Eventually, Drones Will Be Everywhere
Hessel HoogerhuisCity of Drones puts you in a first person view of a drone drifting through an abstract futuristic cityscape.
City of Drones puts you in a first person view of a drone drifting through an abstract futuristic cityscape.
Facebook provides a new tool for suicide prevention
There has been a surge in awareness of the damage that plastic pollution does to our planet in recent years. It has spurred a number of campaigns to remove single-use plastics …
The Smell of Data alerts Internet users in any case of data leakage and communicates digital hazards by means of smell.
Scientists are working on an ingenious approach to carbon capture that will enhance the way plants isolate carbon dioxide from other emissions in order to contain it.
It was announced this week that genetic modification allowed scientists to produce cattle resistant to tuberculosis.
wrote 19th-century scientist and philosopher Hermann von Helmholtz. It was Helmholtz who inspired body-architect Lucy McRae to create Morph?.
Pembient, a West Coast startup, might have a solution to the rhino-poaching problem with its lab-grown rhino horn project.
People with parkinson or other diseases that cause tremors or uncontrable muscular movements, eating is a major challenge. Liftware launches two smart spoons which corrects the unexpected movements of its eaters.
The Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".
A new strain of purple GM tomatoes last longer on shelves and help out cancer-prone mice.
For the closing event of Reprodutopia , a true meeting of minds took place as we discussed the social implications surrounding the future of reproductive technologies. Multiple …
What if women of childbearing age no longer had to interrupt their careers for a pregnancy? In Kuang-Yi Ku ’s project Grandmom Mom, we take a look into the future. In 2050, the …
Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on 23 November 2007 16:30, as part of STRP Art …
A while ago I tried to make a landscape paintings as seen on the Bob Ross television show, yet thing turned out a little bit different in my wilderness. Nature is perhaps the most …
Should men be able to give birth to children? Should we externalize pregnancy with artificial wombs? And are these feminist dreams or frankenstein nightmares? Welcome to …
A report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.
An Australian study has shown the use of lifelike robot babies increased teen pregnancy, rather than discouraging it.
Antonio Esparza designed the TurtleBag: a 3D printable exoskeleton to help turtles distinguish plastic bags from jellyfish and extend their lifespan.
Lately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …
Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …
How will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?
The simulacrum is never that which conceals the truth--it is the truth which conceals that there is none. The simulacrum is true. -Ecclesiastes If we were able to take as the …
After last year’s successful Living labs at DGTL and Welcome to the Village we started 2018 with another. This time with Booking.com at their Annual Meeting in January where over …
Look around you and try to find the most natural thing in the room you are in now. It is you. But for how long? Welcome to the wonderful world of bio design ; a world full of …
For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
An experiment tries to prevent crime by identifying aggressive behavior with new surveillance technology before actual violence is used.
ADE Green returns for the seventh consecutive year to the DeLaMar Theater in Amsterdam. Once more, Amsterdam Dance Event organizes this leading event to ignite sustainable action, …
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
During the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.
As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …
Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
From Friday 28 January - Wednesday 2 Februari the Nano Supermarket will be opened at the Leidseplein in Amsterdam. Additionally, on the 27th of January we will be opened at the …
From 9 - 14 March 2011 the Nano Supermarket opens its doors in Pampona, Spain. The NANO Supermarket presents speculative nanotech products that may hit the shelves within the next …
At Next Nature, we often argue that "our image of nature as static, balanced and harmonious is naive and up for reconsideration ." Paleontologist Peter J. Ward happens to agree. …
Does the moon look lonely? NASA may eventually capture an asteroid to put in orbit around the moon, providing a wealth of research opportunities.
Going to the lustrous SXSW festival in Texas this year? Don't miss out on the Next Nature presentation!
Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
A study, in Language and Cognition has shown that time does not exist as a separate concept for the Brazilian Amondawa – an Amazon tribe first contacted by the outside world in …
On may 21st, Next Nature Network art director Hendrik-Jan Grievink will host a workshop around the idea of Speculative Sensing: exploring the potential of senses found in nature …
According to the Wikipedia page 'Wikipedia: Getting to Philosophy', more than 94% of all articles will eventually lead to the English article "Philosophy".
Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'
Welcome to the access and experience economy. Currency: sweat, blood and action.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Paradise by the Laptop Light is a next nature event with short films, speedlectures, special guests and one laptop. It will be held on 12 September 2008 16:30-17:30, as the …
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image. The facts …
Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.
For every smartphone user to recognize, is that merely the lighting of your screen, a vibration or ring distracts you from almost every activity. Even when you are spending time …
Scientists succeeded in implanting non toxic nano-motors into living cells.
During the 2014 Dutch Design Week, the NANO Supermarket debuts a new line of speculative nano products.
Droog Foundation and Next Nature Network invites you to join the conversation about Intimate Technology: April 23, in Amsterdam.
Tired of drunk people peeing everywhere on the street, people of St. Pauli, Hamburg decided to take a smart step to prevent it.
Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.
Prolonged exposure to artificial light prevents urban trees from adjusting to seasonal variations.
The first cyborg Olympics will take place in Zurich in October.
The robots have arrived! Yesterday we celebrated the launch of HUBOT , job agency for people and robots at MediaMarkt , as part of the Dutch Design Week in Eindhoven. Our virtual …
What do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …
Pink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …
When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
Where were you on the 4th October 2021? During the day that will be remembered for the Facebook outage, not everyone was equally impacted.
The Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.
Written by Kevin Kelly , published in The Technium . I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …
I should tell you the story of how Manko lost a leg. You need to know about this incident to understand his recent works. So please forgive me, I first have to go back to that …
Last Saturday, our Nano Supermarket opened its doors in a pleasurably crowded atmosphere. Below are some snapshots of the opening event. If you happen to be in the neighborhood, …
Is human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …
Coming saturday, your faithful Next Nature editor/designer Hendrik-Jan Grievink will perform Beyond Recognition – a corporate poem about the image of words , at Sameheads Gallery …
On June 10, the digital currency Bitcoin lost 30% of its value in a few hours, dropping from US $28.92 to $20.01 per coin. Bitcoins are a largely untraceable form of money, …
The Next Nature Power Show is an intellectual spectacle where artists, scientists, designers, filmmakers, architects and philosophers present their radical ideas, visionary …
If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
We call upon designers, technologists and artists to submit their speculative nanotech products for the next round of the NANO supermarket.
After the successful introduction of the NANO Supermarket in 2010 it became even more clear that the contest and the presented results produced discussions and many challenges to …
The same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …
The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …
For almost three years, we worked on a sneaker company that we knew would go bankrupt on the day it was founded. This is our coming out...
Floris Kayak discusses online hoaxes and the future of technology.
Volume magazine interviews Next Nature founder Koert van Mensvoort.
An innovative workshop points out future directions for in-vitro meat products.
Scientists are using Twitter, blogs, and news sites to categorize the global psyche.
Because date rape drugs are odorless, colorless and tasteless, victims don't normally realize they've been attacked until it's too late. In a clever, necessary bit of information …
Ever notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …
Sneak peek into your nano future with the brand new NANO Supermarket TV Commercial.
How technology becomes nature in seven steps
Since Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.
Inspired by the award winning In Vitro Meat Cookbook , Next Nature Network and Submarine Channel present Bistro In Vitro : an online design fiction documentary about the future …
The Knotty Object summit promises to be a paradise of anti-disciplinary delight. The event held at the renowned MIT Media Lab gathers designers, scientists, engineers and writers …
Our lustrous NANO Supermarket just opened a 100m2 pop-up store in Norway.
The Random Darknet Shopper, with bitcoin to burn, has purchased counterfeit jeans, master keys, dodgy cigs and even a bag of ecstasy tablets. Who is legally liable?
Read Nicholas Carr's essay on the transhumanist dream of having wings.
