who is one of the most …

Visual of Nano Supermarket 2nd Edition: Call for Products

Nano Supermarket 2nd Edition: Call for Products

We call upon designers, technologists and artists to submit their speculative nanotech products for the next round of the NANO supermarket.

Visual of Nature is Dead, Long live Nature

Nature is Dead, Long live Nature

Like we did to old nature before, we must now cultivate our technological environment.

Visual of Next Nature Lecture @ DesignMarch Island

Next Nature Lecture @ DesignMarch Island

If you happen to be in the neighborhood you may want to attend the Next Nature lecture at the Island Design March on March 22 in the "most northerly capital in the world". If you …

Visual of Next What?

Next What?

In this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …

Visual of Playing With Pigs

Playing With Pigs

Besides children and pets , it turns out that pigs are also attracted to interactive interfaces. Pig Chase is a computer game in which pigs and people can play together. The aim …

Visual of Screw Technology

Screw Technology

In this particular piece of video art, loyal readers of nextnature.net might recognise the building as Zeche Zollverein in Germany, where we organized the Biggest Visual Power …

Visual of The Rise and Fall or Rayfish Footwear

The Rise and Fall or Rayfish Footwear

For almost three years, we worked on a sneaker company that we knew would go bankrupt on the day it was founded. This is our coming out...

Visual of Twitter Implant becomes a Reality

Twitter Implant becomes a Reality

You all probably know the ' Twitter implant ' from the Nano Supermarket . Scientist at the University of Princeton now created the first working prototype. The implant is actually …

Visual of We want you to be Radically Open

We want you to be Radically Open

Can you do it? Do finish your lunch before clicking the link – or you might vaporise. The video was made by Jason Silva for the ongoing TEDGlobal 2012 which has Radical Openness …

Visual of Will a Cockroach Save Your Life?

Will a Cockroach Save Your Life?

Often cockroaches aren’t people's best friends, but maybe in a few years you will be relieved when you see a cockroach. Researchers of the North Carolina State University …

Visual of Featured Page #06: World Card Wood (Infotizement)

Featured Page #06: World Card Wood (Infotizement)

During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week: The World Card Wood, the worlds' most prestgious and versatile …

Visual of A Stroll Through the Bubbles of Chemicals and Men

A Stroll Through the Bubbles of Chemicals and Men

A stunning pre-history of the anthropocene

Visual of Anthropo-scene #2: The Mind's Lianas

Anthropo-scene #2: The Mind's Lianas

What are the physical forms of the noosphere?

Visual of DIY Body Modification to Hack Evolution

DIY Body Modification to Hack Evolution

Biohacker Tim Cannon inserted a chip into his arm to monitor his bodily data and transmit it to an Android device.

Visual of From Eco-Apartheid to Earth Democracy

From Eco-Apartheid to Earth Democracy

Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.

Visual of Buckle up for Black Sky Thinking

Buckle up for Black Sky Thinking

How can we anticipate what happens after the technological singularity?

Visual of Ghost Imaging: Taking Pictures of the Invisible Thanks to a New 3D Technique

Ghost Imaging: Taking Pictures of the Invisible Thanks to a New 3D Technique

British research group created anew scanning technique permits to obtain 3D images and detect wavelengths that our visual system is not able to see.

Visual of Google Birdhouse Shows Birds Their Way

Google Birdhouse Shows Birds Their Way

Putting the birds into the bird's eye view of Google Maps.

Visual of Grow Your Own - Call for Projects

Grow Your Own - Call for Projects

Science Gallery is calling synthetic biologists, bio-artists, bio-designers, amateur biotechnologists and bio-hackers to submit proposals for projects for their upcoming flagship exhibition GROW YOUR OWN.

Visual of How Social Media Has Changed Our Response to Disaster

How Social Media Has Changed Our Response to Disaster

From the earthquake in Haiti to Hurricane Sandy to the Boston Marathon bombings, Facebook, Twitter and other social media were used to spread information and help citizens and …

Visual of Implanted into Bacteria, Synthetic DNA Functions as a Diagnostic Computer

Implanted into Bacteria, Synthetic DNA Functions as a Diagnostic Computer

In the movie Fantastic Voyage, a submarine and its crew were shrunk and injected into the body of a sick man in an attempt to save his life. Despite the fictional nature of this …

Visual of Ingestible Microchips Monitor Medication

Ingestible Microchips Monitor Medication

Digestible Microchips are now approved by the US Food and Drug Administration.