The phone call was as unexpected as the American accent at the other end of the line. And when she hung up a few moments later, Ira van Eelen had to stop to catch her breath. More …
The local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …
Today is Earth Day! This means that we think about the relationship between man, nature and technology, as technology is becoming a nature of its own. Acknowledged in 192 …
eSports is the huge industry that’s growing up around competitive online gaming. Let’s take a look at how this cyberpunk sporting world came to be.
The oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …
Humans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …
Bio design crosses the border between the ‘made’ and the ‘born’. Enabling living organisms as essential design elements, it brings us products that adapt, grow, sense and repair …
Up to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …
In 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …
Now here's a perspective: a pooping cow is like a living 3D printer
Mars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …
What if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?
Biosequin, seaweed textiles, and microbe sunscreen: these ideas and more are marking the next wave of bio-innovators during the Biofabricate Summit 2024.
We spoke with the Museum of Edible Earth, a travelling museum dedicated to the prosperous amount of soil samples.
This Fall, the 1st world Bioprinting Congress is organized in Honolulu, Hawai. Four whole days of biopatterning, bioassembly and biofabrication! The ironic choice of location …
In 1998 at the introduction of the iMac , Apple declared that the "i" stood for "internet". Apple later adopted the "i" prefix across its consumer hardware and software lines. …
Yes, I understand the media interest in Second Hype (Of course we don't take it serious as a virtual reality concept. Steering a mouse, sitting behind a flat screen, moving 3D …
The Biggest Visual Power Show is an intellectual show that blends between a conference and a pop concert. Twenty filmers, scientists, designers, artist and thinkers present …
Between the launch of Sputnik on 4 October 1957 and 1 January 2008, approximately 4600 launches have placed some 6000 satellites into orbit, of which about 400 are travelling …
May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …
Using thermochromatic ink, which changes color when the temperature exceeds a specific degree, designer Josien Pieters created a prototype of a dynamic wallpaper that …
By DAVID BARBOZA SHANGHAI — China made public on Tuesday regulations aimed at cracking down on the use of virtual currencies amid worries that a huge underground economy was …
Now here is an experiment any one can do at home: Look around in your house and try to find a consumer product of which you know where it was made and by whom. Got any? Indeed, …
On May 12, 2009 the ACLU and the (not-for-profit) Public Patent Foundation, filed a lawsuit, charging that patents on two human genes associated with breast and ovarian cancer are …
Following anorexia nervosa (under eating) and bulimia nervosa (overeating and compensating), orthorexia nervosa (obsessively healthy eating) is the latest eating disorder in the …
So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …
Talking about nature and nurture as separate, clear-cut forces is far adrift from the complexities of developmental science, says Evelyn Fox Keller in NewScientist . ONE of the …
In this first review of the works of Manko, we'll discuss the complex sorts of plagiarism in Augmented Reality art that are typical for our contemporary art scene. This introduces …
Are we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …
As we are calling for debate-provoking nanotech products that might hit the shelves of the Supermarket in the next ten years , some products much crazier than the ones we could …
The Dutch evening News payed a visit to our Nano Supermarket to familiarize the television viewers with the intricate world of nanotechnology and its potential impact our economy …
Now here is something for the NANO Supermarket : Massachusetts-based Draper Laboratories have developed a special injectable ink with nano–particles. This ink eventually could …
All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
Researchers at the Marine Biological Laboratory at Wood's Hole, Massachusetts, are testing a plan to train fish to catch themselves by using a sound broadcast to attract them into …
Are we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …
When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
Remember the movie Eternal Sunshine of the Spotless Mind, where Jim Carrey removes his memories of a relationship with Kate Winslet? According to researchers at the University of …
Zero: 'Where to begin? We've had many discussions in our Lab about the future of the children. The plan was simple: to raise the kids to the physical age to be 'frozen' in. Then, …
Are we creating the penicillin or the asbestos of the 21st century? Prior to the arrival of the Nano Supermarket , we share some speculative nanotech products with you. Here’s the …
Recently Google slapped our site with a warning that "something's not right here!" It seems that the Drug Enforcement Agency has caught the Next Nature staff handing out baggies …
A panacea Yoghurt? Cures athlete’s foot, acne and dandruff! Triple irradiated Spinach? Three-week shelf life! Funa sushu? Asian carp fresh from Lake Superior! Minority Report …
Christian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the Next Nature …
I've noticed DNA spray notices springing up around Amsterdam. I assumed it was a fairly standard anti-theft device: A crime is committed, a little nozzle is activated by the …
Thanksgiving is fake-for-real. While it's true that there was a minor harvest feast in 1621, held by English immigrants and Wampanoag Indians, the event was never celebrated …
Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
Perhaps it is just us, but somehow the transport of the Nano Supermarket inside a trailer has a next nature quality to it. Peculiar image of the week. The Nano bus, which drives …
A delicious Montepulciano in only 6 seconds? This is now possible with the universal Nano wine. All you need is a microwave oven. In 5,64 seconds at 1000 watt you have a sublime …
Transporting and displaying cold food is an incredibly wasteful and inefficient process. Current display refrigerators, like those that display meats or cheeses in supermarkets, …
Researchers at Stanford and the J. Craig Venter Institute recently created the first complete computer model of an organism. The simulation models the genome and life processes …
Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.
This week our lustrous NANO Supermarket visits Rotterdam as part of Dutch Electronic Art Festival . Come learn, discuss, and taste some medicinal chocolate. Have better ideas for …
From sleek fashion to life-saving medicines. During the forthcoming Dutch Design Week , our lustrous NANO Supermarket debuts a new line of speculative nano products that might hit …
Designed by Luc de Smet, Awear is a speculative bracelet that can detect and record the sources of allergies for children in uncontrolled environments, such as schools and …
In this particular piece of video art, loyal readers of nextnature.net might recognise the building as Zeche Zollverein in Germany, where we organized the Biggest Visual Power …
Now here is a product that should soon find its way into the NANO Supermarket soon. At least, if supermarkets are willing to put it on their shelves, as they currently make huge …
The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …
From april 17-20, a large deal of the Next Nature crew will be in Milan , Italy. We will bring our lustrous Nano Supermarket to this year’s edition of the Salone Internationale …
An interview about the history and promises of synthetic biology, and the problem with the word "nature".
An algorithm observes human players to learn how to beat Super Mario Bros.
Hendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.
If you happen to be in Amsterdam this weekend, attend the other dinner at Waag Society.
Lab grown meat is part of the trajectory that agricultural technology is already following.
Excerpts from the Rebbit AMA with Andras Forgacs, founder of a company that manufactures in vitro meat.
Looking back on the first recorded attack on a human cyborg.
A revolutionary new smartphone for the blind uses a completely tactile interface.
Scientists designed artificial cells built from silicon, able to copy basic functions of life.
Aagje Hoekstra has developed a bioplastic made of of dead beetles called Coleoptera.
During a triathlon ace a drone operated by a local photographer hit one of the athletes.
Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
A jury of design and science experts awarded the best NANO Supermarket product a € 2.500 prize.
The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.
Digital bits have lives. They work for us, but we totally ignore them. What do bits really want? Here are the life stories of four different bits.
Researchers from UC San Diego announced that they have developed 3D print tiny microrobots in the shape of fish able to detect and remove toxin from liquid.
From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.
Studies suggest that Botox impairs the ability to process the emotional content of language, limiting the quality of emotional experiences.
Thanks to the work of researchers at Cornell University (USA), for the first time a litter of puppies was born entirely from in vitro fertilization.
We recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.
The tour of our lustrous NANO Supermarket is coming to Riga, Latvia.
A microbiologist has developed a way to make the cracks in concrete structures heal themselves.
Solar eclipse may impact power supply due to increased use of solar panels
The first ever circus consisting entirely of drones is coming to Amsterdam. This fall the Amsterdam Arena will host a choreographed airshow using nothing but drones combined with …
The Wood-Boring Wasp inspired scientists to create a new robotic needle which will be used in brain surgery.
On the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.
Read Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.
Tracking your workout can help improve the safety and optimize routes for cyclists and pedestrians in your town.
Speculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.
Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.
Interview with Mike Thompson and Susana Cámara Leret.
Cinemas for Millennials will include special sections where texting is allowed.
Extinct European bisons are being reintroduced in parks. But what makes a national park?
A driverless convoy of trucks drove through Europe and safely arrived in Rotterdam yesterday.
Last week the Olympic women’s diving pool at the Maria Lenk Aquatics Centre mysteriously turned swampy green overnight.
In 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.
Go world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.
On August 8, NNN gave a workshop at BioClub Tokyo to share some insights on the future of technologies concerning human reproduction, sexuality and relationships.
Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!
The Juncao Technology Project makes it possible to grow edible and medicinal fungi on chopped grass or herbal plants.
Our Next Nature Habitat VR experience has won the Sweden International Virtual Reality Award in the category Best 360 Video!
We met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.
As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
In the future, artificial wombs could replace incubators as they mimic the natural environment of the female uterus. But what will these devices look like?
Looking for a self-sustainable mobile microhome? Ecocapsule got you covered. This cute-as-pie capsule pod allows you to live completely off the grid in a low-energy, mobile …
Stick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …
Writing is recognised as one of mankind’s foremost inventions and the mechanization of writing is one of these developments that typify what is commonly regarded as the work of …
Rayfish Footwear was a fictional company that offered personalized sneakers crafted from genetically modified stingray leather. This online science fiction story allowed customers …
Well, we finally made it. After a long, cold, dark winter, spring has officially started today. And guess what it's bringing with it? Nope, not spring flowers: Love flowers! …
The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. This episode: plastic.
Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
Arches National Park, located in Utah, is home to some of America's most beautiful rock formations. The most famous of them, Delicate Arch, has always been, well, pretty delicate. So much so that back in the 1940s, park rangers hatched a plan to preserve the natural monument - by coating it in plastic.
Earth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …
The emerging technology of the artificial womb confronts us with a series of moral and societal questions. How to cope with that? Join us on 29 March at Eindhoven University of …
Designers face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …
Lining up plans for Dutch Design Week ? Once more, 2600 designers gather in over 120 locations during 450 events. So whether you're a local, new in town, or just passing through, …
Around the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …
The world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
In science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …
Intensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …
Travelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …
A koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …
In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …
The spread of the coronavirus has led to the cancellation or postponement of many events around the globe. Luckily there are still events we can look forward to, such as the AI …
Tropical forests are one of the world’s largest carbon stores and they help regulate the global climate. But they’re being erased at a terrifying rate. Deforestation claimed an …
Every day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Nonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …
From all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …
At this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …
While Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …
At the bottom of the Earth’s oceans lies an intricate network of over a million kilometres of fibre optic cables. These cables were laid on the seabed by telecommunication …
The influence of humans on the earth can hardly be underestimated. Think of climate change, deforestation, and the decline of biodiversity. We are heading for a sixth mass …
Promising food design projects do not always find their way to producers, the market and ultimately to consumers. Why is that and what can we do to advance these ideas? Why is it …
Pleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.
Global warming is a big challenge for warm-blooded animals, which must maintain a constant internal body temperature. As anyone who’s experienced heatstroke can tell you, our …
A living lamp that you need to feed, a tapestry made of animal waste streams and tableware made from algae. Welcome to the wonderful world of biodesign.
Scientists have discovered the effect of sunscreen on corals. We need to understand our impact on the world to understand its problems.
In 1972, the Club of Rome published The Limits to Growth, a report about the future of the world. They described the limits of the world’s resources and what it is capable of …
Sometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …
AI sure knows how to throw a banger of a dinner party. One that guests will never forget - or outlive. When New Zealand grocery store chain PAK’nSAVE introduced their new …
In 1912, the RMS Titanic met a fateful demise as it crashed into the depths of the North Atlantic Ocean, leaving a mark on the world's collective memory, and igniting a lasting …
Virtual news anchors seem to spread like wildfire across Asia. We've witnessed Xinhua present the news from China and applauded Lisa on becoming India’s first regional AI news …
Visual artist Heleen Blanken explores the complex relationship between people, nature and technology.
Uli Westphal's Seed Series is an ongoing attempt to document the seeds of all edible plants, one seed at a time.
AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
The pictures of the Next Nature Biggest Visual Powershow , in Zollverein are now online! Powershowmaster Koert van Mensvoort and Claudia (most advanced robot in the world). …
Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …
Wearable Interfaces, Smart Materials and Living Fabrics. V2_, Institute for the Unstable Media, Rotterdam, and Amsterdam-based Virtueel Platform, the expertise centre for …
Toasted bread as an information display device (originally developed in 2001 but somehow still intruiging): a toaster that parses meteorological information from the web and then …
The Biggest Visual Power Show is an intellectual show that blends between a conference and a pop concert. Over twenty arists, filmers, philosophers, politicians and designers …
Business card slash micro-terrain by Tur & Partner, landscape architects. It's a portable garden: impregnated with seeds, in the photosynthetic presence of sunlight and water, the …
How to design an expierience of retrieving in nature in the middle of Holland's second-biggest city? Design a park, built entirely from used railway sleepers. That was the basic …
Those crazy Germans are planning to build modern versions of pyramids that will function as gigantic burial sites. "The Great Pyramid can potentially be any human being's grave or …
Let us pretend you are a soldier and you are being sent to war. One of the first questions that should pop into mind: how will you prevent yourself from getting shot? Armor that …
The Augmented Cognition System will help the brain adapt to data on computer-screens. If there's too much/little data, it will decrease/increase the information for you. If the …
Augmented Fish Reality is an interactive installation of five rolling robotic fish-bowl sculptures. These sculptures allow Siamese Fighting fish (Betta Splendons) to use …
At the Biggest Visual Power Show 2006 , held in Zollverein, Germany, over twenty artists, designers, filmmakers and philosophers gave their view on Next Nature. Click to watch the …
John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …
One week left to send in your Designing for Next Nature proposals in round #1 . A selection of the proposals of round#1 is invited for a 5 minute presentation on 23 November 2007 …
Japanese researchers have developed head gear that lets people control devices such as an iPod using their teeth. Now that is not really new, except when you take in mind that …
In the UK farmers recall simple circles appearing on their land for generations. The British media first reported on the circles in the early 1980s. By 1990 crop circles had …
If your house just isn't big enough to have a leopard, you can allways buy these 20.000 dollar cats. Nailcaps are included to prevent scratches on the matching cat furniture. I …
Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …
The US Army Research Lab in collaboration with the University of Delaware developped a special liquid called s hear thickening fluid . It is actually a mixture of hard …
Feel unhappy? Little depressed? Headaches? Why not try a little trip to de Arizona desert? Richard Chaplin built the Interstellar Light Collector. As is often the case, tragedy …
Ever seen a performance of electronic musicians? No matter the genre, these events don't have the reputation of being very lively, rock 'n roll-like experiences. In the best case, …
Next weekend is a good moment for a next nature picnic. The Dutch ministry of Tures (Ministerie van Turen) invited us to their strawcastle (pictured above) for a nice picnic …
Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on Friday 23 November 2007 16:30 - 18:00, as …
"Not A Cornfield" is a project (2005) by Artist Lauren Bon. It's a living sculpture in the form of a field of corn east of Downtown Los Angeles. The site - historically a train …
The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …
Every next nature typically parasites on some older nature, which as a result dries out and eventually vanishes. Only rarely this mechanism is made visible. The Dutch charity …
A review by Djbroadcast on the Paradise by the Laptop Light event last week. Sorry it is all so Dutch. Wat betekent het begrip natuur voor ons vandaag de dag? We zien 'de groene …
March 2007 gave birth to Knut, the übercute baby icebear in the Berlin Zoo. A unique event, since it was 30 years ago a baby icebear was born in the zoo. Within weeks, Knut has …
This installation is called Feed and raises ferns that can survive under conditions of extreme lighting. The television screens provide light to the plants, which grow …
This landscape is titled 'I can not help the way I feel' and was created by John Isaacs . The way in which the flesh grows, erupts and engulfs the body can be seen as a metaphor …
A single hail storm can destroy the year's harvest. For over 25 years, this gun has been used by vine and fruit growers in France, Spain, Austria and Belgium for one purpose: …
Lecture on Next Nature this Wednesday at the UCSD Center for Research in Computing and the Arts in San Diego. Expect wild trees, wild beaches, and wild systems.