Visual of Smart Sock Makes Your Feet Speak

Smart Sock Makes Your Feet Speak

A new wearable device provides runners with info on posture, rhythm and stride length.

Visual of Sniffer - Meet the Google Nose

Sniffer - Meet the Google Nose

The Sniffer – aka Google Nose – visualizes odors using a smell sensor, which is as good as a dog’s nose, and a glass in front of your eyes.

Visual of Spy Agencies Infiltrate in Online Games

Spy Agencies Infiltrate in Online Games

For NSA, spying on you isn't enough, they monitor your avatar too.

Visual of Sticky Notes Are The

Sticky Notes Are The "New" USB Drives

The next generation of data portability.

Visual of The (Almost) Invisible Dancing Wheelchair

The (Almost) Invisible Dancing Wheelchair

Designed by a dancer, a new wheelchair moves intuitively with the user's movements.

Visual of We Feel Empathy for Robots (Even if They Don't Look Human)

We Feel Empathy for Robots (Even if They Don't Look Human)

Human test subjects felt empathy for dinosaur robots being cuddled or abused.

Visual of Wi-Fi Visualization: Surrounded by Waves

Wi-Fi Visualization: Surrounded by Waves

An artist visualizes WiFi waves across landmarks in Washington, DC.

Visual of Yes, Naturally

Yes, Naturally

The introductory essay from the Yes, Naturally book - available in our store!

Visual of Anthropocene Exhibition

Anthropocene Exhibition

Next Nature Network will take part in the Deutsches Museum exhibit "Welcome to the Anthropocene: The Earth in Our Hands".

Visual of Cat-like Sensitive Whiskers for Robots

Cat-like Sensitive Whiskers for Robots

Electronic whiskers put sensitive catlike sensors on robots.

Visual of In Vitro Meat: Animal Liberation?

In Vitro Meat: Animal Liberation?

Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.

Visual of Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food

Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food

Food and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.

Visual of Nano Product: Catad'Or

Nano Product: Catad'Or

Catad'Or: the allergy sensitive cutlery.

Visual of Nano Product: IDiO

Nano Product: IDiO

IDiO: the self-diagnosis lens.

Visual of Plastic Pollution Solution

Plastic Pollution Solution

Is there a possibility to clean up the oceans from plastic pollution?

Visual of Scientists Created

Scientists Created "Alien-DNA"

US-scientists extended the DNA alphabet with two new created 'foreign' building-blocks.

Visual of Technology Reflexology

Technology Reflexology

People have complex relationships with their own (and other’s) bodies. In Traditional Chinese Medicine (TCM), it is believed that your feet are a map of your body and can provide …

Visual of The Bionic Kangaroo

The Bionic Kangaroo

The BionicKangaroo technologically reproducesthe unique way a kangaroo moves.

Visual of Bowerbirds' Plastic Love Nest

Bowerbirds' Plastic Love Nest

To attract a female, male bower birds build structures and adorn these with colorful plastic decoration.

Visual of Web Access Is A Basic Human Right

Web Access Is A Basic Human Right

"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.

Visual of Transportations Of The Future

Transportations Of The Future

A selection of nine enthralling and striking concepts of future way of transportation.

Visual of Wearing Technology Under the Skin

Wearing Technology Under the Skin

UnderSkin is a device that would be implanted beneath the skin on your hand and charge off your body’s energy.

Visual of A Robot Scientist Could Cure Malaria

A Robot Scientist Could Cure Malaria

Although there seems to be no effective drug in use to cure malaria, a scientist robot named Eve may have found a cure.

Visual of AI is as Intelligent as a Four-Year-Old Kid

AI is as Intelligent as a Four-Year-Old Kid

Computer can already beat us in many tasks. Complicated calculation, processing speed and chess, to name a few. However, generally speaking, you’re still likely to be more …

Visual of Analogue vs Digital: Handwriting

Analogue vs Digital: Handwriting

Will handwriting soon be history? Or will we always prefer a handwritten love letter from our beloved?

Visual of Could Biomimicry Help us Solve the Refugee Crisis?

Could Biomimicry Help us Solve the Refugee Crisis?

From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.

Visual of Car Paleontology

Car Paleontology

Cars - autonomous, self driving, uncontrollable - are bound to become the animals of the future.