Too much carbon emissions warming up the planet? No problem: just bring the stuff back to where you got it from in the first place. Experts have been advising to bury carbon …
This is not a 3-D-animation of a fictional creature, but an actual existing animal: the Angora Rabbit.
Location announcement: The upcoming Biggest Visual Power Show 2008 on Next Nature will take place at the recently renovated Million Dollar Theater on 307 Broadway, Downtown LA. …
The RepRap is a selfreproducing 3D printer. The 3D printer 'prints' his own components by melting tiny plastic particles together. Imagine what would happen if this 3D printer …
Now is a good moment to join the low-volume Next Nature email newsletter featuring the most peculiar of our recent explorations as well as announcements of Next Nature related …
At Massachusetts Institute of Technology , Christopher Love and colleagues are working to find out whether energy from trees can be used to prevent forest fires. A sensor system …
This week we are sneak previewing our forthcoming compilation DVD featuring the best of the Biggest Visual Power Shows at the Picnic 08 - E-art event on 24,25,26 September at …
Are we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …
In our NextNature event BVPS (May 2008), Kevin Kelly spoke of technology as the 7th kingdom of life : a form of evolution whithout the nasty side–effect of dying (Every object …
Eat the fruit. Kiss the Snake. Today 16:30-17:30: Paradise by the Laptop Light is the opening event of the Wereld van Witte de With Festival .
Tru Blood is a synthetic nutrient for vampires that completely eliminates the need to seek sustenance from any living creature. Packaged as a consumer good at your local …
The recent discussion on boomeranged metaphors reminded me of this 20 pound mouse hand created a some years ago for a Paradise by the laptop light event on Next Nature. The …
By MARCEL VAN DER DRIFT. Ten years from now, a cell phone gently sinks to the bottom of the river. It's one of the latest models. The clever design, trendy colours and nifty …
Designer Laura Boffi envisions a future in which human instincts will leap behind on technological progress. For example, once the 'disease called mortality' is cured with …
Forget about palmistry! MRI scans for candidates in top jobs such as bank directors could soon become part of the job-application package, says Erasmus University researcher Prof …
It is a well known secret that plastic hardly breaks down and almost all of the plastic ever made still floats around somewhere . With the great pacific garbage patch now twice …
Apparently, camouflaging oneself with digital patterns rather than nature-imitated patterns functions as a better camouflage within "old-nature" situations. So the digital …
Will we in the future still buy several needs according food in shops, or will we grow M&M’s ourselves? There is a lot happening on in the field of food technology , think for …
A future in which prosthetic patches prevent bodies from aging? Or a sexists view on femininity in robotics? Either way, the question is whether they are up- or downgrades of …
Are you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …
Meet KOBIAN, the humanoid robot that is not only able to walk about and interact with humans, but uses its entire body in addition to its facial expressions to display a full …
The Eco Pod is a experimental design proposal towards the production of clean and renewable energy, which should operate in old, abandoned buildings. Pending an eventual recovery, …
In the depths of northeastern India, one of the wettest places on earth, bridges aren't built – they're grown. What could 21th century architects learn from these dynamic …
So you think climate change is new? So you think the flooding of landmass by the oceans is a new? So you must have not heard of the times when people walked from London to …
Gadgets! You love them when you buy them, but what happens next? Over half of Brits have abandoned gadgets because they don't know how to use them properly. Seventy-one per cent …
Already in the early days of modern civilization, people claimed that they could control the weather. A known example from recent history are the rituals that American Indians …
This smart-looking image is a model of what James M. Tour at Rice University (Texas) and his research team like to call a 'nanocar'. The clustered molecules can roll around on a …
"We live in a time where everything or everyone can be upgraded or ‘pimped'. After the worldwide acceptance of plastic surgery, it was time to subject our worldly possessions …
Getting information as fast as possible and on the spot is the trend. So what could be more direct than having information fired directly into the eye? Today - together with his …
I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …
Have you heard the buzz on virtual money in online games? Some years ago the first virtual millionaire was announced, yet there have also been reports on people being practically …
Besides the extensive collection of animals from around the planet, the Amsterdam City Zoo Artis also houses some local wild species on its premises who immigrated into the zoo on …
The Discovery series 'Ways to save the planet' the episode 'Wrapping Greenland ' shows how Dr. Jason Box uses reflective blankets to cover glaciers in Greenland. Due to global …
This interactive installation came out of the Postgraduate Certificate Course in Advanced Architectural Research of the Bartlett School of Architecture in London. Graduate Justin …
That Next Nature is nothing new can be proven in a walk around Castle Duivenvoorde. The castle dates back from the 11th century, while the gardens date from 1631. In a time where …
Climate change is often thought to have its winners and losers, with Canada, Nordic countries and Russia being portrayed as among the lucky few chilly nations where moderate …
Alright, we were mistaken. Money isn't virtual after all. A recent TV commercial of a Greek bank shed light on the issue. Your money lives, is anthropomorphic and inhabits an …
The Netherlands is known for its outright flat landscape – its even part of the name. How come the Dutch Womans Youth Rafting Team just won the World Cup in the category …
Imagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …
Researchers have designed bacteria that can produce a special glue to knit together cracks in concrete structures. Technews Daily reports the genetically modified microbes have …
If you happen to be in the neighborhood, you may want to attend the lecture I will be throwing at the Follow the Money – The database as a narrative form conference this Thursday …
Nature demanded that we make a choice between immortality and sex, but the Next Nature of the 21st century may not. For help, we can look back to the 20th Century, which had many …
My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …
So, you are well aware that biotech will drive our evolution , you took the crash course on synthetic genomics , you've got your map of the DNA world in your backpack and are now …
Last week I opened a bag of potato crisps that read: "We know the origins of all our ingredients" . As some crisps had already disappeared down my throat, this made me suddenly …
Dusting furniture and floors should be history in forty years time, as special bacteria in a yet to develop cleaning product will be eating the dirt. The speculative cleaning …
Ten days left to submit your speculative product idea for the Nano Supermarket . The jury that will select the finest submissions – to be exhibited in the Nano Supermarket this …
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
If you haven't read the recently posted essay " Razorius Gilletus – On the Origin of a Next Species ?", you probably won't understand much of the following. Anyhow, I'd want to …
Last week, the U.S. Navy announced that four of their “ REMUS 100 ” unmanned underwater vehicles sailed off-radar and stopped responding to commands. The ‘bots were part of a …
Nowadays buttons are completely mundane and natural objects in our environment. You find them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the …
"Until now, the major obstacle that has prevented people from thinking critically about stray shopping carts has been that we have not had any formalized language to differentiate …
What happens when next nature dreams of old nature? Such is the case with extinct animals that have ever come in contact with humans, particularly the dinosaurs, our own …
Anyone who ever saw an x-ray picture of himself will probably recognise the uncanny feeling of staring at your own skull or bones and being confronted by one of nature’s grim …
Traditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …
Modding is the act of adapting hardware/software to have it do what you want it to do, which does not always correlate with what it is originally built to do. Biomodd (ding) is …
Until now, most people have likely regarded bird-feeders as merely a pleasant addition to their gardens. But scientists have now discovered that bird-feeders in the UK are …
Lucy McRae uses spandex to deterritorialize the body. #powershow #bodyart http://bit.ly/th7KyR
In this video, Geert Mul uses online photos to tap into the divine presence in image search #powershow http://bit.ly/uk79b0
In March, Mazda recalled 65,000 cars, not because of any structural faults in the vehicle, but because the engineers had inadvertently created the perfect habitat for a tiny …
Some blackbirds have found city living so much fun (the theater scene! the restaurants!) that they have given up migrating south for the winter. Cities are usually warmer than the …
Renegade architect and futurist Rachel Armstrong has proposed that our cities, currently constructed of dead trees, baked mud, and refined ore, need to be coated in a layer of …
Thinking about Next Nature can sometimes result in a feeling of vertigo. Normal standards are eroded and slowly replaced by next natural ones. A bewildering example can be found …
Want to live a greener life? Eat less meat. Recently the UN appealed for a radical shift in diet , to improve individual health and ease conditions affecting the global …
Another step in the fusion of the made & the born: Surgeons in Sweden have successfully transplanted a fully synthetic, tissue-engineered organ – a trachea– into a man with …
If you felt like building a 2,000 meter mountain in the Netherlands, which features would you like to add? Journalist and accidental landscape visionary Thijs Zonneveld wants to …
This unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …
Arne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow
Manko had been here before. Being just thoughts, surrounded by nothing. He felt glad his thoughts were there, one after the other, so there had to be a form of time and therefore …
Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …
Manko was completely cut off from everything around him, virtually dead, buried alive inside of his own body. He remembered Zero's advice not to panic, but to no effect. He had no …
In the film Mastering Bambi, artists Persijn Broersen and Margit Lukacs have stripped the landscape of its cuddly, anthropomorphic characters. Over the course of the film, the …
Today is your final chance to visit the Nano Supermarket in Amsterdam. So if you happen to be in the neighborhood..
Always wanted to work in a Supermarket? Here is you chance. The Nano Supermarket seeks assistants. The Nano Supermarket assistant is part of a team, knows the products and knows …
Last week our NANO Supermarket was presented at TEDxBrainport in Eindhoven. A good opportunity to show some of our speculative nano products and explain a bit of the why & how …
Pop the champagne! Our must-read coffee table book was officially launched at the delightful and uplifting Next Nature Power Show in Amsterdam. Pictures and video's of the event …
Over the last few days the Next Nature website has been suffering symptoms of dementia due to a hardware failure at our very fancy and luxurious web hosting provider Media Temple …
Intentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …
We tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …
What animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …
Kevin Kelly, Senior Maverick at Wired Magazine talks about the nature of technology and propose to define technology as the 7th Kingdom of Life.
Christien Meindertsma spent three years tracking down every product made from a single pig. Pork made a showing, but the more strange goods were "ammunition, medicine, photo …
The definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …
Ever wished you could take a shower with pigeon poop? Artist Tuur van Balen proposes changing pigeons from flying rats to cleaning agents. A speculative, specially engineered …
The economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …
From the exhibit "What Machines Dream Of" in Berlin comes Life Writer , a work by Christa Sommerer and Laurent Mignonneau. As the participant types, letters are projected on a …
Welcome to earth, #7,000,000,000! Hope you like the #anthropocene. Learn more: http://bit.ly/se1SQc
In The Watchers , the creative geniuses at Studio Smack picture a world where surveillance systems don't just watch us - they actively judge. Are you a green-coded Conformist or …
Part 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …
As mentioned earlier , the world seems obsessed with algae. Not limited to producing light or energy , algae has also found its way to our plate as a new vegetable, and maybe …
Fat is what makes ice cream taste rich and creamy. It's called ice cream, after all, not ice skim milk. So how have some manufacturers managed to make reduced fat ice cream that …
Certain types of bacteria can navigate using magnetic nanoparticles as tiny compasses. Researchers at the University of Leeds have extracted the protein that controls this process …
The Berkeley Robotics & Human Engineering Laboratory is researching a way to improve the performance of human bodies. They are doing innovative research in the field of …
While evidence indicates that humans domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …
Twenty-first century society draws from a world that is less determined by objects and increasingly shaped by connectivity. The clear either/or distinctions that formerly informed …
Although chocolate milk producing cows may sound silly, scientists are seriously analyzing the feasibility of the idea. Why not add genes of cocoa and sugar to a cow, in order to create a cow that produces sweet chocolate milk?
The United States Food and Drug Administration recently approved Elelyso, the first drug to be grown in genetically modified plant cells. Produced in carrot cells, this drug helps …
Filmmaker Jesse Rosten shows his critical views on body standards by presenting the exclusive beauty breakthrough Fotoshop by Adobé. This revolutionary product features pro-pixel …
In vitro meat has been billed as a way to end animal suffering , put a stop to global warming , and solve the world's insatiable demand for animal protein. There's no doubt that …
At the next nature powershow designer Hendrik-Jan Grievink explained how over 1600 blog post on nextnature.net were re-designed & re-edited into a must-read coffee table book.
Life is bleak and bleached for many of the world's corals. Fatal bleaching events triggered by warming seas have become common from the Caribbean to Australia. More worrying still …
Canada-based Okanagan Specialty Fruits is pitching a genetically engineered apple that does not turn brown when bruised or exposed to air. This new technology, available in both …
Using animal blood for building your own house sounds like something from a horror film, but architect Jack Monro has created a set of experimental bricks that take bovine blood …
Humans and other hominids have a reputation for bringing about mass extinctions. Homo erectus has been blamed for the disappearance of many African carnivores, our ancestors …
Plastic is a part of the earth's ecosystem , but it's a part that no one wants. At Harvard, scientists are looking to replace single-use plastic bottles, plates, and cups with …
Peak oil, the point when petroleum extraction is at its maximum, may have already occurred sometime in the last few years . Not only affecting whether we drive a Humvee or not, …
The increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …
As advances in nanotechnology bring us increasingly energy efficient products, plant life such as algae could become attractive sources for tapping energy. The Latro lamp by …
The future of farming is not to be found in further mass-industrialization nor in the return to traditional farming with man and horse power, but rather in swarms of smart, cheap robotic farmers that patiently seed, tend and harvest fields one plant at a time without the need for damaging pesticides.
The world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …
"Earlier today, certain realms were affected by an in-game exploit, resulting in the deaths of player characters and non-player characters in some of the major cities," wrote a …
This weekend some of our sustainable, energy related, NANO Supermarket products are exhibited at the lustrous Lowlands popfestival . Come visit us at the Llowlab to charge your …
Design fiction for the masses. Our NANO Supermarket was presented in the Dutch television show RTL Koffietijd (coffeetime). If you belong to the exquisite 5% visitors of this …
Little over two weeks left to submit your speculative product idea for the Nano Supermarket . The jury that will select the finest submissions – to be exhibited in the Nano …
No, those aren't plastic trinkets or beads from a craft store. They're diatoms, a group of single-celled algae, and unlike almost all of our current technologies, they can rapidly …
As the NANO Supermarket opens discussions on the ethics, purpose and usability of nanotechnology, Frederik De Wilde is researching its artistic possibilities. De Wilde is a guest …
This week our NANO Supermarket will be visiting Milan as part of the Salone Internazionale del Mobile.
In Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …
If you happen to be in the neighborhood you may want to attend the Next Nature lecture at the Island Design March on March 22 in the "most northerly capital in the world". If you …
Some months ago the Rotterdam Think Café organized a Next Nature night featuring a prominent nextnature connoisseur.