Visual of Electronic Skin can Detect Magnetic Fields

Electronic Skin can Detect Magnetic Fields

There is a new artificial skin technology that could give humans magnetoception in the future.

Visual of Ever-Changing Sceneries with Microbots

Ever-Changing Sceneries with Microbots

Kirsten Zirngibl's illustrations depict imaginary landscapes that are formed by microbots.

Visual of Hyperform: the Future of 3D Printing

Hyperform: the Future of 3D Printing

"However, while 3D printers are becoming increasingly accessible and capable of rivalling the quality of professional equipment, they are still inherently limited by a small print …

Visual of Interview: Liam Young on Speculative Architecture and Engineering the Future

Interview: Liam Young on Speculative Architecture and Engineering the Future

Interview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.

Visual of Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between bio­sciences and society and the importance of communication to overcome the fear of new technologies.

Visual of Intimate Technology Evening at Droog

Intimate Technology Evening at Droog

Droog Foundation and Next Nature Network invites you to join the conversation about Intimate Technology: April 23, in Amsterdam.

Visual of Forget Google Street View, Here's Cat Street View

Forget Google Street View, Here's Cat Street View

Japan city has launched an online street view map to introduce the view of the city by a cat's perspective.

Visual of Tracking Employees' Body Functions to Improve Business Performance

Tracking Employees' Body Functions to Improve Business Performance

In the quest for competitive advantage, companies adopt wearable biometric technologies to monitor employees and improve business results.

Visual of Organs Could Self-Heal with Nanoneedles

Organs Could Self-Heal with Nanoneedles

An international team of scientists used nano-sized needles in order to promote production of new blood cells.

Visual of Speculative Sensing at WDCD 2015

Speculative Sensing at WDCD 2015

On may 21st, Next Nature Network art director Hendrik-Jan Grievink  will host a workshop around the idea of Speculative Sensing: exploring the potential of senses found in nature …

Visual of Stewart Helps People to Trust Self-Driving Car

Stewart Helps People to Trust Self-Driving Car

Stewart is a tactile interface that mediates the communication between human and self-driving car.

Visual of Which Technologies will 2016 Bring?

Which Technologies will 2016 Bring?

The new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …

Visual of How Technology is Becoming More and More Sensitive

How Technology is Becoming More and More Sensitive

Over the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …

Visual of The Golden Quarter

The Golden Quarter

Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?

Visual of Tourism's Impact on Indigenous Tribes

Tourism's Impact on Indigenous Tribes

How does an indigenous culture sustain, extend, and evolve nowadays? Probably, it mainly depends on the preferences of the tourism industry. Here is an example from the Mursi, one …

Visual of Turning Poop Back Into Food

Turning Poop Back Into Food

Nasa funded a program to turn astronauts’ poop into food.

Visual of Talkable Vegetables

Talkable Vegetables

Breaking the silence, vegetables in a Japanese supermarket start to talk to the customers.

Visual of We Are What We Like

We Are What We Like

According to a study our PC, equipped with a list of things we "Like" on Facebook , knows us better than our friends.

Visual of The Advent of Connected Toys

The Advent of Connected Toys

It is the era of smart toys, but they certainly raise difficult questions for parents.

Visual of Bringing Augmented Reality to Fitness

Bringing Augmented Reality to Fitness

Fitbit just released a new motivational feature that aims to trigger their users to go out and exercise more.

Visual of The Biggest Impact on the Planet Comes from Household Consumption

The Biggest Impact on the Planet Comes from Household Consumption

New study suggests that the real environmental problem is embodied in the things we buy.

Visual of Cats Take Over London Underground

Cats Take Over London Underground

Last week nearly 70 portraits of cats replaced all advertisements at the Clapham Common tube station in London.

Visual of I Want Wings!!!!!!!!!!!!!!

I Want Wings!!!!!!!!!!!!!!

Read Nicholas Carr's essay on the transhumanist dream of having wings.

Visual of Feeling Lonely with 1000 Facebook Friends

Feeling Lonely with 1000 Facebook Friends

Loneliness is a major social issue and can only be 'cured' with real world interaction.

Visual of Geography Class via Smartphone

Geography Class via Smartphone

A new Google Maps app is designed to get kids exploring the Himalayas without having to actually go outside.

Visual of How Data Reformed Politics

How Data Reformed Politics

Big data is reforming politics, but is it for the better?