While the Pacific garbage patch is often characterized as a dense, Texas-sized island of plastic, in reality it's an area of 2,736 square km scattered with tiny, floating bits of …
Experience full data silence with the Faraday Bag. Made from electromagnetic shielding silver coated fabric, it prevents devices inside it from being contacted. Made by artist …
Closed to commercial shipping and fishing, offshore wind farms aren't put to much use besides generating clean energy. Ecofys , a Dutch sustainable consulting company, hopes to …
You all probably know the ' Twitter implant ' from the Nano Supermarket . Scientist at the University of Princeton now created the first working prototype. The implant is actually …
During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …
At the Next Nature Power Show 2011 our master of ceremony, Koert van Mensvoort gave a mini lecture on our changing notion of Nature.
A new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.
A stunning pre-history of the anthropocene
A device that remotely controls cattle's movements promises to transform the American landscape.
Will writing software eventually replace journalists?
A 23-year-old in China was recently puzzled why his online avatars were being killed off at disproportionate rates. After asking around, the young man eventually discovered that …
Amazon announces they want to use drones to deliver your order within a half hour at any location you choose.
Unpolished creativity at the Next Nature lab from the Industrial Design Department at the Eindhoven University of Technology.
Scientists learn how to harvest electricity from radio waves.
Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
Ultimately existence (or not) for gated communities comes down to the existential choice: should we be afraid of the future?
Science Gallery is calling synthetic biologists, bio-artists, bio-designers, amateur biotechnologists and bio-hackers to submit proposals for projects for their upcoming flagship exhibition GROW YOUR OWN.
From the earthquake in Haiti to Hurricane Sandy to the Boston Marathon bombings, Facebook, Twitter and other social media were used to spread information and help citizens and …
A stem cell experiment with mice may one day mean that same-sex couples could have bio children.
A Facebook version of Monopoly forces players to interact with each other in meatspace.
An interview with Daisy Ginsberg, artist and synthetic biologist.
Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.
Joyce Hwang discusses the challenges for designers, and gains for citizens, of living in a truly biosynthetic city.
How the extinction of mammoths changed the atmosphere.
About 4 or 5 million years ago, major changes in the Earth's climate brought about grassland regions where giant mammals could graze.
In the 1950s, the transition towards what is now known as factory farming picked up speed with farmers.
Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …
Submit your speculative product to the NANO Supermarket and win 2500 euro.
A new material can stop toxic off-gassing from plastics, but the 'new car smell' is so valuable the car industry might not change.
Indulge in the Next Nature stump speech at TEDx from Dr. Van Mensvoort
Only genetic engineering can stop citrus from going commercially extinct. But is the public ready to accept GM orange juice?
A professor and an artist have invented a method to manufacture paint from acid mine runoff.
Buckle up for another cinematic espresso shot from our favorite performance philosopher Jason Silva.
Filter and recover antibiotics from drinking water using only bacteria, water and sunlight.
Beekeepers in France have been puzzled by their bees producing blue and green honey. Turned out the bees were eating waste from an M&Ms factory.
Break out the ketchup: Mark Post has grown the world's first entirely artificial burger from cultured beef cells.
One of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …
JAXA developes a net that could collect debris from outer space.
4th of December Dr Van Mensvoort lectures in New York at the BIOFABRICA summit. Other speakers include Paola Antonelli and Andras Forgac.
In glass capsules endangered rainforest flora will be able to survive regardless of what happens to their natural habitat.
For most of history, poliomyelitis was a relatively unremarkable disease – it caused paralysis and occasionally death, but only in a tiny fraction of those infected. It was …
If you happen to be in Bangkok this week, do consider attending the Creative Unfold conference, featuring prominent 'What if..." thinkers.
At Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook
On the 5th of August, one year after the lab grown hamburger, the In Vitro Meat Cookbook was launched.
Is there a possibility to clean up the oceans from plastic pollution?
Researchers created a robo-feline able to run and bound while completely untethered.
Science Fiction taught us to think of robots as human-like beings, yet the robots that actually make it into your home are more likely to look like furniture.
The Pavlok wristband gives its wearers an electric shock if they fail at hitting work deadlines or completing fitness goals.
Dividing the sidewalk in two lanes: one for cell phone users and one for non-cell phone users.
What if we could drink from a giant drop of water? The bottle of the future has the shape of a soft, hygienic, biodegradable and edible blob.
The top three aspects why people should support cultured meat.
A selection of nine enthralling and striking concepts of future way of transportation.
Robots are coming to replace shopping assistants , teachers , farmers and eventually even nurses!
How cities will function when there are more robots than people working in factories, everything is intelligently interlinked, autos drive autonomously and drones deliver the mail?
With cities covering growing area of land, we humans and our spaces build the new wilderness for animals and plants.
Emily Howell is an interactive interface able to compose and perform her own pieces of music.
A recent project, named GENESI, might make it possible for city infrastructures to communicate with us.
Robots can already read, talk and reason. Yet, they do not seem to have found limits to their artistic skills either. Meet DOUG_1, first the drawing robot.
Researchers are working on artificial organs-on-chips will be used for drug development.
Time ago we wrote about the fact that US Food and Drug Administration was considering whether to approve the first genetically engineered salmon. We have a verdict: from now on …
Last April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …
Scientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.
Project Jacquard makes it possible to weave touch and gesture interactivity into any textile.
To thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.
While the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".
The Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.
Starship, a robot that will remodel our local deliveries system.
The company MyWebwill helped you to manage your digital afterlife. Unfortunately for its subscribers the company itself has now deceased.
Our lustrous NANO Supermarket opened a 100m2 pop-up store in Stavanger, Norway.
Researchers at Nasa's Center for Climate Simulation (NCCS) in Maryland can deploy a supercomputer called the "Discover".
Next Nature at "Mindfulness and Digital Detox: How to Tune Out to Tune In" Conference in Paris.
Next Nature Night on Design & Evolution, Tuesday 30th June.
Koert van Mensvoort will take part in the Nature 3.x: Where is Nature Now? symposium at the University of Minnesota.
We officially launched the Next Nature Movement in The Netherlands. To seal the beginning of the Next Nature Movement, director Koert van Mensvoort donated the first symbolic ECO coin.
Dr. Garth Webb, an optometrist from British Columbia, has invented the Ocumetics Bionic Lens : lenses that after being implanted through an eight minute surgery, improve eyesight …
Sarah Parcak is a pioneering "satellite archaeologist" from University of Alabama, a sort of Indiana Jones with 21st century tech. She has been awarded the 2016 TED Prize for her …
Australian programmer started a social experiment called “Twitch Plays Pokémon”. Over a Million People Play Pokémon in Social Experiment
The first beauty contest judged by complex algorithms has sparked controversy after biased results.
What if a camera would say "no" when you press the shutter because there are already too many similar photos on the internet?
team of computer scientists at the universities of Germany and California has created what they call photoshoping videos in real time.
Part two of a ten part series exploring the design of an invisible technology: money.
Designer and architect Neri Oxman explores how digital fabrication technologies can interact with the biological world. Watch the TED talk.
A road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.
Here's a look at how drones can and will impact the agriculture and farming industry.
An eagle clutching a flying drone is probably not a show that you see everyday, unless you live in the Netherlands.
Seabirds eat floating plastic debris because it smells like food, study finds.
We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
Google launched the Mzansi Experience, a virtual tour to South Africa through Street View.
Due to an algorithmic error, Facebook mistakenly "memorialized" vital user accounts with a banner announcing the user’s passing – turning their friend walls into memorial walls.
Loneliness is a major social issue and can only be 'cured' with real world interaction.
Scientists say they can reverse aging by reprogramming the genome.
Chloé Rutzerveld presents a modern version of the iconic stroopwafel, fully made of vegetables.
CRISPRy cabbage has been served for the first time in the world.