Visual of Technology: Intrusive or Supportive?

Technology: Intrusive or Supportive?

Is the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?

Visual of Let's Talk About Virtue Signalling

Let's Talk About Virtue Signalling

With virtue signalling, the joys of moral superiority are just one click away!

Visual of Explore Mars with NASA's VR Experience

Explore Mars with NASA's VR Experience

Exploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.

Visual of Meet Biomimic Alyssa Stark

Meet Biomimic Alyssa Stark

Using biology as a model for innovation and progress, Alyssa Stark embodies the essence of Biomimicry.

Visual of Meet the Firefighter Drone

Meet the Firefighter Drone

Meet the firefighter drone, she is the best at extinguishing fires and keep every species safe!

Visual of Shark Drones Clean up the Port of Rotterdam

Shark Drones Clean up the Port of Rotterdam

In the port of Rotterdam you might be able to cross a floating Waste Shark: a robot able to collect up to 500 kilos of trash.

Visual of Who Owns the Map?

Who Owns the Map?

In their pursuit of mapping the physical world online, mapping services simultaneously shape our understanding of it too.

Visual of More People Are Too Fat Than Too Thin

More People Are Too Fat Than Too Thin

For the first time in history the world population counts more people who are too fat than too thin.

Visual of Pokémon Go Improves Players' Mental Health

Pokémon Go Improves Players' Mental Health

Pokémon Go is shaping social relationships amongst individuals.

Visual of Fitness Tracker to Make Happy Meal Healthier

Fitness Tracker to Make Happy Meal Healthier

McDonald’s provided their Happy Meals with a high-tech activity tracker toy.

Visual of Robots Taking Government Jobs

Robots Taking Government Jobs

Meet Amelia, the first robot to work along with human coworkers in a council job.

Visual of Will We Share .thought Files?

Will We Share .thought Files?

With the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.

Visual of A Step Further in the Race Against AI

A Step Further in the Race Against AI

Today, we all have superpowers. It may not seem like it because we are attached to our physical devices to use our powers, but with a Neural Lace that may soon change.

Visual of Talking Contact Lenses

Talking Contact Lenses

Researchers at University of Washington have introduced a new wireless communication method that allows small wearable devices to ‘talk’ to everyday devices.

Visual of A Taste of RoboBee Honey

A Taste of RoboBee Honey

Where most researchers are focusing on keeping bees alive, researchers of Harvard are developing a bee replacement; the Robobee. The Robobee is only the size of half a paperclip, with ultra thin wings flapping 120 times per second. The main goal is to build a mechanic pollinator.

Visual of The Interactive Supermarket

The Interactive Supermarket

Coop Italia has opened a flagship store in Milan to present their vision of what grocery shopping might hold for us in 2050.

Visual of We Are more Bacteria than Human

We Are more Bacteria than Human

Our bodies are microbiomes, suffering from our habit of cleanliness.

Visual of VR Surgery and Live Stream Operations

VR Surgery and Live Stream Operations

There is a new breakthrough coming from the operating room: an app, called MDLinking, that connects 8.5 million doctors world wide.

Visual of Welcome to the City Made of Bone

Welcome to the City Made of Bone

Our cities are made out of steel and concrete. What if we replace them with wood and bone?

Visual of Xian'er, When Religion Meets A.I.

Xian'er, When Religion Meets A.I.

A robot monk has been created in China, mixing spirituality with artificial intelligence.

Visual of AI & VR Impact on Architects and Engineers

AI & VR Impact on Architects and Engineers

Future workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.

Visual of Artificial Light Threatens Pollination

Artificial Light Threatens Pollination

A recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.

Visual of Bionic Leaf Helps Vegetables to Grow

Bionic Leaf Helps Vegetables to Grow

Bionic leaf fertilizes crops to make them weigh 150 percent more

Visual of Take Your Data Selfie

Take Your Data Selfie

Do digital footprints match real life goals?

Visual of Design Your Own Vegetables

Design Your Own Vegetables

With her project Future Food Formula, food designer Chloé Rutzerveld is looking for innovative methods to design vegetables.

Visual of The Birth of a Digital Nation in Estonia

The Birth of a Digital Nation in Estonia

Due to its digital citizenship program, something interesting is happening in Estonia. In July there were more new applications for e-citizenship than newborn babies. Are we …

Visual of Experience Death with VR

Experience Death with VR

Virtual reality experiment tries to help people frightened of death with outer-body experience.