Ground Level Traffic Lights For Smartphone Zombies
Researchers are experimenting with a new technology that would be able to grow drones from chemical compounds.
The eggplant emoji became a political weapon and gain cult status being the forbidden fruit of the web.
Interview with Govert Flint, designer, architect and self-taught artist.
The penguin jumper is designed by the Penguin Foundation, an organization that rescues penguins on the Australian coast who are hit by oils spills.
If you happen to be at San Francisco International Airport on the hectic Holiday time, LiLou, the airport's pig can help you alleviate the stress.
How wild animals and cities are adapting to each other.
Soon we won’t program computers anymore, we’ll train them like dogs.
Madrid's new plans to fight rising temperatures and high pollution rates investing on green urban areas.
American chocolate manufacturer Mondelez reduces the weight of its widely popular Toblerone bars as a result of the Brexit vote.
On King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.
If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …
A polymer film coating can turn contact lenses into computer screens.
Genetic engineers are developing techniques to kill several types of mosquitoes.
Come and check out the NANO Supermarket at SAS Software's Forum BeLux 2016 on October 13 in The Egg Brussels!
Sleeping underwater has always been your dream? Thanks to an ambitious project it will be soon reality.
Being reminded by Facebook that it's your best friends' birthday.
In their pursuit of mapping the physical world online, mapping services simultaneously shape our understanding of it too.
Today there are on average there are some 8000 planes in the sky carrying at least half a million people. On average during the Stone Age there must have been less.
UV Production House reflects on popular online platforms for maker culture.
Part one of a ten part series exploring the design of an invisible technology: money.
An industrial robot just tattooed the first person ever in San Francisco.
With winter just around the corner, salt trucks are getting ready to hit the road spreading tons of salt. Ice free asphalt is necessary to drive safely and keep transports …
Researchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.
The principle behind a time based currency is usually very simple: one hour of work equals a unit of time.
Last week The Hague hosted a festival dedicated to contemporary experiments in music, art and digital culture.
Researchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.
A Californian engineer is using old cellphones and solar panels to save the rainforest ecosystem against deforestation.
United Nations aims at turning a playful technology into a serious medium.
Web 0.0 is sa project by street-artist Biancoshock where web apps are contextualized in real life.
Jasper van Loenen developed a wearable that sends a corrective electrostatic shock to its wearer when visiting an unprotected website.
According to a new study, humankind is now entering the "Age of Plastic". The research investigates the evidence that we are living in the Anthropocene, a time in which humanity is the main geological force.
New York City decided to definitely say goodbye to neglected payphones and replace them with Wi-Fi hotspots.
Sweden's new Icehotel 365 uses solar cooling to stay open all year.
In 1996, Yoshinori Kuwabara at Juntendo University in Tokyo incubated a premature goat fetus by using extrauterine fetal incubation.
One fan has become so impatient for the conclusion to "Game of Thrones", he's programmed an AI to write it for him. Move over, George R.R. Martin!
Global data about animal movements are indispensable in our today international networked world to understand how to safe human health and wildlife simultaneously.
Take a look at this video to get an idea of what life with a virtual anime assistant would look like.
In year 400BCE in ancient Indian Sanskrit epics, 100 princes were created from a jar of ghee.
Danish company develops device to stimulate creativity.
We know how it feels to catch a cold; how might it feel to catch malware?
A series of photographs from the Ciptagelar village in West Java, Indonesia.
Tons of living animals have floated from Japan to the United States traveling across the ocean on plastic junk and debris.
With her project Future Food Formula, food designer Chloé Rutzerveld is looking for innovative methods to design vegetables.
What if you had the choice of sparing your child from diseases and disorders such as Alzheimer’s disease, heart disease or autism?
Mythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.
BladeRanger might have found the ultimate solution for solar panels cleaning putting drones and robots together at work.
We asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.
We had a wonderful first run of the ECO Coin during DGTL festival in Amsterdam.
Virtual reality experiment tries to help people frightened of death with outer-body experience.
To explore deep sea Standfort University developed OceanOne: a humanoid diving robot, which at the same time creates a simulation of the underwater experience on land.
Last week, our NNN fellows gathered to discuss the Next Habitat; how will we work in the future? And how does this affect our personal lives?
This week our virtual reality experience landed at the inaugural VR program of SXSW festival.
When giving first aid, all kinds of emotions are in play. Thus it is important for the victim of an accident to receive emotional assistance and to be mentally supported during an …
What can we learn from listening to the buzz of bees' conversation? With the help of a new monitoring system, a Canadian researcher is hoping to find out.
We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.
Meet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.
If you’ve watched clouds roll by, you know wind moves more steadily in the upper atmosphere. Turbines just can’t reach high-altitude wind energy. Kites can!
NNN director Koert van Mensvoort writes a letter to humanity.
Before a natural disaster hordes of people crowd in supermarkets and fight over the last supplies. It mirrors the savannah with cliques and groups trying to get the available food, water or shelter.
What if you could unlock your phone by simply looking at the camera? According to Apple, this is precisely how the iPhone X will work. But how secure is it?
Will cows still graze fields in an in vitro future? And what might we do with these animals when they naturally die?
A recent study examining the purity of 17 commercial sea salt brands from eight different countries found microplastics in all 17 samples.
It's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.
After mounting criticism from environmentalists, a firefly-themed park in China announced that the glowing bugs will be replaced by lasers.
A smart, huggable bed partner, who also improves your sleep quality. Sounds great, right? Soon, you might be able to order one yourself: Somnox is a soft robotic pillow that gently breathes as you hold it.
The Texas Heart Institute researches in the field of organ transplantation. With the “ghost heart” — an heart organ scrubbed clean of all its former cells, the researches are on the verge of creating a sustainable and effective way of transplanting organs.
What if we rethink the system and instead of building from earth to sky, we do it the other way around?
In New York, observant residents were surprised to see a skyscraper that looked like it was struggling to load its textures.
The Smell of Data documentary will make its online debut on nextnature.net.
The Pollution Pods installation replicates the smell and air quality of five different urban environments, forming the smell of a global economy.
The philosophy behind sponge cities is simple: cities should contribute to solving water related problems instead of causing them.
The story of money, an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. This episode: gold.
The story of money: an accessible roadmap from prehistory to digital age - from cows to credit, from gold mining to bitcoin mining.
The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. This episode: paper.
Wu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.
MIT Media Lab developed pasta programmed on a computer.
Have you already visited our Meat the Future exhibition? Consider this three course meal an introduction to what you may expect.
An external device that helps you conceive, carry and raise a child. Too scary? Or extremely useful? It's up to you to decide, your virtual midwife is here!
In various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …
Smiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …
Calling all bloggers! We’d love to have you on board for the 2018 Border Sessions festival in The Hague (NL). Join our team for behind-the-scenes access to festival events. To …
Humanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …
Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …
Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
There it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …
Dear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …
"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …
Australian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …
Babies' needs aren't complex. And yet, they are. Over the years, parents have found some tricks to ease their babies as well as themselves. Taking a baby for a drive to make them …
For those experiencing symptoms of motion sickness in VR , it’s now possible to step inside a real-life simulation of what it could be like to ski on mars. Last week, desert dust …
Chernobyl is famous as the site of the worst nuclear power accidents in history. The 1986 disaster has come to represent the perils of nuclear energy, much as Hiroshima represents …
Tonight, Studio Drift is launching their debut museum solo exhibition at the Stedelijk Museum in Amsterdam: Coded Nature . As NNN Fellows , this Dutch duo is showcasing a …
The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …
The South Beach diet. The Atkins diet. Eating paleo. Cutting out gluten. Going vegan. The list of fad diets and health crazes goes on, yet health statistics in the US and around …
A team of German researchers published a study earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …
As early as 2009-10 , researchers were looking at Twitter data mining as a way to predict the incidence of flu. At the time, the H1N1 virus, or “swine flu,” had made the jump from …
Images largely shape our experience of reality. Just consider how imagery of nature continues to rise in popularity: only a society no longer grounded in their natural landscape …
Researchers are using VR as an empathy tool to help neurotypical teachers understand their students with autism. There have already been attempts to use VR to help autistic …
Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …
Before social networks, there were episodic characters in our lives - people we've only met once or twice, and we haven’t heard from since. Nowadays whoever, we once add a person …
New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …
“Within a few years it will be possible for a premature baby to continue to mature in an artificial womb,” says gynecologist Guid Oei. It is therefore that the Artificial Womb: …
We live in a world of fast or disposable fashion. This industry is increasingly impacting the environment due to the use of toxic chemicals, water and energy consumption, heavy …
We must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …
You know climate change is real when dead coral Pokémon start to wash up on (virtual) beaches. Behold, Cursola, world’s first dead coral Pokémon. On the origins of Cursola While …
With New Year’s resolutions in full swing, many people may have chosen to cut down on their tech use – or even give it up altogether. The growing popularity of such “digital …
What will you be having for breakfast, lunch or dinner in 2050? Where will this food be sourced? And how will it be prepared? Edible insects? A hamburger made from cultured meat? …
Always thinking about food? What about food that doesn’t exist yet? On the 18th of September at De Studio, Next Nature Network will host a night of talks on the future of food and …
Emoji, Skype, Selfies - can these communication technologies close the generation gap? In part, yes! Young people are teaching senior citizens how to use technology, and it’s …
Leather is one of the oldest and most versatile materials in the world. It’s a supple, tough, relatively strong and durable material and it’s relatively impermeable, yet …
This question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …
Gene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …
Death certificates and commemorative plaques aren’t something you’d normally associate with a glacier. But that is exactly how Iceland recently mourned the loss of 700-year-old …
As a young bio designer at the start of your career, you'll have to overtake all kinds of obstacles. From the collection of living materials to working in a laboratory and …
Nature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …
Solar cells are often considered an eyesore, used for their sustainability yet not for their beauty. Installed on roofs or in solar parks, they take up precious space. Well that’s …
A flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …
The world is developing, climate change is happening and it's time for us to do something. Now. One strategy would be to simply stop eating meat — or at least reduce the amount of …
You might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …
What is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …
We are a network of makers, thinkers, educators and supporters. With members in 44 countries, we are the international network for anyone interested in the debate on our future – …
The rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …
Surrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …
Like it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …
The food chain has always worked roughly like this: sunlight feeds plants. Plants feed insects. Insects and plants feed animals. Plants and animals feed people. Then …
Hooray! This just in: Next Nature Network is granted a significant contribution from the Dutch government intended to develop a Future Lab for design & technology in Eindhoven …
With most of us stuck at home because of lockdown, for the singles around us intimacy may have turned into a distant dream. Could we find our salvation in technology? And what …
Historians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …
Facial recognition is increasingly being used in many countries around the world. In some cases the take up has been dramatic . As a result, people are being observed by cameras …
Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The field of biofabrication is still new to most people. As founder and CEO of Biofabricate, Suzanne Lee shared with us this exciting online event series Creatives in Biotech . If …
The current lockdown in much of Europe has city-dwellers flocking to the countryside to wait out the outbreak sweeping the continent. Seeking relief from coronavirus, urbanites …
Recently, Twitter announced it would be clearing all inactive accounts in an effort to free up dormant usernames and prevent the risk of old accounts being hacked. The new policy …
Biosensors, cultivated meat and spider’s silk. For synthetic biologist and Next Nature ambassador Nadine Bongaerts, these are all advances towards a new world, where polluting …
Current social distancing measures are all about keeping a physical distance from each other in order to flatten the curve. But this does not mean we have to keep a distance from …
Octavio Paz says calls The Invention of Morel , “ without exaggeration… a perfect novel. ” According to Borges, “ to classify [it] as perfect is neither an …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …
Data Dating is an exhibition that explores what it means to find romance in the internet age. Love it or hate it, technology has transformed the way we date. So, how are digital …
For many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …
Play is a core part of a healthy childhood , through which children develop social, communication, cognitive and physical skills. Children’s play adapts to its circumstances. …
A Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …
Interior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …
What does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …
It’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …
Technology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.
Good day astronauts of spaceship Earth! Today it was announced that Next Nature's plans for the Evoluon have been awarded a financial contribution of €7.6 million from the Region …
With 7.9 billion people and counting, the Food and Agricultural Organisation of the United Nations predicts that by 2050, food supply needs to grow by 70% in order to accommodate …
The exhibition "Apocalypse - End Without End" shows that the end is a human invention
Utopianism and dystopianism are themes often found in today’s movies, especially considering the increased awareness of the damage done to the Earth by human activities. Often …
The textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …
We now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …
What is the metaverse and to what extent should we believe that the vision being presented to us is really going to be central to our daily lives?
The digital world has been creeping closer to your face. Was a time when a laptop was about as personal as you got with a computer. Then came smartphones, and a few years later, …
Memories are often considered very personal and private. Yet, in the past few years, people have got used to notifications from social media or phone galleries telling them they …
Can we create a new biosphere on another planet? Documentary "Spaceship Earth" shows how - in the Arizona desert.
In a feat of biomimicry that seamlessly marries biology with physics, tests carried out at the University of Southern California’s Viterbi School of Engineering made fascinating …
Looking at evolution, we see that there’s always a next nature. Nature changes along with us. How will that influence our way of life in the future?
Humans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …
It’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics
Most people think of mammoths as the iconic woolly species from the last Ice Age, which ended around 12,000 years ago. But mammoths originated in Africa around 5 million years …
In an era of high-tech and climate extremes, we are drowning in information while starving for wisdom. Architect Julia Watson imagines a design movement building on indigenous …
In 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …
Here are 5 things you cannot miss at Floriade Expo 2022
The three winners of the Bio, Art & Design (BAD) awards have been announced.
You are in for a surprise when you look at food and concept designer Chloé Rutzerveld 's portfolio. It is hard to believe that somebody so young - she is just 25 - has already …
Climate change will transform how we live, but these tech and policy experts see reason for optimism
A team of researchers from Freiburg University has developed an artificial muscle that may result in improvements in medicine, prosthetics, and implants.
If we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.
Many aspects of the current metaverse were already familiar 143 years ago.
The Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Cyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
What is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …
Humans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.
We are now so used to communicating with some robotic device in our homes. But this skill cost Furbies a national ban in the US.
Demand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …
AI language model ChatGPT has hit the mainstream last year when it became widely accessible to everyone. Next to doing our (home)work, it became also a D&D Dungeon Master , …
There is a banana crisis happening right now. Our beloved yellow fruits are being threatened with extinction due to a fungal infection called Panama disease, which can wipe out …
A significant milestone has been reached as the US Department of Agriculture has granted approval to a vaccine for insects for the very first time. An important breakthrough, …
Lo and behold the new Lotus Eletre Hyper SUV car. It shouldn't be allowed to exist, yet you may meet it in traffic soon.
In a ground-breaking discovery, researchers at the University of Pennsylvania have achieved to produce insulin out of lettuce. There's no need for needles and injections anymore, …
Reduce, reuse, recycle. We know the drill. But how do we cope with a junkyard in space?
Get ready to take your dining experience to literal new heights, soon we are able to enjoy high cuisine at the edge of space. French company Zephalto is introducing extravagant …
Eddie Corwin studies beaver dams and ponds from satellite images in order to restore watercourses and wetlands, and establish nature reserves.
Augment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.
Wondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?
Designer Govert Flint proposes a new office concept, entirely based on movement and play.
To pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.
In conversation with film director Joshua Ashish Dawson about the future of wellness, climate anxiety and healthy cynicism India-born, Los Angeles-based film director Joshua …