Visual of A Fake City for Real Self-Driving Cars

A Fake City for Real Self-Driving Cars

Uber built a fake city called Almono to train self-driving cars. This town is full of fake houses, mannequins and chaotic intersections.

Visual of Female Menstrual Cycle on a Computer Chip

Female Menstrual Cycle on a Computer Chip

The complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.

Visual of Next Nature Habitat VR at SXSW17

Next Nature Habitat VR at SXSW17

This week our virtual reality experience landed at the inaugural VR program of SXSW festival.

Visual of Next Nature Habitat VR Wins Sweden VR Award

Next Nature Habitat VR Wins Sweden VR Award

Our Next Nature Habitat VR experience has won the Sweden International Virtual Reality Award in the category Best 360 Video!

Visual of HUBOT: Meet the Data Waiter

HUBOT: Meet the Data Waiter

As a data waiter you are working at the Tinder restaurant. Upon arrival, visitors log in with their social media account. An intelligent algorithm matches the guests based on …

Visual of Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.

Visual of Letter to Humanity

Letter to Humanity

NNN director Koert van Mensvoort writes a letter to humanity.

Visual of Space Television Network

Space Television Network

Sen is a space television network that provides visuals from other planets in order to prepare us for our multi-planetary life.

Visual of NEW: Next Nature Academy

NEW: Next Nature Academy

The Next Nature Academy offers the philosophy, the tools and the methods that will shift the way you think about nature and technology.

Visual of Do a Next Nature Workshop!

Do a Next Nature Workshop!

NNN organizes workshops using a physical Pyramid of Technology as conceptual tool.

Visual of Old Cows and New Ideas

Old Cows and New Ideas

Will cows still graze fields in an in vitro future? And what might we do with these animals when they naturally die?

Visual of Call for Videos: Intimate Technology

Call for Videos: Intimate Technology

Next Nature Network is curating the One Minutes series for September 2017.

Visual of AI Foodcial Recognition 

AI Foodcial Recognition 

Pic2Recipe is an artificial intelligence system able to recognize ingredients, identify a dish and suggest recipes from a single image.

Visual of Put Your Phone on Theatre Mode in Cinemas

Put Your Phone on Theatre Mode in Cinemas

A new feature rumored to be in the next iOS update called Theater Mode could dim smartphone usage in cinemas.

Visual of Pre-Order the Pyramid of Technology Toolkit

Pre-Order the Pyramid of Technology Toolkit

The Pyramid of Technology toolkit is a workshop-in-a-box that helps you better understand technology and catalyze innovative processes.

Visual of Robot Librarians Instruct Young Generations

Robot Librarians Instruct Young Generations

The Dutch province Gelderland-South uses two educational robots to increase kids' knowledge on such a technology.

Visual of Our Relationship with Tech Is Growing Stronger

Our Relationship with Tech Is Growing Stronger

It's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.

Visual of Dubai Employs First Robotic Police Officer

Dubai Employs First Robotic Police Officer

The first robotic officer will soon report for duty in Dubai.

Visual of Jobs for Caretakers - Robots at Work #1

Jobs for Caretakers - Robots at Work #1

This is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.

Visual of Shazam Your Plant Findings

Shazam Your Plant Findings

Shazam for Plants app lets you catch around 400.000 plant species left on our planet through the lens of your smartphone.

Visual of Solar Powered Electric Cars

Solar Powered Electric Cars

The sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.

Visual of Swap Your Smartphone for a Pineapple

Swap Your Smartphone for a Pineapple

Dutch commercial telecom provider Ben recently launched an advertising campaign to sell smartphone plans by promoting disconnection.

Visual of A Virtual Reality Retreat

A Virtual Reality Retreat

Are we sleepwalking into our technological future?

Visual of Here’s how the Dutch are embracing blockchain in the polder

Here’s how the Dutch are embracing blockchain in the polder

Smiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …

Visual of Chinese farmers are using AI to help rear the world’s biggest pig population

Chinese farmers are using AI to help rear the world’s biggest pig population

It’s been called China’s “pork miracle.” For centuries, pig-rearing in the country was predominantly a backyard occupation. (The etymology of the Chinese character for “home” …

Visual of Call for projects: bring your groundbreaking creativity to tackle pressing energy issues

Call for projects: bring your groundbreaking creativity to tackle pressing energy issues

We need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …

Visual of E-Skin Makes You Control Objects Without Touching Them

E-Skin Makes You Control Objects Without Touching Them

Scientists developed an e-skin that lets the wearer manipulate virtual objects without touching them, by using magnetic fields.

Visual of Three scenarios for the future of farming

Three scenarios for the future of farming

Agriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …

Visual of Why in the future, we will all wear one piece of garment

Why in the future, we will all wear one piece of garment

It's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …

Visual of Smartphone app helps indigenous communities fight deforestation

Smartphone app helps indigenous communities fight deforestation

Five people suspected of illegal gold mining in Peru are in custody after indigenous community members used a system called ForestLink to alert authorities to the activity. …

Visual of Welcome spring with this selection of NANO Supermarket products

Welcome spring with this selection of NANO Supermarket products

Well, we finally made it. After a long, cold, dark winter, spring has officially started today. And guess what it's bringing with it? Nope, not spring flowers: Love flowers! …

Visual of The Story of Money: Bits

The Story of Money: Bits

The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. The final episode: bits.

Visual of This startup uses body heat to mine crypto

This startup uses body heat to mine crypto

While many love to speculate about the sheer number of jobs that robots and artificial intelligence are going to replace in the near future, no one seems to be coming up with any …

Visual of This tiny tooth sensor tracks what you eat, and it could help you be healthier

This tiny tooth sensor tracks what you eat, and it could help you be healthier

The South Beach diet. The Atkins diet. Eating paleo. Cutting out gluten. Going vegan. The list of fad diets and health crazes goes on, yet health statistics in the US and around …

Visual of Your Next Nature guide to Unseen 2018: When Records Melt

Your Next Nature guide to Unseen 2018: When Records Melt

Images largely shape our experience of reality. Just consider how imagery of nature continues to rise in popularity: only a society no longer grounded in their natural landscape …

Visual of Here’s what manufacturing enhanced with virtual reality will look like

Here’s what manufacturing enhanced with virtual reality will look like

Robots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …

Visual of Welcome to the CRISPR baby world—here’s what you should know

Welcome to the CRISPR baby world—here’s what you should know

Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …

Visual of Digital detoxes are a solution looking for a problem

Digital detoxes are a solution looking for a problem

With New Year’s resolutions in full swing, many people may have chosen to cut down on their tech use – or even give it up altogether. The  growing popularity of such “digital …

Visual of Four visions for the future of public transport

Four visions for the future of public transport

The way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …

Visual of How technology bridges the generational communication gap

How technology bridges the generational communication gap

Emoji, Skype, Selfies - can these communication technologies close the generation gap? In part, yes! Young people are teaching senior citizens how to use technology, and it’s …

Visual of First human CRISPR trial in the US aims to cure inherited blindness

First human CRISPR trial in the US aims to cure inherited blindness

Gene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …

Visual of Maurizio Montalti talks nature’s cycle of life

Maurizio Montalti talks nature’s cycle of life

As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …

Visual of Interview: Pirjo Kääriäinen on collaboration and the new ecological biomateriality

Interview: Pirjo Kääriäinen on collaboration and the new ecological biomateriality

Meet Pirjo Kääriäinen, professor of design driven fibre innovation at Aalto University, Finland. Kääriäinen founded CHEMARTS —a collaborative program at the university that brings …

Visual of In conversation with Studio Drift

In conversation with Studio Drift

A flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …

Visual of Next Generation: Get to know Valerie Daude

Next Generation: Get to know Valerie Daude

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Meet Emma: Your colleague of the future comes with a warning

Meet Emma: Your colleague of the future comes with a warning

Emma is in poor health. She has painful varicose veins, stress-related eczema, puffy skin, a grey complexion, red eyes and a hunch-back. She is an imagined office worker of the …

Visual of Next Generation: Unleashing nature’s untapped potential with Amelie Unger

Next Generation: Unleashing nature’s untapped potential with Amelie Unger

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of The social animals that are inspiring new behaviors for robot swarms

The social animals that are inspiring new behaviors for robot swarms

From flocks of birds to fish schools in the sea, or towering termite mounds , many social groups in nature exist together to survive and thrive. This cooperative behaviour can be …

Visual of The religion named Artificial Intelligence

The religion named Artificial Intelligence

Would you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …

Visual of A path to humane technology

A path to humane technology

In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …